Summary for ontology term: 1-month-old human stage

Number of annotations with term: 29

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.160000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCATAACTTGAGTACTGTAGGGGTAACTGGAATTCCTG0.160000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.160000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.120000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.120000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATGATTAAGTGGGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTCCAAACTGGTTATCTAGAGTGCAGGAGAGGAGAGTGGAATTCCTAG0.120000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__ScardoviaTACGTAGGGTGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTTGTTGCGTCTGGTGTGAAAGCTTACTGCTTAACGGTAGGTTGCGCTGGATACGGGCAGGCTTGAGTGCAGTAGGGGAGACTGGAATTCTCGGT0.120000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCTGCCAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTACAGATCTAGAGTATCGGAGGGGAAAGTGGAATTCCTAGT0.120000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.080000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.080000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.375000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.375000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCTTCTTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAAGCTCAGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.375000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.375000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTGATTTAAGTCAGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGGGTTACTTGAGTGTGTTTGAGGTAGGCGGAATGCGTGG0.375000
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__SolobacteriumTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCTGTTAAGTAAGTGGTTAAATTGTTGGGCTCAACCCAATCCAGCCACTTAAACTGGCAGGCTAGAGTATTGGAGAGGCAAGTGGAATTCCATGT0.250000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCATAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATGGAAACTATGGAACTGGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.190476
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGGACGTTAGTAACTGAACGTCCCCTGACGGTATCTAACCAGAAAGCCACGGC0.169014
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGTGGATATTTAAGTGGGATGTGAAATACTCGGGCTTAACCTGGGTGCTGCATTCCAAACTGGATATCTAGAGTGCAGGAGAGGAAAGGAGAATTCCTAG0.153846
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGTGGATATTTAAGTGGGATGTGAAATATCCGGGCTTAACCTGGGTGCTGCATTCCAAACTGGATATCTAGAGTGCAGGAGAGGAAAGGAGAATTCCTAG0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCTAG0.142857
d__BacteriaGACGTAGGGGGCTAGCGTTATTCGGAATTATTGGGCGTAAAGCGCTCGTAGGCGGGAAGACAAGTCCGTGTTGAAAGACCTCGGCTCAACTGAGGGACCGGCTCGGATACTGTTTTTCTTGAGGCAATCAGAGGGTGATGGAATTCCCGG0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCTATAAGTCTGAAGTTAAAGGCAGTGGCTCAACCATTGTTCGCTTTGGAAACTGTAGAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.142857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGCTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCATAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGGCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.142857

Annotations:

common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
227amnonpeaks at age 1 month in baby nasopharynx ( high in age 1-month-old human stage compared to newborn human stage infant stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 2
859amnon high in 1-month-old human stage compared to 6-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 8
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 1-month-old human stage2021-06-13v3No1 / 9
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 10
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 13
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No1 / 14
797amnon high in 1-month-old human stage compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 14
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 15
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 17
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 17
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 18
797amnondominant feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 19
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 20
797amnondominant feces, homo sapiens, infant, germany, breast fed, 1-month-old human stage2021-06-13v3No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
797amnon high in 1-month-old human stage compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 22
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 22
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 27
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No1 / 69
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557

Problems / suggestions? Please email info AT dbbact DOT org