Summary for ontology term: 1-year-old human stage

Number of annotations with term: 110

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.170213
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.170213
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.170213
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.170213
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.170213
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.170213
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__IntestinibacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.170213
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.170213
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__TerrisporobacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.170213
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.148936

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.538462
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.461538
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.461538
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.461538
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.461538
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.461538
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.384615
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.384615
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__LachnoanaerobaculumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCAATGCAAGTCTGAAGTGAAAGGCGTGGGCTCAACCCATGAACTGCTTTGGAAACTGTATAGCTTGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.384615
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.384615

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__AlloiococcusTAGGGAATCTTCCACAATGGGTGCAAGCCTGATGGAGCAATGCCGCGTGAGTGAAGAAGGACTTCGGTTCGTAAAGCTCTGTTGTTGGGGAAGAACACGGATAGGAGTCACTGCCTATCCCTTGACGGTACCCAACCAGAAAGTCACGGC0.315789
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__MoraxellaTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTTTGGTTGTAAAGCACTTTAAGTGGGGAGGAAAAGCTTATGGTTAATACCCATAAGCCCTGACGTTACCCACAGAATAAGCACCGGC0.312500
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__DolosigranulumTAGGGAATCTTCCACAATGGGTGCAAACCTGATGGAGCAATGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTTAGAGAAGAACACGTGCTAGGTAACTACTAGCGCCTTGACGGTATCTAACCAGAAAGTCACGGCT0.268657
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGCCAGGGACGAAGCGTTTTGTGACGGTACCTGGAGAAGAAGCACCGGCTAACTACGTGCCAGCAGCC0.253968
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGCGTAAGTAACTGTGCGCGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.241379
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGTGGGTTAGTAAGTCAGTGGTGAAATCCTGCAGCTTAACTGTAGAATTGCCATTGATACTGCTAGTCTTGAGTGTATTTGAAGTAGCTGGAATAAGTAG0.225352
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__TuricellaTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGACCGCGAGGAAGCCGCCTGGTTGGAAGGGTGGTGACGGTAGTGGTAGAAGAAGCACCGGCTAACTA0.218182
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTATCCAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTAGTAGGCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.207317
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__StreptobacillusTACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCTTAAAGGGCATCTAGGCGGTTTTTCAAGTCAGGGGTGAAAACTTATGGCTCAACTATAAGCTTGCCTTTGAAACTGAAAGACTAGAGTACTGGAAAGGTGGGTGGAACTACACG0.206897
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTCAATTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.203390

Annotations:

common ontology terms
term enrichment score
TermScore
infant0.592527
1-year-old human stage0.575600
12-month-old human stage0.360825
2-year-old human stage0.320000
age 1-3 years0.280788
child0.224900
perth0.202899
LOWER IN 1-year-old human stage0.194805
18-month-old human stage0.176471
recurrent otitis media0.166667
gambia0.160000
sweden0.159696
edo state0.153846
age0.148148
nasopharynx0.139535
LOWER IN 12-month-old human stage0.133779
saliva0.133060
state of victoria0.126984
no dental caries0.119403
nigeria0.117647
LOWER IN under-1-year-old human stage0.116667
homo sapiens0.115635
municipality of umea0.112903
LOWER IN infant0.111851
LOWER IN 2-year-old human stage0.101695
australia0.100000
under-1-year-old human stage0.099174
formula fed0.096552
LOWER IN child0.094637
middle ear0.093750
pemba island0.083333
supragingival dental plaque0.080537
breast fed0.076923
supragingival plaque0.075949
tanzania0.071429
LOWER IN 18-month-old human stage0.068966
15-month-old human stage0.067797
urban slum0.067797
dhaka0.067797
infant stage0.065574
bangladesh0.065574
feces0.063779
germany0.058537
rural community0.058252
kingdom of denmark0.053333
LOWER IN 4-year-old human stage0.051724
4-year-old human stage0.051724
middle ear fluid0.051724
middle ear rinse0.051724
female0.048000
dentition0.038835
LOWER IN 2-month-old human stage0.035398
LOWER IN age 1-3 years0.035398
fiji0.035088
14-month-old human stage0.035088
13-month-old human stage0.035088
11-month-old human stage0.035088
10-month-old human stage0.035088
21-month-old human stage0.035088
20-month-old human stage0.035088
19-month-old human stage0.035088
dental plaque0.035088
LOWER IN age 7 months0.035088
LOWER IN 3-month-old human stage0.034483
age 7 months0.034483
state of california0.034188
ear canal0.033898
external acoustic meatus0.033333
kingdom of the netherlands0.031746
finland0.031746
india0.030303
LOWER IN female0.029851
LOWER IN adult0.029630
nasal cavity0.028986
oral cavity0.027027
united states of america0.019737
LOWER IN control0.019608
LOWER IN 3-year-old human stage0.017857
LOWER IN age 2 months0.017857
LOWER IN 9-month-old human stage0.017857
LOWER IN protein-energy malnutrition0.017857
LOWER IN severe malnutririon0.017857
LOWER IN malnutrition0.017857
severe malnutririon0.017857
protein-energy malnutrition0.017857
malnutrition0.017857
LOWER IN recurrent otitis media0.017857
LOWER IN middle ear rinse0.017857
LOWER IN middle ear fluid0.017857
age 6-12 months0.017857
LOWER IN age 6-12 months0.017857
14-days-old human0.017857
helminthiasis0.017857
3-year-old human stage0.017699
9-month-old human stage0.017699
2-month-old human stage0.017544
parasitic helminthiasis infectious disease0.017544
LOWER IN formula fed0.017544
LOWER IN breast fed0.017391
LOWER IN 1-month-old human stage0.017241
Fraction of dbbact annotations with this term covered by the query
TermScore
1-year-old human stage0.923077
LOWER IN 1-year-old human stage0.909091
12-month-old human stage0.875000
LOWER IN 12-month-old human stage0.833333
18-month-old human stage0.750000
LOWER IN 2-year-old human stage0.750000
age 1-3 years0.750000
LOWER IN under-1-year-old human stage0.700000
LOWER IN 18-month-old human stage0.666667
LOWER IN 2-month-old human stage0.666667
gambia0.666667
LOWER IN age 1-3 years0.666667
2-year-old human stage0.600000
under-1-year-old human stage0.545455
infant0.529412
municipality of umea0.500000
LOWER IN 3-year-old human stage0.500000
LOWER IN age 2 months0.500000
fiji0.500000
edo state0.500000
LOWER IN 9-month-old human stage0.500000
15-month-old human stage0.500000
14-month-old human stage0.500000
13-month-old human stage0.500000
11-month-old human stage0.500000
10-month-old human stage0.500000
state of victoria0.500000
21-month-old human stage0.500000
20-month-old human stage0.500000
19-month-old human stage0.500000
urban slum0.500000
dhaka0.500000
LOWER IN protein-energy malnutrition0.500000
LOWER IN severe malnutririon0.500000
LOWER IN malnutrition0.500000
dental plaque0.500000
severe malnutririon0.500000
protein-energy malnutrition0.500000
malnutrition0.500000
LOWER IN 4-year-old human stage0.500000
4-year-old human stage0.500000
perth0.500000
recurrent otitis media0.500000
LOWER IN recurrent otitis media0.500000
middle ear fluid0.500000
middle ear rinse0.500000
LOWER IN middle ear rinse0.500000
LOWER IN middle ear fluid0.500000
age 6-12 months0.500000
LOWER IN age 6-12 months0.500000
14-days-old human0.500000
helminthiasis0.500000
pemba island0.500000
LOWER IN age 7 months0.500000
LOWER IN infant0.461538
LOWER IN child0.357143
LOWER IN 3-month-old human stage0.333333
3-year-old human stage0.333333
9-month-old human stage0.333333
no dental caries0.333333
infant stage0.333333
bangladesh0.333333
middle ear0.333333
age 7 months0.333333
nasopharynx0.300000
age0.285714
2-month-old human stage0.250000
ear canal0.250000
parasitic helminthiasis infectious disease0.250000
LOWER IN formula fed0.250000
breast fed0.250000
sweden0.214286
external acoustic meatus0.200000
LOWER IN breast fed0.200000
formula fed0.200000
child0.173913
LOWER IN 1-month-old human stage0.166667
age 2 months0.166667
nigeria0.166667
6-month-old human stage0.166667
tanzania0.166667
supragingival dental plaque0.153846
3-month-old human stage0.142857
kingdom of the netherlands0.125000
1-month-old human stage0.125000
finland0.125000
supragingival plaque0.125000
kingdom of denmark0.100000
saliva0.092593
india0.090909
LOWER IN female0.083333
LOWER IN adult0.080000
nasal cavity0.071429
australia0.066667
rural community0.062500
homo sapiens0.061920
oral cavity0.052632
female0.042857
dentition0.041667
germany0.040000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.872727
infant0.672727
feces0.527273
1-year-old human stage0.418182
child0.318182
saliva0.236364
12-month-old human stage0.227273
2-year-old human stage0.218182
australia0.200000
age 1-3 years0.172727
united states of america0.136364
sweden0.127273
perth0.127273
LOWER IN 1-year-old human stage0.109091
germany0.109091
age0.100000
18-month-old human stage0.100000
recurrent otitis media0.100000
nasopharynx0.090909
edo state0.090909
nigeria0.090909
gambia0.090909
LOWER IN 12-month-old human stage0.072727
state of victoria0.072727
no dental caries0.072727
municipality of umea0.063636
LOWER IN infant0.063636
LOWER IN under-1-year-old human stage0.063636
formula fed0.063636
female0.054545
LOWER IN child0.054545
LOWER IN 2-year-old human stage0.054545
under-1-year-old human stage0.054545
rural community0.054545
supragingival plaque0.054545
supragingival dental plaque0.054545
middle ear0.054545
tanzania0.045455
pemba island0.045455
breast fed0.045455
state of california0.036364
kingdom of denmark0.036364
LOWER IN 18-month-old human stage0.036364
15-month-old human stage0.036364
infant stage0.036364
urban slum0.036364
dhaka0.036364
bangladesh0.036364
control0.036364
dentition0.036364
LOWER IN control0.027273
LOWER IN 4-year-old human stage0.027273
4-year-old human stage0.027273
middle ear fluid0.027273
middle ear rinse0.027273
nasal cavity0.018182
kingdom of the netherlands0.018182
LOWER IN 3-month-old human stage0.018182
fiji0.018182
adult0.018182
LOWER IN female0.018182
LOWER IN adult0.018182
14-month-old human stage0.018182
13-month-old human stage0.018182
11-month-old human stage0.018182
10-month-old human stage0.018182
oral cavity0.018182
21-month-old human stage0.018182
20-month-old human stage0.018182
19-month-old human stage0.018182
LOWER IN 2-month-old human stage0.018182
finland0.018182
LOWER IN age 1-3 years0.018182
dental plaque0.018182
external acoustic meatus0.018182
ear canal0.018182
india0.018182
age 7 months0.018182
LOWER IN age 7 months0.018182
LOWER IN 1-month-old human stage0.009091
1-month-old human stage0.009091
3-month-old human stage0.009091
LOWER IN 3-year-old human stage0.009091
3-year-old human stage0.009091
LOWER IN age 2 months0.009091
age 2 months0.009091
9-month-old human stage0.009091
LOWER IN 9-month-old human stage0.009091
6-month-old human stage0.009091
2-month-old human stage0.009091
LOWER IN protein-energy malnutrition0.009091
LOWER IN severe malnutririon0.009091
LOWER IN malnutrition0.009091
severe malnutririon0.009091
protein-energy malnutrition0.009091
malnutrition0.009091
LOWER IN recurrent otitis media0.009091
LOWER IN middle ear rinse0.009091
LOWER IN middle ear fluid0.009091
age 6-12 months0.009091
Number of experiments associating the term to the sequence
TermScore
homo sapiens20.000000
infant18.000000
feces13.000000
1-year-old human stage12.000000
LOWER IN 1-year-old human stage10.000000
child8.000000
12-month-old human stage7.000000
LOWER IN under-1-year-old human stage7.000000
age6.000000
LOWER IN infant6.000000
LOWER IN 2-year-old human stage6.000000
2-year-old human stage6.000000
under-1-year-old human stage6.000000
saliva5.000000
LOWER IN child5.000000
LOWER IN 12-month-old human stage5.000000
nasopharynx3.000000
18-month-old human stage3.000000
sweden3.000000
female3.000000
united states of america3.000000
age 1-3 years3.000000
LOWER IN control3.000000
LOWER IN 18-month-old human stage2.000000
LOWER IN 3-month-old human stage2.000000
adult2.000000
LOWER IN female2.000000
LOWER IN adult2.000000
australia2.000000
LOWER IN 2-month-old human stage2.000000
gambia2.000000
LOWER IN age 1-3 years2.000000
control2.000000
supragingival plaque2.000000
supragingival dental plaque2.000000
LOWER IN 4-year-old human stage2.000000
4-year-old human stage2.000000
nasal cavity1.000000
kingdom of the netherlands1.000000
municipality of umea1.000000
state of california1.000000
LOWER IN 1-month-old human stage1.000000
kingdom of denmark1.000000
1-month-old human stage1.000000
3-month-old human stage1.000000
LOWER IN 3-year-old human stage1.000000
3-year-old human stage1.000000
LOWER IN age 2 months1.000000
age 2 months1.000000
fiji1.000000
9-month-old human stage1.000000
edo state1.000000
nigeria1.000000
LOWER IN 9-month-old human stage1.000000
15-month-old human stage1.000000
14-month-old human stage1.000000
13-month-old human stage1.000000
11-month-old human stage1.000000
10-month-old human stage1.000000
state of victoria1.000000
6-month-old human stage1.000000
oral cavity1.000000
21-month-old human stage1.000000
20-month-old human stage1.000000
19-month-old human stage1.000000
2-month-old human stage1.000000
no dental caries1.000000
infant stage1.000000
urban slum1.000000
dhaka1.000000
bangladesh1.000000
finland1.000000
rural community1.000000
LOWER IN protein-energy malnutrition1.000000
LOWER IN severe malnutririon1.000000
LOWER IN malnutrition1.000000
dental plaque1.000000
severe malnutririon1.000000
protein-energy malnutrition1.000000
malnutrition1.000000
dentition1.000000
perth1.000000
recurrent otitis media1.000000
LOWER IN recurrent otitis media1.000000
middle ear1.000000
middle ear fluid1.000000
middle ear rinse1.000000
external acoustic meatus1.000000
ear canal1.000000
india1.000000
LOWER IN middle ear rinse1.000000
LOWER IN middle ear fluid1.000000
age 6-12 months1.000000
LOWER IN age 6-12 months1.000000
14-days-old human1.000000
parasitic helminthiasis infectious disease1.000000
helminthiasis1.000000
tanzania1.000000
pemba island1.000000
LOWER IN formula fed1.000000
breast fed1.000000
germany1.000000
LOWER IN breast fed1.000000
formula fed1.000000
age 7 months1.000000
LOWER IN age 7 months1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 12-month-old human stage 3-month-old human stage 2-year-old human stage in homo sapiens sweden saliva child )2020-03-18v31 / 1approvedNo
966amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant gambia rural community homo sapiens feces 2022-12-21v31 / 3approvedNo
966amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens rural community gambia infant 2022-12-21v31 / 3approvedNo
966amnon high in severe malnutririon protein-energy malnutrition malnutrition compared to control in feces homo sapiens rural community gambia infant 1-year-old human stage 2022-12-21v31 / 3approvedNo
797amnon high in age 7 months compared to 12-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 4approvedNo
919amnon high in 12-month-old human stage compared to 2-year-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 5approvedNo
966amnon high in control compared to protein-energy malnutrition severe malnutririon malnutrition in 1-year-old human stage infant gambia rural community homo sapiens feces 2022-12-21v31 / 6approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v31 / 6approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v31 / 6approvedNo
919amnon high in 2-month-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 7approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v31 / 7approvedNo
284amnon high in age 2 months compared to 12-month-old human stage in homo sapiens female feces state of california infant 2018-01-27v41 / 8approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v31 / 9approvedNo
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in 2-year-old human stage 1-year-old human stage age 1-3 years child tanzania pemba island feces homo sapiens 2021-01-25v31 / 9approvedNo
227amnoncommon in baby nasopharynx age 6 months to 1 year (common 12-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands)2017-10-30v41 / 10approvedNo
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant 12-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v41 / 10approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v31 / 10approvedNo
797amnon high in formula fed compared to breast fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 10approvedNo
533amnoncommon 12-month-old human stage, homo sapiens, infant, nasopharynx, fiji2019-07-22v41 / 11approvedNo
533amnondominant 12-month-old human stage, homo sapiens, infant, nasopharynx, fiji2019-07-22v41 / 12approvedNo
596amnondominant 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 12approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v31 / 12approvedNo
797amnon high in breast fed compared to formula fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 12approvedNo
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in under-1-year-old human stage age compared to 2-year-old human stage 1-year-old human stage age 1-3 years in homo sapiens feces infant )2017-11-13v41 / 13approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v31 / 13approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v31 / 13approvedNo
605amnon high in middle ear fluid compared to middle ear rinse in 2-year-old human stage 1-year-old human stage australia child age 1-3 years perth recurrent otitis media middle ear 2020-04-07v31 / 13approvedNo
919amnondominant 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 14approvedNo
891amnondominant urban slum, 1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 14approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v31 / 14approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v31 / 14approvedNo
919amnondominant 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, 2-year-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 15approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v31 / 15approvedNo
922amnondominant no dental caries, 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-07-25v41 / 16approvedNo
892amnondominant 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v41 / 16approvedNo
777amnondominant 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 17approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, 15-month-old human stage, oral cavity2022-12-20v41 / 17approvedNo
777amnondominant 18-month-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 18approvedNo
966amnoncommon infant, 1-year-old human stage, gambia, rural community, homo sapiens, feces2022-12-21v31 / 18approvedNo
797amnondominant 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 18approvedNo
736amnondominant 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v31 / 19approvedNo
273amnondominant 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 20approvedNo
892amnondominant 1-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, infant, united states of america, homo sapiens2022-04-07v41 / 20approvedNo
922amnondominant no dental caries, 1-year-old human stage, supragingival dental plaque, supragingival plaque, infant, dentition, united states of america, homo sapiens2022-07-25v41 / 20approvedNo
797amnoncommon 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 15-month-old human stage2022-12-20v41 / 22approvedNo
736amnon high in 2-year-old human stage 1-year-old human stage age 1-3 years child compared to female adult in tanzania pemba island feces homo sapiens 2021-01-25v31 / 22approvedNo
284amnondominant 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 23approvedNo
669amnondominant 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 23approvedNo
797amnoncommon 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 23approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 18-month-old human stage2022-12-20v41 / 24approvedNo
605amnon high in middle ear rinse compared to middle ear fluid in 2-year-old human stage 1-year-old human stage australia child age 1-3 years perth recurrent otitis media middle ear 2020-04-07v31 / 24approvedNo
891amnoncommon 1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 25approvedNo
797amnondominant 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 25approvedNo
966amnondominant feces, homo sapiens, rural community, gambia, 1-year-old human stage, infant2022-12-21v31 / 26approvedNo
605amnon high in control compared to recurrent otitis media in 2-year-old human stage 1-year-old human stage australia nasopharynx child age 1-3 years perth 2020-04-07v31 / 27approvedNo
892amnoncommon supragingival plaque, supragingival dental plaque, 1-year-old human stage, dental plaque, infant, united states of america, homo sapiens2022-04-07v41 / 29approvedNo
922amnoncommon dentition, supragingival plaque, supragingival dental plaque, infant, 1-year-old human stage, no dental caries, united states of america, homo sapiens2022-07-25v41 / 29approvedNo
284amnoncommon 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 30approvedNo
960amnoncommon 15-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 30approvedNo
922amnoncommon no dental caries, infant, 1-year-old human stage, saliva, united states of america, homo sapiens2022-07-25v41 / 33approvedNo
892amnoncommon 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v41 / 33approvedNo
669amnon high in 14-days-old human compared to 12-month-old human stage in sweden infant feces homo sapiens 2020-09-26v41 / 33approvedNo
284amnon high in 12-month-old human stage compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v41 / 35approvedNo
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant finland )2017-11-12v41 / 35approvedNo
669amnoncommon 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 35approvedNo
596amnoncommon 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 36approvedNo
960amnoncommon oral cavity, 15-month-old human stage, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 36approvedNo
233amnon high in 1-year-old human stage age compared to under-1-year-old human stage in feces homo sapiens infant united states of america 2017-11-05v41 / 37approvedNo
892amnon high in 1-year-old human stage infant compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v41 / 40approvedNo
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in dentition supragingival plaque supragingival dental plaque no dental caries united states of america homo sapiens 2022-07-25v41 / 41approvedNo
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in saliva no dental caries united states of america homo sapiens 2022-07-25v41 / 41approvedNo
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant infant stage urban slum homo sapiens feces dhaka bangladesh 2022-04-03v41 / 42approvedNo
797amnon high in age 7 months compared to 12-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 44approvedNo
273amnoncommon 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 46approvedNo
736amnoncommon 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v31 / 49approvedNo
960amnoncommon 18-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 50approvedNo
797amnon high in 12-month-old human stage infant compared to 2-year-old human stage child in formula fed germany homo sapiens feces 2021-06-13v31 / 52approvedNo
45amnonhigher in younf babies compared to 2 year olds in india ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant india )2016-12-19v41 / 56approvedNo
919amnoncommon 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 62approvedNo
872amnon high in infant age 6-12 months under-1-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 63approvedNo
919amnoncommon 2-year-old human stage, 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 65approvedNo
960amnon high in 9-month-old human stage compared to 18-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 74approvedNo
777amnoncommon 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 79approvedNo
777amnon high in 3-month-old human stage infant compared to 18-month-old human stage child in municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 79approvedNo
736amnon high in adult female compared to 2-year-old human stage 1-year-old human stage age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v31 / 79approvedNo
777amnon high in 18-month-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 83approvedNo
919amnon high in 2-year-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 87approvedNo
797amnon high in 12-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v31 / 106approvedNo
797amnon high in 2-year-old human stage child compared to 12-month-old human stage infant in formula fed germany homo sapiens feces 2021-06-13v31 / 139approvedNo
605amnon high in recurrent otitis media compared to control in 2-year-old human stage 1-year-old human stage australia nasopharynx child age 1-3 years perth 2020-04-07v31 / 149approvedNo
273amnon high in 1-month-old human stage age compared to 1-year-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 155approvedNo
919amnon high in 12-month-old human stage compared to 2-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 164approvedNo
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in no dental caries supragingival dental plaque supragingival plaque dentition united states of america homo sapiens 2022-07-25v41 / 167approvedNo
241amnonlower in babies age <1 year compared to age 1-3 years ( high in 2-year-old human stage 1-year-old human stage age age 1-3 years compared to under-1-year-old human stage in homo sapiens feces infant )2017-11-13v41 / 173approvedNo
960amnon high in 18-month-old human stage infant compared to female adult in homo sapiens nigeria edo state feces 2022-12-20v41 / 178approvedNo
777amnon high in 3-year-old human stage compared to 18-month-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 184approvedNo
872amnon high in 1-year-old human stage compared to infant age 6-12 months under-1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 188approvedNo
922amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 200approvedNo
669amnon high in 12-month-old human stage compared to 2-month-old human stage in sweden infant feces homo sapiens 2020-09-26v41 / 212approvedNo
892amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in saliva united states of america homo sapiens 2022-04-07v41 / 216approvedNo
872amnon high in 1-year-old human stage compared to 2-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 233approvedNo
45amnonlower in young babies compared to 2 year olds in india ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant india )2016-12-19v41 / 253approvedNo
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in urban slum infant stage dhaka bangladesh infant homo sapiens feces 2022-04-03v41 / 363approvedNo
960amnon high in 18-month-old human stage compared to 9-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v41 / 407approvedNo
273amnon high in 1-year-old human stage age compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 557approvedNo
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant finland )2017-11-12v41 / 567approvedNo
777amnon high in 18-month-old human stage child compared to 3-month-old human stage infant in municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 583approvedNo
872amnon high in 2-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 704approvedNo
960amnon high in female adult compared to 18-month-old human stage infant in feces edo state nigeria homo sapiens 2022-12-20v41 / 1392approvedNo

Problems / suggestions? Please email info AT dbbact DOT org