Summary for ontology term: 1-year-old human stage

Number of annotations with term: 78

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.104478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.104478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.104478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.104478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__TerrisporobacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.104478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.104478
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.104478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__IntestinibacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.104478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.104478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGCTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.089552

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.384615
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.384615
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.384615
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.384615
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.307692
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.307692
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTACGTAGGGGGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGTCTGTTAGGTCGGGAGTTAAATCCGGGGGCTCAACCCCCGTTCGCTCCCGATACCGGCAGACTTGAGTTTGGTAGGGGAAGGTGGAATTCCTAGT0.307692
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGCCTGTCGTGTAATCCTCTGGCTTAACTGGGGGTGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.307692
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCTCGGCTTAACCGAGGAAGTGCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGGGATGTGAAATACCCGGGCTCAACCTGGGTGCTGCATTCCAAACTGGAAATCTAGAGTGCAGGAGGGGAAAGTGGAATTCCTAG0.307692

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__MoraxellaTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTTTGGTTGTAAAGCACTTTAAGTGGGGAGGAAAAGCTTATGGTTAATACCCATAAGCCCTGACGTTACCCACAGAATAAGCACCGGC0.243902
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__AlloiococcusTAGGGAATCTTCCACAATGGGTGCAAGCCTGATGGAGCAATGCCGCGTGAGTGAAGAAGGACTTCGGTTCGTAAAGCTCTGTTGTTGGGGAAGAACACGGATAGGAGTCACTGCCTATCCCTTGACGGTACCCAACCAGAAAGTCACGGC0.233766
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__DolosigranulumTAGGGAATCTTCCACAATGGGTGCAAACCTGATGGAGCAATGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTTAGAGAAGAACACGTGCTAGGTAACTACTAGCGCCTTGACGGTATCTAACCAGAAAGTCACGGCT0.206897
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGCCAGGGACGAAGCGTTTTGTGACGGTACCTGGAGAAGAAGCACCGGCTAACTACGTGCCAGCAGCC0.192771
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGCGTAAGTAACTGTGCGCGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.179487
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__TuricellaTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGACCGCGAGGAAGCCGCCTGGTTGGAAGGGTGGTGACGGTAGTGGTAGAAGAAGCACCGGCTAACTA0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATAGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGTACTGCTTTGGAAACTGTTAAGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.150000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCACTTTGTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.141593
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGTGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.137931
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAACTCTGTTGTTAGAGAAGAACAGCGCATAGAGTAACTGTTATGCGTGTGACGGTATCTAACCAGAAAGCCACGGC0.136054

Annotations:

common ontology terms
term enrichment score
TermScore
infant0.557029
1-year-old human stage0.536398
12-month-old human stage0.409756
2-year-old human stage0.406977
age 1-3 years0.367742
child0.266436
perth0.264151
recurrent otitis media0.220000
LOWER IN 1-year-old human stage0.189723
sweden0.189189
age0.188841
nasopharynx0.179641
municipality of umea0.152174
LOWER IN 12-month-old human stage0.135593
formula fed0.132075
middle ear0.125000
LOWER IN under-1-year-old human stage0.123711
LOWER IN 2-year-old human stage0.119048
18-month-old human stage0.113636
pemba island0.113636
homo sapiens0.110155
under-1-year-old human stage0.103093
breast fed0.102041
tanzania0.102041
dhaka0.097561
gambia0.097561
saliva0.095672
bangladesh0.093023
LOWER IN infant0.076923
kingdom of denmark0.072727
middle ear fluid0.071429
middle ear rinse0.071429
LOWER IN child0.070175
australia0.070000
feces0.065967
germany0.056338
LOWER IN 18-month-old human stage0.048780
fiji0.048780
LOWER IN age 1-3 years0.048780
age 7 months0.048780
LOWER IN age 7 months0.048780
infant stage0.048193
LOWER IN 3-month-old human stage0.047059
external acoustic meatus0.046512
ear canal0.046512
kingdom of the netherlands0.044444
state of california0.043956
finland0.043478
supragingival dental plaque0.043478
india0.043478
female0.042463
supragingival plaque0.040816
dental plaque0.040816
nasal cavity0.040000
LOWER IN 4-year-old human stage0.025316
4-year-old human stage0.025316
LOWER IN 3-year-old human stage0.025000
3-year-old human stage0.025000
LOWER IN recurrent otitis media0.025000
LOWER IN middle ear rinse0.025000
LOWER IN middle ear fluid0.025000
14-days-old human0.025000
helminthiasis0.025000
LOWER IN 2-month-old human stage0.024691
LOWER IN age 2 months0.024390
age 2 months0.024390
LOWER IN formula fed0.024390
LOWER IN breast fed0.024390
6-month-old human stage0.024096
parasitic helminthiasis infectious disease0.024096
LOWER IN 1-month-old human stage0.023810
1-month-old human stage0.023810
3-month-old human stage0.023529
LOWER IN control0.015209
united states of america0.014854
LOWER IN female0.014184
control0.009479
LOWER IN adult0.007968
adult0.007968
urban slum0.000000
age 6-12 months0.000000
LOWER IN age 6-12 months0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
dhaka1.000000
LOWER IN 4-year-old human stage1.000000
4-year-old human stage1.000000
gambia1.000000
12-month-old human stage0.857143
LOWER IN 2-year-old human stage0.833333
2-year-old human stage0.833333
age 1-3 years0.750000
1-year-old human stage0.666667
LOWER IN 12-month-old human stage0.571429
infant0.538462
LOWER IN 1-year-old human stage0.533333
municipality of umea0.500000
18-month-old human stage0.500000
LOWER IN 18-month-old human stage0.500000
LOWER IN 3-year-old human stage0.500000
3-year-old human stage0.500000
fiji0.500000
bangladesh0.500000
LOWER IN age 1-3 years0.500000
recurrent otitis media0.500000
perth0.500000
LOWER IN recurrent otitis media0.500000
middle ear fluid0.500000
middle ear rinse0.500000
LOWER IN middle ear rinse0.500000
LOWER IN middle ear fluid0.500000
pemba island0.500000
14-days-old human0.500000
helminthiasis0.500000
age 7 months0.500000
LOWER IN age 7 months0.500000
middle ear0.333333
LOWER IN 2-month-old human stage0.333333
LOWER IN under-1-year-old human stage0.315789
nasopharynx0.300000
age0.285714
LOWER IN 3-month-old human stage0.285714
under-1-year-old human stage0.263158
LOWER IN age 2 months0.250000
age 2 months0.250000
external acoustic meatus0.250000
ear canal0.250000
breast fed0.250000
LOWER IN formula fed0.250000
formula fed0.250000
LOWER IN breast fed0.250000
tanzania0.250000
sweden0.200000
6-month-old human stage0.200000
parasitic helminthiasis infectious disease0.200000
child0.194444
kingdom of the netherlands0.166667
LOWER IN 1-month-old human stage0.166667
1-month-old human stage0.166667
LOWER IN infant0.153846
3-month-old human stage0.142857
finland0.142857
supragingival dental plaque0.142857
india0.142857
kingdom of denmark0.125000
LOWER IN child0.111111
supragingival plaque0.100000
dental plaque0.100000
nasal cavity0.090909
saliva0.065217
homo sapiens0.059041
infant stage0.045455
australia0.043478
state of california0.038462
feces0.035032
germany0.034483
female0.031746
LOWER IN female0.015873
LOWER IN control0.010811
united states of america0.008097
LOWER IN adult0.005780
adult0.005780
control0.005405
urban slum0.000000
age 6-12 months0.000000
LOWER IN age 6-12 months0.000000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.820513
infant0.576923
feces0.564103
1-year-old human stage0.448718
child0.423077
12-month-old human stage0.269231
2-year-old human stage0.269231
age 1-3 years0.243590
saliva0.179487
sweden0.179487
australia0.179487
perth0.179487
germany0.153846
age0.141026
recurrent otitis media0.141026
nasopharynx0.128205
LOWER IN 1-year-old human stage0.115385
municipality of umea0.089744
united states of america0.089744
formula fed0.089744
LOWER IN under-1-year-old human stage0.076923
LOWER IN 12-month-old human stage0.076923
middle ear0.076923
18-month-old human stage0.064103
LOWER IN 2-year-old human stage0.064103
under-1-year-old human stage0.064103
female0.064103
breast fed0.064103
tanzania0.064103
pemba island0.064103
kingdom of denmark0.051282
LOWER IN child0.051282
LOWER IN infant0.051282
bangladesh0.051282
dhaka0.051282
infant stage0.051282
urban slum0.051282
state of california0.051282
gambia0.051282
control0.038462
middle ear fluid0.038462
middle ear rinse0.038462
nasal cavity0.025641
kingdom of the netherlands0.025641
LOWER IN 18-month-old human stage0.025641
LOWER IN 3-month-old human stage0.025641
fiji0.025641
finland0.025641
LOWER IN age 1-3 years0.025641
supragingival plaque0.025641
dental plaque0.025641
supragingival dental plaque0.025641
LOWER IN control0.025641
external acoustic meatus0.025641
ear canal0.025641
india0.025641
age 7 months0.025641
LOWER IN age 7 months0.025641
LOWER IN 1-month-old human stage0.012821
1-month-old human stage0.012821
3-month-old human stage0.012821
LOWER IN 3-year-old human stage0.012821
3-year-old human stage0.012821
6-month-old human stage0.012821
LOWER IN age 2 months0.012821
age 2 months0.012821
LOWER IN 4-year-old human stage0.012821
4-year-old human stage0.012821
LOWER IN recurrent otitis media0.012821
LOWER IN middle ear rinse0.012821
LOWER IN middle ear fluid0.012821
age 6-12 months0.012821
LOWER IN age 6-12 months0.012821
LOWER IN formula fed0.012821
LOWER IN breast fed0.012821
LOWER IN 2-month-old human stage0.012821
LOWER IN female0.012821
LOWER IN adult0.012821
adult0.012821
14-days-old human0.012821
parasitic helminthiasis infectious disease0.012821
helminthiasis0.012821
Exp. ID User ID Description Date Region Flag Sequences
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 2-year-old human stage 3-month-old human stage 12-month-old human stage in homo sapiens saliva child sweden )2020-03-18v3No1 / 1
797amnon high in age 7 months compared to 12-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 4
605amnoncommon control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
605amnoncommon external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 7
284amnon high in age 2 months compared to 12-month-old human stage in feces homo sapiens female infant state of california 2018-01-27v4No1 / 8
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 9
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in feces homo sapiens child tanzania age 1-3 years pemba island 2-year-old human stage 1-year-old human stage 2021-01-25v3No1 / 9
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 12-month-old human stage)2017-10-30v4No1 / 10
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 12-month-old human stage)2017-10-30v4No1 / 10
605amnondominant control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 10
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 12-month-old human stage 2021-06-13v3No1 / 10
533amnoncommon homo sapiens, nasopharynx, infant, fiji, 12-month-old human stage2019-07-22v4No1 / 11
533amnondominant homo sapiens, nasopharynx, infant, fiji, 12-month-old human stage2019-07-22v4No1 / 12
596amnondominant homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 12
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 12
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 12-month-old human stage 2021-06-13v3No1 / 12
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnondominant external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnon high in middle ear fluid compared to middle ear rinse in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 13
891amnondominant feces, homo sapiens, infant, bangladesh, dhaka, infant stage, 1-year-old human stage, urban slum2022-04-03v4No1 / 14
605amnoncommon nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
605amnondominant nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
892amnondominant homo sapiens, united states of america, saliva, infant, 1-year-old human stage2022-04-07v4No1 / 16
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 18
797amnondominant feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 18
736amnondominant feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 19
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 20
892amnondominant homo sapiens, united states of america, infant, supragingival plaque, dental plaque, supragingival dental plaque, 1-year-old human stage2022-04-07v4No1 / 20
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 12-month-old human stage2021-06-13v3No1 / 20
736amnon high in child age 1-3 years 2-year-old human stage 1-year-old human stage compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 23
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 23
605amnon high in middle ear rinse compared to middle ear fluid in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 24
891amnoncommon feces, homo sapiens, infant, bangladesh, dhaka, infant stage, 1-year-old human stage, urban slum2022-04-03v4No1 / 25
797amnondominant feces, homo sapiens, infant, germany, formula fed, 12-month-old human stage2021-06-13v3No1 / 25
605amnon high in control compared to recurrent otitis media in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 27
892amnoncommon homo sapiens, united states of america, infant, supragingival plaque, dental plaque, supragingival dental plaque, 1-year-old human stage2022-04-07v4No1 / 29
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
892amnoncommon homo sapiens, united states of america, saliva, infant, 1-year-old human stage2022-04-07v4No1 / 33
669amnon high in 14-days-old human compared to 12-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 33
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
596amnoncommon homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 36
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
892amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 40
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v4No1 / 42
797amnon high in age 7 months compared to 12-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-year-old human stage2018-01-14v4No1 / 46
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 49
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
45amnonhigher in younf babies compared to 2 year olds in india ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 56
872amnon high in infant under-1-year-old human stage age 6-12 months compared to 1-year-old human stage in feces homo sapiens child gambia 2022-02-26v1No1 / 63
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 79
777amnon high in infant 3-month-old human stage compared to child 18-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
736amnon high in female adult compared to child age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
777amnon high in 18-month-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 83
797amnon high in 12-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 106
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
605amnon high in recurrent otitis media compared to control in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 149
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 173
777amnon high in 3-year-old human stage compared to 18-month-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
872amnon high in 1-year-old human stage compared to infant under-1-year-old human stage age 6-12 months in feces homo sapiens child gambia 2022-02-26v1No1 / 188
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
892amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 216
872amnon high in 1-year-old human stage compared to 2-year-old human stage in feces homo sapiens child gambia 2022-02-26v1No1 / 233
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v4No1 / 363
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
872amnon high in 2-year-old human stage compared to 1-year-old human stage in feces homo sapiens child gambia 2022-02-26v1No1 / 704

Problems / suggestions? Please email info AT dbbact DOT org