Summary for ontology term: 2-5 year-old child stage

Number of annotations with term: 142

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.166667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.166667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAGCTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.145833
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATAGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.145833
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGCTTGTCGCGTCTGCTGTGAAAACGCGGGGCTCAACTCCGCGCGTGCAGTGGGTACGGGCAGGCTGGAGTGCGGCAGGGGTGGCTGGAATTCCTGG0.145833
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGAGTGCGCAGGCGGTTTTGCAAGACCGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTGGTGACTGCAAGGCTAGAGTGTGTCAGAGGGAGGTGGAATTCCGCA0.125000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTTGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGGTGGCAGGCGATACGGGCATAACTAGAGTGCTGTAGGGGAGACTGGAATTCCTG0.125000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGTTAAGTCAGCGGTGAAATCTAGGAGCTTAACTCCTAAATTGCCATTGATACTGGCGGGCTTGAGTGTAGATGAGGTAGGCGGAATGCGTGG0.125000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.125000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGTGTAACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.125000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT1.000000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.833333
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae"TACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGATATACAAGTCAGGGGTGAAAACTTAGGGCTCAACTCAAAGCTTGCCTTTGAAACTGTATATCTAGAGTGCTGGAGAGGTGGACGGAACTACACG0.833333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTATCCAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTAGTAGGCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.833333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__LachnoanaerobaculumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCGAAGCAAGTCTGAAGTGAAATGCATGGGCTCAACCCATGAATTGCTTTGGAAACTGTTTGGCTTGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTATTAAGTCAGTGGTGAAAGACGGTGGCTCAACCATCGTTAGCCATTGAAACTGGTAGTCTTGAGTGCAGACAGGGATGCTGGAACTCGTGGT0.666667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.666667
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCTTTCAAGTCAGGGGTGAAAACCTGCGGCTCAACCGCAGGCCTGCCTTTGAAACTGATAGGCTGGAGTACCGGAGAGGTGGACGGAACTGCACG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Propionibacteriaceae;g__TessaracoccusTACGTAGGGTGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTTGTAGGTGGTTTGTCGCGTCGGGAGTGAAAACTCAGGGCTTAACTCTGAGCTTGCTTTCGATACGGGCTGACTTGAGGGAGGTAGGGGAGAATGGAATTCCTGG0.461538
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAGCTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.415842
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTTAGAGAAGAACAGCGCATAGAGTAACTGTTATGCGTGTGACGGTATCTAACCAGAAAGCCACGGC0.415094
d__Bacteria;p__Firmicutes;c__Negativicutes;o__SelenomonadalesTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATTGTAAAGCTCTGTTAATCGGGACGAAAGAGTTCTGTGTAAATAATGCAGAAAAGTGACGGTACCGGAATAGAAAGCCACGG0.384615
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTCTGAAGAAGGCCTTCGGGTTGTAAAGGACTTTTGTCAGGGAAGAAAAGGCTGTTGCTAATATCAGCGGCTGATGACGGTACCTGAAGAATAAGCACCGGC0.383562
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__SoonwooaTGAGGAATATTGGACAATGGGTGGGAGCCTGATCCAGCCATTCCGCGTGCAGGAAGAAGGTCTTATGGATTGTAAACTGCTTTTATATAGGGATAAACCTACTCTCGAGAGGGTAGCTGAAGGTACTATATGAATAAGCACCGGCTAACT0.383562
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAAGGATGACTGTCTTATGGATTGTAAACTTCTTTTATACGGGAATAACAAGAGTCACGTGTGACTCCCTGCATGTACCGTATGAATAAGCATCGGCTAACT0.367647
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGATGCAAATCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATGTGAGAATAAAGTTAGGTATGTATACTTATTTGCATGTATCACATGAATAAGGACCGGCTAATT0.363636
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGGCGTAAGCCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATGCGGGGATAAAAGAGCCCACGTGTGGGTTTTTGCAGGTACCGCATGAATAAGGACCGGCTAATT0.361446
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAAAGTCTGATCCAGCAATTCTGTGTGCACGATGACGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAAAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.360248

Annotations:

common ontology terms
term enrichment score
TermScore
child0.496343
2-5 year-old child stage0.480292
2-year-old human stage0.445230
no dental caries0.260623
4-year-old human stage0.247059
1-year-old human stage0.239791
age 1-3 years0.227092
saliva0.195972
supragingival dental plaque0.179551
6-year-old human stage0.174419
supragingival plaque0.168224
perth0.164706
shandong province0.141414
recurrent otitis media0.134146
sweden0.121457
dental caries0.116667
LOWER IN child0.110429
infant0.107667
LOWER IN 2-year-old human stage0.105860
municipality of umea0.101266
homo sapiens0.098787
LOWER IN 4-year-old human stage0.092511
australia0.087379
tonsil0.080808
3-year-old human stage0.079470
indonesia0.077922
municipality of yogyakarta0.077922
LOWER IN 1-year-old human stage0.077320
middle ear0.075000
LOWER IN 2-5 year-old child stage0.067265
dental plaque0.065789
pemba island0.065789
tonsil surface0.063694
LOWER IN infant0.063191
nasopharynx0.059406
tanzania0.058140
zealand0.053333
daycare0.053333
1-5-years-old human0.053333
age 3-60.053333
state of victoria0.053333
LOWER IN supragingival dental plaque0.052402
medellin metropolitan area0.051948
gambia0.051948
LOWER IN supragingival plaque0.051502
formula fed0.049383
feces0.048244
colombia0.048193
palatine tonsil0.048193
LOWER IN adult0.047904
LOWER IN saliva0.047809
dentition0.045161
kingdom of denmark0.043956
germany0.041096
5-year-old human stage0.040541
18-month-old human stage0.040541
LOWER IN 12-month-old human stage0.040541
middle ear fluid0.040541
middle ear rinse0.040541
tonsil tissue0.040541
LOWER IN tonsil surface0.040541
dental black stain0.040541
no dental black stain0.040541
iron deficiency anemia0.040541
no iron deficiency anemia0.040541
italy0.040268
autistic disorder0.039735
china0.038471
LOWER IN control0.029586
control0.029412
adult0.028736
LOWER IN age 1-3 years0.027586
LOWER IN human adult stage0.027586
daxin county0.027397
LOWER IN 3-year-old human stage0.027397
LOWER IN 6-12 year-old child stage0.027397
LOWER IN age 8-120.027397
age 8-120.027397
LOWER IN age 3-60.027397
tonsillar hypertrophy0.027397
LOWER IN tonsil0.027397
21-month-old human stage0.027397
20-month-old human stage0.027397
19-month-old human stage0.027397
orenburg0.027397
ear canal0.026667
12-month-old human stage0.026667
breast fed0.026667
6-12 year-old child stage0.026667
LOWER IN under-1-year-old human stage0.026316
external acoustic meatus0.026316
under-1-year-old human stage0.026144
LOWER IN dental caries0.025641
jiangsu province0.025316
human adult stage0.024845
russia0.024390
rural community0.022989
age0.021739
LOWER IN 5-year-old human stage0.013889
LOWER IN 7-year-old human stage0.013889
Fraction of dbbact annotations with this term covered by the query
TermScore
2-year-old human stage0.900000
LOWER IN 2-year-old human stage0.875000
2-5 year-old child stage0.875000
LOWER IN 2-5 year-old child stage0.750000
4-year-old human stage0.750000
LOWER IN 4-year-old human stage0.750000
age 1-3 years0.750000
3-year-old human stage0.666667
LOWER IN age 1-3 years0.666667
LOWER IN human adult stage0.666667
no dental caries0.666667
5-year-old human stage0.500000
municipality of umea0.500000
daxin county0.500000
LOWER IN 3-year-old human stage0.500000
18-month-old human stage0.500000
LOWER IN 5-year-old human stage0.500000
LOWER IN 12-month-old human stage0.500000
LOWER IN 7-year-old human stage0.500000
LOWER IN 6-year-old human stage0.500000
zealand0.500000
6-year-old human stage0.500000
dental plaque0.500000
LOWER IN dental plaque0.500000
age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
daycare0.500000
1-5-years-old human0.500000
LOWER IN trichuriasis0.500000
trichuriasis0.500000
LOWER IN age 0-6 months0.500000
perth0.500000
recurrent otitis media0.500000
LOWER IN recurrent otitis media0.500000
middle ear fluid0.500000
middle ear rinse0.500000
LOWER IN middle ear rinse0.500000
LOWER IN middle ear fluid0.500000
helminthiasis0.500000
pemba island0.500000
LOWER IN 6-12 year-old child stage0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
tonsillar hypertrophy0.500000
tonsil tissue0.500000
LOWER IN tonsil surface0.500000
LOWER IN tonsil0.500000
21-month-old human stage0.500000
20-month-old human stage0.500000
19-month-old human stage0.500000
state of victoria0.500000
LOWER IN tonsil tissue0.500000
orenburg0.500000
dental black stain0.500000
no dental black stain0.500000
iron deficiency anemia0.500000
no iron deficiency anemia0.500000
LOWER IN no iron deficiency anemia0.500000
LOWER IN iron deficiency anemia0.500000
LOWER IN no dental black stain0.500000
LOWER IN dental black stain0.500000
LOWER IN no dental caries0.500000
1-year-old human stage0.461538
LOWER IN 1-year-old human stage0.454545
LOWER IN child0.428571
LOWER IN supragingival dental plaque0.375000
child0.347826
LOWER IN 18-month-old human stage0.333333
LOWER IN age 1-7 years0.333333
age 1-7 years0.333333
medellin metropolitan area0.333333
middle ear0.333333
LOWER IN 14-year-old human stage0.333333
LOWER IN 13-year-old human stage0.333333
14-year-old human stage0.333333
LOWER IN fifth decade human stage0.333333
autistic disorder0.333333
LOWER IN autistic disorder0.333333
tonsil surface0.333333
gambia0.333333
supragingival dental plaque0.307692
LOWER IN infant0.307692
LOWER IN supragingival plaque0.300000
7-year-old human stage0.250000
supragingival plaque0.250000
ear canal0.250000
parasitic helminthiasis infectious disease0.250000
12-month-old human stage0.250000
breast fed0.250000
13-year-old human stage0.250000
6-12 year-old child stage0.250000
LOWER IN 65-79 year-old human stage0.250000
fifth decade human stage0.250000
65-79 year-old human stage0.250000
shandong province0.250000
Fraction of annotations for the query sequences containing the term
TermScore
child0.866197
homo sapiens0.802817
saliva0.401408
2-5 year-old child stage0.330986
feces0.316901
2-year-old human stage0.295775
china0.267606
united states of america0.225352
1-year-old human stage0.161972
no dental caries0.161972
4-year-old human stage0.147887
age 1-3 years0.133803
supragingival dental plaque0.126761
supragingival plaque0.126761
australia0.126761
sweden0.105634
6-year-old human stage0.105634
perth0.098592
shandong province0.098592
dental caries0.098592
infant0.077465
recurrent otitis media0.077465
LOWER IN child0.063380
municipality of umea0.056338
LOWER IN 2-year-old human stage0.056338
control0.056338
tonsil0.056338
LOWER IN 4-year-old human stage0.049296
dentition0.049296
3-year-old human stage0.042254
LOWER IN 1-year-old human stage0.042254
indonesia0.042254
municipality of yogyakarta0.042254
nasopharynx0.042254
middle ear0.042254
germany0.042254
italy0.042254
LOWER IN 2-5 year-old child stage0.035211
dental plaque0.035211
LOWER IN infant0.035211
adult0.035211
LOWER IN control0.035211
tanzania0.035211
pemba island0.035211
tonsil surface0.035211
zealand0.028169
kingdom of denmark0.028169
LOWER IN supragingival plaque0.028169
LOWER IN supragingival dental plaque0.028169
LOWER IN saliva0.028169
colombia0.028169
medellin metropolitan area0.028169
daycare0.028169
1-5-years-old human0.028169
LOWER IN adult0.028169
formula fed0.028169
age 3-60.028169
palatine tonsil0.028169
state of victoria0.028169
gambia0.028169
5-year-old human stage0.021127
18-month-old human stage0.021127
LOWER IN 12-month-old human stage0.021127
middle ear fluid0.021127
middle ear rinse0.021127
autistic disorder0.021127
tonsil tissue0.021127
LOWER IN tonsil surface0.021127
dental black stain0.021127
no dental black stain0.021127
iron deficiency anemia0.021127
no iron deficiency anemia0.021127
rural community0.014085
daxin county0.014085
LOWER IN 3-year-old human stage0.014085
under-1-year-old human stage0.014085
LOWER IN under-1-year-old human stage0.014085
LOWER IN age 1-3 years0.014085
age0.014085
LOWER IN human adult stage0.014085
human adult stage0.014085
external acoustic meatus0.014085
ear canal0.014085
12-month-old human stage0.014085
breast fed0.014085
LOWER IN 6-12 year-old child stage0.014085
LOWER IN age 8-120.014085
6-12 year-old child stage0.014085
age 8-120.014085
LOWER IN age 3-60.014085
jiangsu province0.014085
tonsillar hypertrophy0.014085
LOWER IN tonsil0.014085
21-month-old human stage0.014085
20-month-old human stage0.014085
19-month-old human stage0.014085
orenburg0.014085
russia0.014085
LOWER IN dental caries0.014085
LOWER IN 18-month-old human stage0.007042
Number of experiments associating the term to the sequence
TermScore
homo sapiens17.000000
child16.000000
feces10.000000
2-year-old human stage9.000000
saliva7.000000
LOWER IN 2-year-old human stage7.000000
2-5 year-old child stage7.000000
infant6.000000
1-year-old human stage6.000000
LOWER IN child6.000000
LOWER IN 1-year-old human stage5.000000
adult5.000000
LOWER IN control5.000000
china4.000000
supragingival dental plaque4.000000
supragingival plaque4.000000
LOWER IN infant4.000000
control4.000000
LOWER IN adult4.000000
LOWER IN 12-month-old human stage3.000000
LOWER IN 2-5 year-old child stage3.000000
4-year-old human stage3.000000
LOWER IN 4-year-old human stage3.000000
age 1-3 years3.000000
LOWER IN supragingival plaque3.000000
LOWER IN supragingival dental plaque3.000000
LOWER IN saliva3.000000
sweden2.000000
3-year-old human stage2.000000
18-month-old human stage2.000000
under-1-year-old human stage2.000000
LOWER IN under-1-year-old human stage2.000000
6-year-old human stage2.000000
united states of america2.000000
LOWER IN age 1-3 years2.000000
LOWER IN human adult stage2.000000
human adult stage2.000000
australia2.000000
12-month-old human stage2.000000
no dental caries2.000000
5-year-old human stage1.000000
municipality of umea1.000000
rural community1.000000
daxin county1.000000
LOWER IN 3-year-old human stage1.000000
LOWER IN 18-month-old human stage1.000000
LOWER IN 5-year-old human stage1.000000
LOWER IN age 1-7 years1.000000
age 1-7 years1.000000
LOWER IN 7-year-old human stage1.000000
7-year-old human stage1.000000
LOWER IN 6-year-old human stage1.000000
zealand1.000000
kingdom of denmark1.000000
age1.000000
dental plaque1.000000
LOWER IN dental plaque1.000000
age 0-6 months1.000000
indonesia1.000000
municipality of yogyakarta1.000000
colombia1.000000
medellin metropolitan area1.000000
daycare1.000000
1-5-years-old human1.000000
LOWER IN trichuriasis1.000000
trichuriasis1.000000
LOWER IN age 0-6 months1.000000
nasopharynx1.000000
perth1.000000
recurrent otitis media1.000000
LOWER IN recurrent otitis media1.000000
middle ear1.000000
middle ear fluid1.000000
middle ear rinse1.000000
external acoustic meatus1.000000
ear canal1.000000
LOWER IN middle ear rinse1.000000
LOWER IN middle ear fluid1.000000
parasitic helminthiasis infectious disease1.000000
helminthiasis1.000000
tanzania1.000000
pemba island1.000000
formula fed1.000000
germany1.000000
breast fed1.000000
LOWER IN 14-year-old human stage1.000000
LOWER IN 13-year-old human stage1.000000
LOWER IN 6-12 year-old child stage1.000000
age 3-61.000000
LOWER IN age 8-121.000000
LOWER IN age 13-141.000000
14-year-old human stage1.000000
13-year-old human stage1.000000
6-12 year-old child stage1.000000
age 8-121.000000
age 13-141.000000
LOWER IN age 3-61.000000
LOWER IN fifth decade human stage1.000000
LOWER IN 65-79 year-old human stage1.000000
fifth decade human stage1.000000
65-79 year-old human stage1.000000
jiangsu province1.000000
italy1.000000
autistic disorder1.000000
LOWER IN autistic disorder1.000000
tonsil surface1.000000
tonsil1.000000
palatine tonsil1.000000
tonsillar hypertrophy1.000000
tonsil tissue1.000000
LOWER IN tonsil surface1.000000
LOWER IN tonsil1.000000
21-month-old human stage1.000000
20-month-old human stage1.000000
19-month-old human stage1.000000
state of victoria1.000000
LOWER IN tonsil tissue1.000000
dentition1.000000
orenburg1.000000
russia1.000000
dental black stain1.000000
shandong province1.000000
no dental black stain1.000000
iron deficiency anemia1.000000
dental caries1.000000
no iron deficiency anemia1.000000
LOWER IN no iron deficiency anemia1.000000
LOWER IN iron deficiency anemia1.000000
LOWER IN no dental black stain1.000000
LOWER IN dental black stain1.000000
LOWER IN no dental caries1.000000
LOWER IN dental caries1.000000
gambia1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 12-month-old human stage 3-month-old human stage 2-year-old human stage in homo sapiens sweden saliva child )2020-03-18v31 / 1approvedNo
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v41 / 3approvedNo
564amnon high in autistic disorder compared to control in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v31 / 5approvedNo
919amnon high in 12-month-old human stage compared to 2-year-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 5approvedNo
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v41 / 6approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v31 / 6approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v31 / 6approvedNo
892amnon high in 4-year-old human stage compared to 2-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v41 / 7approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v31 / 7approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v31 / 9approvedNo
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in 2-year-old human stage 1-year-old human stage age 1-3 years child tanzania pemba island feces homo sapiens 2021-01-25v31 / 9approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v31 / 10approvedNo
983amnon high in supragingival plaque supragingival dental plaque compared to saliva in child 2-5 year-old child stage china homo sapiens 2022-12-26v31 / 10approvedNo
983amnon high in tonsil tissue compared to tonsil surface in tonsil child 2-5 year-old child stage china homo sapiens 2022-12-26v31 / 11approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v31 / 12approvedNo
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in under-1-year-old human stage age compared to 2-year-old human stage 1-year-old human stage age 1-3 years in homo sapiens feces infant )2017-11-13v41 / 13approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v31 / 13approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v31 / 13approvedNo
605amnon high in middle ear fluid compared to middle ear rinse in 2-year-old human stage 1-year-old human stage australia child age 1-3 years perth recurrent otitis media middle ear 2020-04-07v31 / 13approvedNo
596amnondominant 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 14approvedNo
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v31 / 14approvedNo
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v31 / 14approvedNo
564amnon high in control compared to autistic disorder in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v31 / 14approvedNo
892amnon high in 2-year-old human stage compared to 4-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v41 / 15approvedNo
983amnondominant homo sapiens, china, 2-5 year-old child stage, child, supragingival plaque, supragingival dental plaque2022-12-26v31 / 15approvedNo
983amnon high in tonsil surface tonsil compared to saliva in child 2-5 year-old child stage china homo sapiens 2022-12-26v31 / 15approvedNo
919amnondominant 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, 2-year-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 15approvedNo
926amnondominant 2-5 year-old child stage, orenburg, supragingival dental plaque, supragingival plaque, russia, child, homo sapiens2022-07-28v31 / 15approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, dental caries, dental caries, no iron deficiency anemia2022-12-30v31 / 15approvedNo
872amnondominant 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v11 / 16approvedNo
777amnondominant 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 17approvedNo
892amnondominant 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v41 / 17approvedNo
922amnondominant no dental caries, 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v41 / 17approvedNo
777amnondominant 5-year-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 18approvedNo
892amnondominant 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v41 / 18approvedNo
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v31 / 18approvedNo
922amnondominant no dental caries, 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v41 / 18approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, dental black stain, no dental caries2022-12-30v31 / 18approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, no dental caries, no dental black stain2022-12-30v31 / 18approvedNo
997amnon high in no iron deficiency anemia compared to iron deficiency anemia in child china saliva 2-5 year-old child stage 6-year-old human stage shandong province dental caries dental caries 2022-12-30v31 / 18approvedNo
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v41 / 19approvedNo
736amnondominant 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v31 / 19approvedNo
797amnondominant 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v31 / 19approvedNo
983amnondominant homo sapiens, china, 2-5 year-old child stage, child, saliva2022-12-26v31 / 19approvedNo
983amnon high in saliva compared to supragingival plaque supragingival dental plaque in homo sapiens china 2-5 year-old child stage child 2022-12-26v31 / 19approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, dental caries, dental caries, iron deficiency anemia2022-12-30v31 / 19approvedNo
892amnondominant 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v41 / 20approvedNo
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v31 / 20approvedNo
922amnondominant no dental caries, 4-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v41 / 20approvedNo
983amnondominant homo sapiens, china, 2-5 year-old child stage, child, palatine tonsil, tonsil, tonsil surface2022-12-26v31 / 21approvedNo
736amnon high in 2-year-old human stage 1-year-old human stage age 1-3 years child compared to female adult in tanzania pemba island feces homo sapiens 2021-01-25v31 / 22approvedNo
797amnondominant 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v31 / 22approvedNo
1018amnondominant homo sapiens, china, 3-year-old human stage, daxin county, rural community, feces2023-04-03v31 / 23approvedNo
892amnondominant 2-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v41 / 23approvedNo
922amnondominant no dental caries, 2-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v41 / 23approvedNo
723amnondominant 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v31 / 24approvedNo
605amnon high in middle ear rinse compared to middle ear fluid in 2-year-old human stage 1-year-old human stage australia child age 1-3 years perth recurrent otitis media middle ear 2020-04-07v31 / 24approvedNo
983amnondominant homo sapiens, china, 2-5 year-old child stage, child, palatine tonsil, tonsil, tonsil tissue, tonsillar hypertrophy2022-12-26v31 / 24approvedNo
997amnon high in dental black stain compared to no dental black stain in no dental caries shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v31 / 24approvedNo
961amnondominant feces, homo sapiens, child, kingdom of denmark, zealand, 4-year-old human stage2022-12-20v41 / 27approvedNo
605amnon high in control compared to recurrent otitis media in 2-year-old human stage 1-year-old human stage australia nasopharynx child age 1-3 years perth 2020-04-07v31 / 27approvedNo
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 28approvedNo
723amnoncommon 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v31 / 30approvedNo
438amnondominant 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v41 / 30approvedNo
983amnon high in saliva compared to tonsil surface tonsil in homo sapiens china 2-5 year-old child stage child 2022-12-26v31 / 30approvedNo
997amnon high in no dental black stain compared to dental black stain in child china saliva 2-5 year-old child stage 6-year-old human stage shandong province no dental caries 2022-12-30v31 / 30approvedNo
983amnon high in tonsil surface compared to tonsil tissue in homo sapiens china 2-5 year-old child stage child tonsil 2022-12-26v31 / 36approvedNo
723amnon high in age 0-6 months infant compared to 2-5 year-old child stage in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v31 / 37approvedNo
892amnon high in 1-year-old human stage infant compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v41 / 40approvedNo
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in dentition supragingival plaque supragingival dental plaque no dental caries united states of america homo sapiens 2022-07-25v41 / 41approvedNo
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in saliva no dental caries united states of america homo sapiens 2022-07-25v41 / 41approvedNo
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v31 / 42approvedNo
922amnoncommon 4-year-old human stage, no dental caries, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v41 / 42approvedNo
892amnoncommon 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v41 / 43approvedNo
797amnoncommon 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v31 / 46approvedNo
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v41 / 47approvedNo
892amnoncommon 2-year-old human stage, child, supragingival dental plaque, dental plaque, supragingival plaque, united states of america, homo sapiens2022-04-07v41 / 48approvedNo
922amnoncommon 2-year-old human stage, child, no dental caries, supragingival dental plaque, supragingival plaque, dentition, united states of america, homo sapiens2022-07-25v41 / 48approvedNo
736amnoncommon 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v31 / 49approvedNo
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 50approvedNo
797amnoncommon 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v31 / 50approvedNo
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v31 / 50approvedNo
1018amnoncommon feces, rural community, daxin county, 3-year-old human stage, china, homo sapiens2023-04-03v31 / 51approvedNo
797amnon high in 12-month-old human stage infant compared to 2-year-old human stage child in formula fed germany homo sapiens feces 2021-06-13v31 / 52approvedNo
892amnon high in supragingival plaque supragingival dental plaque dental plaque compared to saliva in 4-year-old human stage child united states of america homo sapiens 2022-04-07v41 / 53approvedNo
926amnoncommon 2-5 year-old child stage, supragingival plaque, supragingival dental plaque, child, orenburg, russia, homo sapiens2022-07-28v31 / 55approvedNo
922amnoncommon 4-year-old human stage, no dental caries, child, saliva, united states of america, homo sapiens2022-07-25v41 / 56approvedNo
596amnoncommon 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 57approvedNo
892amnoncommon 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v41 / 57approvedNo
922amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v41 / 58approvedNo
892amnoncommon 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v41 / 59approvedNo
922amnoncommon child, 2-year-old human stage, no dental caries, saliva, united states of america, homo sapiens2022-07-25v41 / 59approvedNo
919amnoncommon 2-year-old human stage, 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 65approvedNo
872amnoncommon 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v11 / 68approvedNo
983amnoncommon tonsillar hypertrophy, tonsil tissue, tonsil, palatine tonsil, child, 2-5 year-old child stage, china, homo sapiens2022-12-26v31 / 69approvedNo
983amnon high in supragingival plaque supragingival dental plaque compared to tonsil surface tonsil in homo sapiens china 2-5 year-old child stage child 2022-12-26v31 / 74approvedNo
997amnon high in control no dental caries compared to dental caries dental caries in child china saliva 2-5 year-old child stage 6-year-old human stage shandong province 2022-12-30v31 / 74approvedNo
438amnonhigher in kindergarten compared to primary and middle school kids ( high in 2-5 year-old child stage age 3-6 compared to 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v41 / 76approvedNo
596amnon high in under-1-year-old human stage compared to 2-5 year-old child stage age 1-7 years in homo sapiens sweden saliva child 2020-03-18v31 / 78approvedNo
736amnon high in adult female compared to 2-year-old human stage 1-year-old human stage age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v31 / 79approvedNo
983amnon high in tonsil surface tonsil compared to supragingival plaque supragingival dental plaque in child 2-5 year-old child stage china homo sapiens 2022-12-26v31 / 80approvedNo
777amnon high in 3-year-old human stage compared to 5-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 81approvedNo
777amnoncommon 5-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 83approvedNo
777amnon high in 18-month-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 83approvedNo
961amnoncommon 4-year-old human stage, zealand, kingdom of denmark, child, homo sapiens, feces2022-12-20v41 / 84approvedNo
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to 2-5 year-old child stage child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v31 / 87approvedNo
919amnon high in 2-year-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 87approvedNo
997amnon high in iron deficiency anemia compared to no iron deficiency anemia in dental caries dental caries shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v31 / 89approvedNo
777amnoncommon 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v31 / 92approvedNo
723amnonhigher in children age 2-4 years compared to mothers ( high in 2-5 year-old child stage child compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v31 / 95approvedNo
983amnoncommon tonsil surface, tonsil, palatine tonsil, child, 2-5 year-old child stage, china, homo sapiens2022-12-26v31 / 95approvedNo
961amnon high in 4-year-old human stage compared to 6-year-old human stage in zealand kingdom of denmark child homo sapiens feces 2022-12-20v41 / 97approvedNo
922amnon high in child 4-year-old human stage compared to human adult stage adult in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 97approvedNo
922amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v41 / 102approvedNo
892amnon high in saliva compared to supragingival plaque supragingival dental plaque dental plaque in 4-year-old human stage child united states of america homo sapiens 2022-04-07v41 / 107approvedNo
997amnon high in dental caries dental caries compared to control no dental caries in shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v31 / 108approvedNo
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v41 / 109approvedNo
983amnoncommon saliva, child, 2-5 year-old child stage, china, homo sapiens2022-12-26v31 / 115approvedNo
983amnoncommon supragingival dental plaque, supragingival plaque, child, 2-5 year-old child stage, china, homo sapiens2022-12-26v31 / 118approvedNo
777amnon high in 5-year-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 120approvedNo
997amnoncommon no dental caries, dental black stain, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 136approvedNo
797amnon high in 2-year-old human stage child compared to 12-month-old human stage infant in formula fed germany homo sapiens feces 2021-06-13v31 / 139approvedNo
997amnoncommon no dental black stain, no dental caries, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 141approvedNo
605amnon high in recurrent otitis media compared to control in 2-year-old human stage 1-year-old human stage australia nasopharynx child age 1-3 years perth 2020-04-07v31 / 149approvedNo
997amnoncommon no iron deficiency anemia, dental caries, dental caries, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 151approvedNo
961amnon high in 6-year-old human stage compared to 4-year-old human stage in feces homo sapiens child kingdom of denmark zealand 2022-12-20v41 / 166approvedNo
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in no dental caries supragingival dental plaque supragingival plaque dentition united states of america homo sapiens 2022-07-25v41 / 167approvedNo
438amnonlower in kindergarten compared to primary and middle school kids ( high in 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 compared to 2-5 year-old child stage age 3-6 in homo sapiens feces china )2018-12-30v41 / 168approvedNo
241amnonlower in babies age <1 year compared to age 1-3 years ( high in 2-year-old human stage 1-year-old human stage age age 1-3 years compared to under-1-year-old human stage in homo sapiens feces infant )2017-11-13v41 / 173approvedNo
892amnon high in 4-year-old human stage child compared to human adult stage adult organism in saliva united states of america homo sapiens 2022-04-07v41 / 180approvedNo
777amnon high in 3-year-old human stage compared to 18-month-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 184approvedNo
997amnoncommon iron deficiency anemia, dental caries, dental caries, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 190approvedNo
922amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 200approvedNo
892amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in saliva united states of america homo sapiens 2022-04-07v41 / 216approvedNo
872amnon high in 1-year-old human stage compared to 2-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 233approvedNo
892amnon high in adult human adult stage compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v41 / 275approvedNo
438amnon high in 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage adult in homo sapiens feces china 2018-12-30v41 / 279approvedNo
596amnon high in 2-5 year-old child stage age 1-7 years compared to under-1-year-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 288approvedNo
922amnon high in human adult stage adult compared to 4-year-old human stage child in no dental caries saliva united states of america homo sapiens 2022-07-25v41 / 291approvedNo
723amnon high in 2-5 year-old child stage compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v31 / 305approvedNo
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v41 / 486approvedNo
872amnon high in 2-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 704approvedNo

Problems / suggestions? Please email info AT dbbact DOT org