Summary for ontology term: 2-5 year-old child stage

Number of annotations with term: 84

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTGTTAGCAGGGAAGAAGAGAGATTGACGGTACCTGCAGAGAAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.051948
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTGAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG0.051948
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.051948
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.051948
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AbiotrophiaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGTGTAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAATTCCATG0.051948
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTGGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAACTCTGTGATCCGGGACGAAAAGGCAGAGTGCGAAGAACAAACTGCATTGACGGTACCGGAAAAGCAAGCCACGG0.051948
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTTAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG0.051948
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGTGCTAGAGTAACTGTTAGCGCCTTGACGGTATCTAACCAGAAAGCCACGGC0.051948
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__HaemophilusTGGGGAATATTGCGCAATGGGGGCAACCCTGACGCAGCCATGCCGCGTGAATGAAGAAGGCCTTCGGGTTGTAAAGTTCTTTCGGTAGCGAGGAAGGCATTTAGTTTAATAGACTAGGTGATTGACGTTAACTACAGAAGAAGCACCGGC0.051948
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCGACAGGGACGAAGCTTTTGTGACGGTACCTGTATAAGAAGCACCGGCTAACTACGTGCCAGCAGCCG0.051948

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAACGTGTAAGTAACTGTGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.230769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__TerrisporobacterTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGTGATGAAGGCCTTCGGGTCGTAAAACTCTGTCCTCAAGGAAGATAATGACGGTACTTGAGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.230769
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__KlebsiellaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGGGGAGGAAGGCGATAAGGTTAATAACCTTGTCGATTGACGTTACCCGCAGAAGAAGCACCGGC0.230769
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGGACGTTAGTAACTGAACGTCCCCTGACGGTATCTAACCAGAAAGCCACGGC0.230769
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTATCTTACCAGAAAGGGACGG0.230769
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.153846
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.153846
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACAGTAGAGACGGTACCTAACCAGAAAGCCACGGC0.153846
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATTGTAAAGCTCTGTTAATCGGGACGAAAGAGTTCTGTGTGAATAATGCAGAAAAGTGACGGTACCGGAATAGAAAGCCACGG0.153846
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.153846

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__AlloiococcusTAGGGAATCTTCCACAATGGGTGCAAGCCTGATGGAGCAATGCCGCGTGAGTGAAGAAGGACTTCGGTTCGTAAAGCTCTGTTGTTGGGGAAGAACACGGATAGGAGTCACTGCCTATCCCTTGACGGTACCCAACCAGAAAGTCACGGC0.206897
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__MoraxellaTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTTTGGTTGTAAAGCACTTTAAGTGGGGAGGAAAAGCTTATGGTTAATACCCATAAGCCCTGACGTTACCCACAGAATAAGCACCGGC0.195652
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__DolosigranulumTAGGGAATCTTCCACAATGGGTGCAAACCTGATGGAGCAATGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTTAGAGAAGAACACGTGCTAGGTAACTACTAGCGCCTTGACGGTATCTAACCAGAAAGTCACGGCT0.185567
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTTGGGAGCAAGCCTTCGGGTGAGTGTACCTTTCGAATAAGCGCCGGCTAACTACGTGCCAGCAGC0.177419
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCGACAGGGACGAAGCTTTTGTGACGGTACCTGTATAAGAAGCACCGGCTAACTACGTGCCAGCAGCCG0.175824
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAGCTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.168067
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGCGGGATGACGGCCTTCGGGTTGTAAACCGCTTTTGATCGGGAGCAAGCCTTCGGGTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGCAGC0.166667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Propionibacteriaceae;g__TessaracoccusTACGTAGGGTGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTTGTAGGTGGTTTGTCGCGTCGGGAGTGAAAACTCAGGGCTTAACTCTGAGCTTGCTTTCGATACGGGCTGACTTGAGGGAGGTAGGGGAGAATGGAATTCCTGG0.162791
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGCGTAAGTAACTGTGCGCGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.159091
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGTGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.158730

Annotations:

common ontology terms
term enrichment score
TermScore
2-year-old human stage0.614035
child0.453735
age 1-3 years0.347561
1-year-old human stage0.285714
perth0.250000
2-5 year-old child stage0.239521
recurrent otitis media0.207547
4-year-old human stage0.193548
municipality of umea0.160000
LOWER IN 2-year-old human stage0.153846
sweden0.152672
indonesia0.125000
municipality of yogyakarta0.125000
middle ear0.117647
saliva0.107735
pemba island0.106383
LOWER IN 2-5 year-old child stage0.097720
tanzania0.096154
LOWER IN child0.094340
gambia0.090909
age 3-60.086957
3-year-old human stage0.086957
daycare0.086957
1-5-years-old human0.086957
infant0.085837
supragingival dental plaque0.084034
medellin metropolitan area0.083333
nasopharynx0.083333
LOWER IN 1-year-old human stage0.080808
formula fed0.080000
homo sapiens0.077410
supragingival plaque0.074627
dental plaque0.074627
colombia0.071429
australia0.068966
LOWER IN 4-year-old human stage0.068966
5-year-old human stage0.066667
middle ear fluid0.066667
middle ear rinse0.066667
autistic disorder0.064516
italy0.058824
LOWER IN infant0.054545
feces0.048305
germany0.046512
LOWER IN age 8-120.045455
age 8-120.045455
LOWER IN age 3-60.045455
LOWER IN 3-year-old human stage0.045455
LOWER IN age 1-3 years0.045455
LOWER IN 12-month-old human stage0.043956
external acoustic meatus0.043478
ear canal0.043478
breast fed0.043478
LOWER IN 6-12 year-old child stage0.042553
6-12 year-old child stage0.042553
under-1-year-old human stage0.038835
LOWER IN under-1-year-old human stage0.038835
jiangsu province0.037736
age0.031746
adult0.031128
LOWER IN control0.029740
control0.027149
LOWER IN adult0.023346
LOWER IN age 13-140.023256
age 13-140.023256
18-month-old human stage0.023256
LOWER IN 18-month-old human stage0.023256
LOWER IN 5-year-old human stage0.023256
age 0-6 months0.023256
LOWER IN age 0-6 months0.023256
LOWER IN trichuriasis0.023256
trichuriasis0.023256
LOWER IN recurrent otitis media0.023256
LOWER IN middle ear rinse0.023256
LOWER IN middle ear fluid0.023256
helminthiasis0.023256
LOWER IN 14-year-old human stage0.022989
14-year-old human stage0.022989
LOWER IN 65-79 year-old human stage0.022989
65-79 year-old human stage0.022989
LOWER IN autistic disorder0.022989
LOWER IN age 1-7 years0.022989
age 1-7 years0.022989
LOWER IN 7-year-old human stage0.022989
7-year-old human stage0.022989
LOWER IN 13-year-old human stage0.022727
13-year-old human stage0.022727
LOWER IN fifth decade human stage0.022727
fifth decade human stage0.022727
6-month-old human stage0.022472
parasitic helminthiasis infectious disease0.022472
LOWER IN fourth decade human stage0.021978
fourth decade human stage0.021978
LOWER IN 3-month-old human stage0.021978
LOWER IN supragingival dental plaque0.021978
12-month-old human stage0.021978
LOWER IN adult organism0.021739
LOWER IN supragingival plaque0.021277
LOWER IN dental plaque0.021277
LOWER IN human adult stage0.018868
Fraction of dbbact annotations with this term covered by the query
TermScore
2-year-old human stage1.166667
LOWER IN 2-year-old human stage1.000000
4-year-old human stage1.000000
LOWER IN 4-year-old human stage1.000000
gambia1.000000
age 1-3 years0.750000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
municipality of umea0.500000
5-year-old human stage0.500000
3-year-old human stage0.500000
18-month-old human stage0.500000
LOWER IN 3-year-old human stage0.500000
LOWER IN 18-month-old human stage0.500000
LOWER IN 5-year-old human stage0.500000
LOWER IN age 1-3 years0.500000
age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
LOWER IN age 0-6 months0.500000
daycare0.500000
1-5-years-old human0.500000
LOWER IN trichuriasis0.500000
trichuriasis0.500000
recurrent otitis media0.500000
perth0.500000
LOWER IN recurrent otitis media0.500000
middle ear fluid0.500000
middle ear rinse0.500000
LOWER IN middle ear rinse0.500000
LOWER IN middle ear fluid0.500000
helminthiasis0.500000
pemba island0.500000
2-5 year-old child stage0.363636
LOWER IN 14-year-old human stage0.333333
14-year-old human stage0.333333
LOWER IN 65-79 year-old human stage0.333333
65-79 year-old human stage0.333333
autistic disorder0.333333
LOWER IN autistic disorder0.333333
LOWER IN age 1-7 years0.333333
age 1-7 years0.333333
LOWER IN 7-year-old human stage0.333333
7-year-old human stage0.333333
1-year-old human stage0.333333
medellin metropolitan area0.333333
middle ear0.333333
child0.305556
LOWER IN 12-month-old human stage0.285714
LOWER IN 2-5 year-old child stage0.272727
LOWER IN 1-year-old human stage0.266667
LOWER IN 13-year-old human stage0.250000
13-year-old human stage0.250000
LOWER IN fifth decade human stage0.250000
fifth decade human stage0.250000
external acoustic meatus0.250000
ear canal0.250000
tanzania0.250000
formula fed0.250000
breast fed0.250000
LOWER IN 6-12 year-old child stage0.200000
6-12 year-old child stage0.200000
6-month-old human stage0.200000
parasitic helminthiasis infectious disease0.200000
infant0.153846
LOWER IN fourth decade human stage0.142857
fourth decade human stage0.142857
LOWER IN 3-month-old human stage0.142857
supragingival dental plaque0.142857
LOWER IN supragingival dental plaque0.142857
colombia0.142857
12-month-old human stage0.142857
LOWER IN child0.138889
sweden0.133333
LOWER IN adult organism0.125000
LOWER IN infant0.115385
under-1-year-old human stage0.105263
LOWER IN under-1-year-old human stage0.105263
supragingival plaque0.100000
dental plaque0.100000
LOWER IN supragingival plaque0.100000
LOWER IN dental plaque0.100000
nasopharynx0.100000
jiangsu province0.090909
saliva0.065217
italy0.050000
age0.047619
LOWER IN human adult stage0.045455
human adult stage0.045455
australia0.043478
homo sapiens0.040590
germany0.034483
feces0.025478
adult0.023121
LOWER IN saliva0.021739
LOWER IN control0.021622
Fraction of annotations for the query sequences containing the term
TermScore
child0.880952
homo sapiens0.833333
feces0.464286
2-year-old human stage0.416667
saliva0.309524
1-year-old human stage0.250000
age 1-3 years0.226190
united states of america0.190476
2-5 year-old child stage0.178571
sweden0.178571
australia0.166667
perth0.166667
recurrent otitis media0.130952
4-year-old human stage0.107143
municipality of umea0.095238
control0.083333
LOWER IN 2-year-old human stage0.083333
china0.071429
LOWER IN child0.071429
italy0.071429
indonesia0.071429
municipality of yogyakarta0.071429
nasopharynx0.071429
middle ear0.071429
germany0.071429
LOWER IN 2-5 year-old child stage0.059524
infant0.059524
supragingival plaque0.059524
dental plaque0.059524
supragingival dental plaque0.059524
tanzania0.059524
pemba island0.059524
age 3-60.047619
adult0.047619
3-year-old human stage0.047619
LOWER IN control0.047619
LOWER IN 1-year-old human stage0.047619
colombia0.047619
medellin metropolitan area0.047619
daycare0.047619
1-5-years-old human0.047619
gambia0.047619
formula fed0.047619
LOWER IN adult0.035714
5-year-old human stage0.035714
autistic disorder0.035714
LOWER IN 4-year-old human stage0.035714
LOWER IN infant0.035714
middle ear fluid0.035714
middle ear rinse0.035714
LOWER IN age 8-120.023810
LOWER IN 6-12 year-old child stage0.023810
age 8-120.023810
6-12 year-old child stage0.023810
LOWER IN age 3-60.023810
jiangsu province0.023810
LOWER IN 3-year-old human stage0.023810
LOWER IN 12-month-old human stage0.023810
under-1-year-old human stage0.023810
LOWER IN under-1-year-old human stage0.023810
age0.023810
LOWER IN age 1-3 years0.023810
external acoustic meatus0.023810
ear canal0.023810
breast fed0.023810
LOWER IN age 13-140.011905
LOWER IN 13-year-old human stage0.011905
LOWER IN 14-year-old human stage0.011905
age 13-140.011905
13-year-old human stage0.011905
14-year-old human stage0.011905
LOWER IN 65-79 year-old human stage0.011905
LOWER IN fourth decade human stage0.011905
LOWER IN fifth decade human stage0.011905
65-79 year-old human stage0.011905
fourth decade human stage0.011905
fifth decade human stage0.011905
18-month-old human stage0.011905
LOWER IN 18-month-old human stage0.011905
LOWER IN 5-year-old human stage0.011905
LOWER IN autistic disorder0.011905
6-month-old human stage0.011905
LOWER IN 3-month-old human stage0.011905
LOWER IN age 1-7 years0.011905
age 1-7 years0.011905
LOWER IN 7-year-old human stage0.011905
7-year-old human stage0.011905
LOWER IN adult organism0.011905
LOWER IN human adult stage0.011905
human adult stage0.011905
LOWER IN supragingival plaque0.011905
LOWER IN dental plaque0.011905
LOWER IN supragingival dental plaque0.011905
LOWER IN saliva0.011905
age 0-6 months0.011905
LOWER IN age 0-6 months0.011905
LOWER IN trichuriasis0.011905
trichuriasis0.011905
LOWER IN recurrent otitis media0.011905
LOWER IN middle ear rinse0.011905
Exp. ID User ID Description Date Region Flag Sequences
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 2-year-old human stage 3-month-old human stage 12-month-old human stage in homo sapiens saliva child sweden )2020-03-18v3No1 / 1
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in feces homo sapiens child colombia medellin metropolitan area daycare 1-5-years-old human )2019-02-12v4No1 / 3
564amnon high in autistic disorder compared to control in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 5
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in feces homo sapiens child colombia medellin metropolitan area daycare 1-5-years-old human )2019-02-12v4No1 / 6
605amnoncommon control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
892amnon high in 4-year-old human stage compared to 2-year-old human stage in homo sapiens united states of america saliva child 2022-04-07v4No1 / 7
605amnoncommon external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 7
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 9
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in feces homo sapiens child tanzania age 1-3 years pemba island 2-year-old human stage 1-year-old human stage 2021-01-25v3No1 / 9
605amnondominant control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 10
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 12
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnondominant external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnon high in middle ear fluid compared to middle ear rinse in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 13
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 14
605amnoncommon nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
605amnondominant nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
892amnon high in 2-year-old human stage compared to 4-year-old human stage in homo sapiens united states of america saliva child 2022-04-07v4No1 / 15
872amnondominant feces, homo sapiens, child, gambia, 2-year-old human stage2022-02-26v1No1 / 16
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 17
892amnondominant homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v4No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 18
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 18
892amnondominant homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v4No1 / 18
482amnondominant feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 19
736amnondominant feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 19
797amnondominant feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 19
564amnondominant feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 20
892amnondominant homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 4-year-old human stage2022-04-07v4No1 / 20
736amnon high in child age 1-3 years 2-year-old human stage 1-year-old human stage compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 22
892amnondominant homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 2-year-old human stage2022-04-07v4No1 / 23
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
605amnon high in middle ear rinse compared to middle ear fluid in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 24
605amnon high in control compared to recurrent otitis media in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 27
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 28
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
723amnon high in infant age 0-6 months compared to 2-5 year-old child stage in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 37
892amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 40
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
892amnoncommon homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 4-year-old human stage2022-04-07v4No1 / 43
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 47
892amnoncommon homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 2-year-old human stage2022-04-07v4No1 / 48
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 49
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 50
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
892amnon high in supragingival plaque dental plaque supragingival dental plaque compared to saliva in homo sapiens united states of america child 4-year-old human stage 2022-04-07v4No1 / 53
596amnoncommon homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 57
892amnoncommon homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v4No1 / 57
892amnoncommon homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v4No1 / 59
872amnoncommon feces, homo sapiens, child, gambia, 2-year-old human stage2022-02-26v1No1 / 68
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
736amnon high in female adult compared to child age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
777amnon high in 3-year-old human stage compared to 5-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 81
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 83
777amnon high in 18-month-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 83
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child 2-5 year-old child stage in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 92
723amnonhigher in children age 2-4 years compared to mothers ( high in child 2-5 year-old child stage compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
892amnon high in saliva compared to supragingival plaque dental plaque supragingival dental plaque in homo sapiens united states of america child 4-year-old human stage 2022-04-07v4No1 / 107
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
777amnon high in 5-year-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
605amnon high in recurrent otitis media compared to control in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 149
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v4No1 / 168
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 173
892amnon high in child 4-year-old human stage compared to adult organism human adult stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 180
777amnon high in 3-year-old human stage compared to 18-month-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
892amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 216
872amnon high in 1-year-old human stage compared to 2-year-old human stage in feces homo sapiens child gambia 2022-02-26v1No1 / 233
892amnon high in adult human adult stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 275
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
596amnon high in age 1-7 years 2-5 year-old child stage compared to under-1-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 288
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
872amnon high in 2-year-old human stage compared to 1-year-old human stage in feces homo sapiens child gambia 2022-02-26v1No1 / 704

Problems / suggestions? Please email info AT dbbact DOT org