Summary for ontology term: 3-month-old human stage

Number of annotations with term: 39

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTATCTTACCAGAAAGGGACGG0.172414
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCGCTCATGGTCAAGCCGCAGCTTTGGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTAC0.172414
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTGGGGAATCTTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGCGGGATGAAGGCCTTCGGGTTGTAAACCGCTTTCAGCAGGGACGAGGCGAAAGTGACGGTACCTGCAGAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCG0.137931
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAAAGTCTGATCCAGCAATTCTGTGTGCACGATGACGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAAAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.103448
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGGGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGATGTGAAAGCCCCGAGCTTAACTTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.103448
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumCCGCGGTAATACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGG0.103448
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGC0.103448
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGTGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.103448
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGGATATTGCACAATGGGGGGAACCCTGATGCAGCGACGCCGCGTGGGTGAAGAAGCGCCTCGGCGCGTAAAGCCCTGTCAGCAGGGAAGAAAATGACGGTACCTGAAGAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.103448
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGCTAGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATATGGGAATAAAGTGCAGTATGTATACTGCTTTGCATGTACCTTATGAATAAGGATCGGCTAACT0.103448

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTGAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAACGTGTAAGTAACTGTGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATAAAGGAATAAAGTCGGGTATGGATACCCGTTTGCATGTACTTTATGAATAAGGATCGGCTAACT0.250000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__HaemophilusTGGGGAATATTGCGCAATGGGGGCAACCCTGACGCAGCCATGCCGCGTGAATGAAGAAGGCCTTCGGGTTGTAAAGTTCTTTCGGTAGTGAGGAAGGCATTTAGTTTAATAGACTAGGTGATTGACGTTAACTACAGAAGAAGCACCGGC0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGTGCTAGAGTAACTGTTAGCGCCTTGACGGTATCTAACCAGAAAGCCACGGC0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGTCTTCTTGCGAATAGTTAGAAGAATTGACGGTACCGGAATAGAAAGCCACGG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGTCCTCTTGCGAATAGTTAGAGGAATTGACGGTACCGGAATAGAAAGCCACGG0.250000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTGGGGAATATTGCACAATGGGGGGAACCCTGATGCAGCCATGCCGCGTGAATGAAGAAGGCCTTCGGGTTGTAAAGTTCTTTCGGTGACGAGGAAGGTTGATAGGTTAATAGCCTATCAAATTGACGTTAATCACAGAAGAAGCACCGGC0.166667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumCCGCGGTAATACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGG0.285714
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGGAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACGCTGTGACGGTATCTTACCAGAAAGGGACGG0.285714
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCAGGGAGCAAGGCTTCGGTTGAGTGTACCTGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGC0.272727
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCATTTTTTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.243902
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTTGGGAGCAAGCCTTCGGGTGAGTGTACCTTTCGAATAAGCGCCGGCTAACTACGTGCCAGCAGC0.236842
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAATGGCTACCATGCGAATAGTGTGGGAGTTTGACGGTACCGGAATAGAAAGCCACGG0.228571
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCACTTTGTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.213333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAATGGCTACCATGCGAATAGTTTGGGAGTTTGACGGTACCGGAATAGAAAGCCACGG0.205128
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGTGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.205128
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAAGGATGAAGGTCTTCGGATCGTAAACTTCTATCAGCAGGGAAGAAACCATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGG0.186047

Annotations:

common ontology terms
term enrichment score
TermScore
3-month-old human stage0.781395
LOWER IN 3-month-old human stage0.404412
rhesus macaque0.290909
infant0.250000
formula fed0.240000
municipality of umea0.235294
breast fed0.208955
macaca mulatta0.183908
sweden0.175439
LOWER IN 1-month-old human stage0.125000
1-month-old human stage0.125000
age0.109290
monkey0.105960
kingdom of the netherlands0.105263
hypopharynx0.093023
LOWER IN age 7 months0.093023
age 7 months0.093023
captive0.087432
nasopharynx0.086957
nasal cavity0.083333
6-month-old human stage0.081633
child0.077519
saliva0.074349
kingdom of denmark0.072727
germany0.063618
age 8 months0.048780
LOWER IN age 6 months0.048780
age 6 months0.048780
LOWER IN age 8 months0.048780
2-days-old human0.048780
LOWER IN 2-days-old human0.048780
LOWER IN 18-month-old human stage0.048780
18-month-old human stage0.048780
LOWER IN bifidobacterium supplement0.048780
bifidobacterium supplement0.048780
LOWER IN age > 3 months0.047619
LOWER IN age < 3 months0.047619
age 1 month0.047619
LOWER IN age 1 month0.047619
LOWER IN age 1 week0.046512
age 1 week0.046512
LOWER IN formula fed0.046512
LOWER IN breast fed0.046512
LOWER IN 2-year-old human stage0.044444
LOWER IN state of oregon0.044444
state of oregon0.044444
LOWER IN 12-month-old human stage0.043478
control diet0.037736
LOWER IN control diet0.037736
homo sapiens0.036063
LOWER IN infant stage0.032787
LOWER IN infant0.030769
state of california0.030769
LOWER IN state of california0.030769
LOWER IN child0.026667
research facility0.013169
feces0.012608
united states of america0.007940
Fraction of dbbact annotations with this term covered by the query
TermScore
3-month-old human stage0.857143
LOWER IN 3-month-old human stage0.714286
age 8 months0.500000
LOWER IN age 6 months0.500000
rhesus macaque0.500000
age 6 months0.500000
LOWER IN age 8 months0.500000
municipality of umea0.500000
2-days-old human0.500000
LOWER IN 2-days-old human0.500000
LOWER IN 18-month-old human stage0.500000
18-month-old human stage0.500000
hypopharynx0.500000
LOWER IN bifidobacterium supplement0.500000
bifidobacterium supplement0.500000
LOWER IN age 7 months0.500000
age 7 months0.500000
LOWER IN age > 3 months0.333333
LOWER IN age < 3 months0.333333
LOWER IN 1-month-old human stage0.333333
1-month-old human stage0.333333
age 1 month0.333333
LOWER IN age 1 month0.333333
formula fed0.250000
breast fed0.250000
LOWER IN age 1 week0.250000
age 1 week0.250000
LOWER IN formula fed0.250000
LOWER IN breast fed0.250000
6-month-old human stage0.200000
macaca mulatta0.166667
kingdom of the netherlands0.166667
LOWER IN 2-year-old human stage0.166667
LOWER IN state of oregon0.166667
state of oregon0.166667
infant0.153846
LOWER IN 12-month-old human stage0.142857
sweden0.133333
kingdom of denmark0.125000
nasopharynx0.100000
age0.095238
nasal cavity0.090909
monkey0.071429
control diet0.071429
LOWER IN control diet0.071429
captive0.055556
child0.055556
LOWER IN infant stage0.045455
saliva0.043478
LOWER IN infant0.038462
state of california0.038462
LOWER IN state of california0.038462
germany0.034483
LOWER IN child0.027778
homo sapiens0.018450
research facility0.006803
feces0.006369
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.794872
3-month-old human stage0.717949
infant0.666667
feces0.615385
germany0.410256
LOWER IN 3-month-old human stage0.282051
saliva0.256410
sweden0.256410
formula fed0.230769
united states of america0.205128
research facility0.205128
macaca mulatta0.205128
monkey0.205128
captive0.205128
rhesus macaque0.205128
breast fed0.179487
municipality of umea0.153846
age0.128205
child0.128205
nasal cavity0.076923
nasopharynx0.076923
kingdom of the netherlands0.076923
LOWER IN 1-month-old human stage0.076923
1-month-old human stage0.076923
hypopharynx0.051282
kingdom of denmark0.051282
6-month-old human stage0.051282
LOWER IN age 7 months0.051282
age 7 months0.051282
age 8 months0.025641
LOWER IN age 6 months0.025641
age 6 months0.025641
LOWER IN age 8 months0.025641
LOWER IN age > 3 months0.025641
LOWER IN age < 3 months0.025641
LOWER IN infant stage0.025641
2-days-old human0.025641
LOWER IN 2-days-old human0.025641
LOWER IN child0.025641
LOWER IN 18-month-old human stage0.025641
18-month-old human stage0.025641
LOWER IN infant0.025641
LOWER IN age 1 week0.025641
age 1 week0.025641
LOWER IN 2-year-old human stage0.025641
LOWER IN 12-month-old human stage0.025641
LOWER IN formula fed0.025641
LOWER IN breast fed0.025641
control diet0.025641
LOWER IN bifidobacterium supplement0.025641
bifidobacterium supplement0.025641
LOWER IN control diet0.025641
state of california0.025641
LOWER IN state of oregon0.025641
state of oregon0.025641
LOWER IN state of california0.025641
age 1 month0.025641
LOWER IN age 1 month0.025641
Exp. ID User ID Description Date Region Flag Sequences
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 2-year-old human stage 3-month-old human stage 12-month-old human stage in homo sapiens saliva child sweden )2020-03-18v3No1 / 1
227amnonpeaks at age 3 months in baby nasopharynx ( high in age 3-month-old human stage compared to age > 3 months age < 3 months infant stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 2
797amnon high in bifidobacterium supplement compared to control diet in feces homo sapiens infant germany formula fed 3-month-old human stage 2021-06-13v3No1 / 3
797amnon high in control diet compared to bifidobacterium supplement in feces homo sapiens infant germany formula fed 3-month-old human stage 2021-06-13v3No1 / 5
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 9
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 12
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 12
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 13
596amnondominant homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 14
797amnon high in 1-month-old human stage compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 14
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
797amnondominant feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 15
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 17
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 18
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 20
596amnoncommon homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 21
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 21
797amnon high in 1-month-old human stage compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 22
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 27
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 28
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 29
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 38
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
777amnon high in infant 3-month-old human stage compared to child 18-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
777amnon high in 2-days-old human compared to 3-month-old human stage in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
777amnon high in 3-month-old human stage compared to 2-days-old human in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 197
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955

Problems / suggestions? Please email info AT dbbact DOT org