Summary for ontology term: 6-12 year-old child stage

Number of annotations with term: 62

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.033898
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.033898
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Eubacteriaceae;g__EubacteriumTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGCACCTTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCTTGCGAACTGGGGTGCTTGAGTGCAGGAGGGGAAAGTGGAATTCCTAGT0.033898
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.033898
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.033898
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTTTTTTAAGTTAGAGGTGAAAGCTCGACGCTCAACGTCGAAATTGCCTCTGATACTGAGAGACTAGAGTGTAGTTGCGGAAGGCGGAATGTGTGG0.033898
d__Bacteria;p__Firmicutes;c__ClostridiaTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGCTGTCAAGTCAGATGTGAAATACCGGGGCTCAACTCCGGGGCTGCATTTGAAACTGATGGTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.033898
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGTCGATTAAGTTAGATGTGAAACCCCCGGGCTTAACTTGGGGACTGCATCTAATACTGGTTGACTTAGAGTACAGGAGAGGGAAGCGGAATTCCTA0.033898
d__Bacteria;p__Candidatus Saccharibacteria;g__Saccharibacteria_genera_incertae_sedisTACGTAGGGTGCAAGCATTATCCGGAGTGACTGGGCGTAAAGAGTTGCGTAGGCGGTTTAATAAGTGAATAGTGAAACCTGGTGGCTCAACCATACAGACTATTATTCAAACTGTTAAACTCGAGAATGGTAGAGGTAACTGGAATTTCT0.033898
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCCTGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.033898

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.800000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.600000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.600000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.400000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.400000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.400000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.400000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAAACTTCCGGCTCAACCGGGGGCTTGCGGTGGGTACGGGCCGGCTAGAGTGCGGTAGGGGTAACTGGAACTCCTGG0.400000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.400000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.400000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGATGGGGACGAACGTGCCTAATGCGAATAGTTTTAGGCAATGACGGTACCCATCGAGGAAGCCACGG0.297872
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTTTGGTTGTAAAGCACTTTAAGTGGGGAGGAAAAGTTGACGGTTAATACCCGCCAGCCCTGACGTTACCCACAGAATAAGCACCGGC0.294118
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATTCTGTGTGCACGAAGAAGGTTTTCGGATTGTAAAGTGCTTTCAGCAGGGAAGAAGGAAGTGACGGTACCTGCAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGCG0.291667
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATTCTGTGTGCACGAAGAAGGTTTTCGGATTGTAAAGTGCTTTCAGCAGGGAAGAAGAAAGTGACGGTACCTGCAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGCG0.264901
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGTCGAGAGACTGAACCAGCCAAGTCGCGTGAAGGAAGACGGCTCTATGAGTTGTAAACTTCTTTTGTACAGGAGTAAAGTGAGACACGTGTGTTTTATTGCAAGTACTGTACGAATAAGCATCGGCTAACT0.263736
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAAGCAGGCCTGTCCCTGTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAAC0.263158
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGAAGGCCTTCGGGTTGTAAACTCCTTTCGCCCGGGACGAAGCCCACCTGGTGGGTGACGGTACCGTGGAGAAGAAGCACCGGCTAACTACGTGCC0.254902
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTCTGAAGAAGGCCTTCGGGTTGTAAAGGACTTTTGTCAGGGAAGAAAAGGGCGGGGTTAATACCCCTGTCTGATGACGGTACCTGAAGAATAAGCACCGGC0.254335
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CapnocytophagaTGAGGAATATTGGTCAATGGTCGGAAGACTGAACCAGCCATGCCGCGTGCAGGAAGAATGCCTTATGGGTTGTAAACTGCTTTTATATGGGAAGAATAAGGTGTACGTGTACATTGATGACGGTACCATATGAATAAGCATCGGCTAACT0.247788
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGATGGGGACGAACGTGCCTAATGCGAATAGTATTAGGTAATGACGGTACCCATCGAGGAAGCCACGG0.247191

Annotations:

common ontology terms
term enrichment score
TermScore
6-year-old human stage0.820313
7-year-old human stage0.574713
8-year-old human stage0.523810
dental caries0.372093
child0.370213
10-year-old human stage0.367347
11-year-old human stage0.367347
9-year-old human stage0.367347
supragingival dental plaque0.293333
6-12 year-old child stage0.279070
state of nebraska0.268657
supragingival plaque0.240437
shandong province0.212121
no dental caries0.202899
2-5 year-old child stage0.192771
los angeles0.176471
burmese0.138889
asian0.129870
european0.121951
caucasian0.121951
zealand0.121212
LOWER IN dental caries0.117647
age 8-120.114286
adolescent stage0.109091
hispanic0.108108
african american0.102564
hispanic or latin american0.102564
guangzhou city prefecture0.097561
dental black stain0.092308
no dental black stain0.092308
iron deficiency anemia0.092308
no iron deficiency anemia0.092308
age 8-12 years0.088235
LOWER IN burmese0.088235
ulcerative colitis0.085714
LOWER IN asian0.084507
state of colorado0.081633
kingdom of denmark0.081633
LOWER IN european0.081081
LOWER IN caucasian0.081081
dentition0.075630
saliva0.074227
oral cavity0.065574
sweden0.063492
age 3-60.060606
LOWER IN age 8-120.060606
LOWER IN age 3-60.060606
bordeaux0.060606
LOWER IN hispanic0.058824
LOWER IN african american0.057143
LOWER IN hispanic or latin american0.057143
LOWER IN 6-12 year-old child stage0.054054
cystic fibrosis0.054054
state of california0.053571
mouth0.049383
homo sapiens0.046844
LOWER IN 2-5 year-old child stage0.045455
jiangsu province0.045455
LOWER IN ulcerative colitis0.045455
french republic0.044444
LOWER IN child0.039604
LOWER IN no iron deficiency anemia0.031746
LOWER IN iron deficiency anemia0.031746
LOWER IN no dental black stain0.031746
LOWER IN dental black stain0.031746
LOWER IN no dental caries0.031746
LOWER IN age 13-140.031250
age 13-140.031250
LOWER IN 6-year-old human stage0.031250
4-year-old human stage0.031250
LOWER IN 4-year-old human stage0.031250
LOWER IN age 8-12 years0.031250
china0.031128
LOWER IN 14-year-old human stage0.030769
14-year-old human stage0.030769
LOWER IN 65-79 year-old human stage0.030769
65-79 year-old human stage0.030769
LOWER IN 7-year-old human stage0.030769
LOWER IN 13-year-old human stage0.030303
13-year-old human stage0.030303
LOWER IN fifth decade human stage0.030303
fifth decade human stage0.030303
LOWER IN fourth decade human stage0.028571
fourth decade human stage0.028571
2-year-old human stage0.028571
LOWER IN 2-year-old human stage0.028571
control0.026408
LOWER IN control0.023810
united states of america0.022587
feces0.022298
LOWER IN adult0.016129
adult0.016129
Fraction of dbbact annotations with this term covered by the query
TermScore
6-year-old human stage1.500000
no dental caries1.000000
dental black stain1.000000
no dental black stain1.000000
iron deficiency anemia1.000000
no iron deficiency anemia1.000000
LOWER IN no iron deficiency anemia1.000000
LOWER IN iron deficiency anemia1.000000
LOWER IN no dental black stain1.000000
LOWER IN dental black stain1.000000
LOWER IN no dental caries1.000000
los angeles1.000000
7-year-old human stage1.000000
8-year-old human stage1.000000
zealand1.000000
dental caries0.666667
LOWER IN dental caries0.666667
age 8-12 years0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
6-12 year-old child stage0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
bordeaux0.500000
10-year-old human stage0.500000
11-year-old human stage0.500000
9-year-old human stage0.500000
burmese0.500000
LOWER IN burmese0.500000
LOWER IN 6-year-old human stage0.500000
4-year-old human stage0.500000
LOWER IN 4-year-old human stage0.500000
LOWER IN age 8-12 years0.500000
LOWER IN 14-year-old human stage0.333333
14-year-old human stage0.333333
LOWER IN 65-79 year-old human stage0.333333
65-79 year-old human stage0.333333
asian0.333333
LOWER IN asian0.333333
LOWER IN 7-year-old human stage0.333333
hispanic0.333333
LOWER IN hispanic0.333333
LOWER IN 13-year-old human stage0.250000
13-year-old human stage0.250000
LOWER IN fifth decade human stage0.250000
fifth decade human stage0.250000
LOWER IN european0.250000
supragingival dental plaque0.250000
state of nebraska0.250000
LOWER IN caucasian0.250000
european0.250000
caucasian0.250000
african american0.250000
LOWER IN african american0.250000
hispanic or latin american0.250000
LOWER IN hispanic or latin american0.250000
child0.230769
shandong province0.200000
guangzhou city prefecture0.200000
supragingival plaque0.181818
LOWER IN 6-12 year-old child stage0.166667
cystic fibrosis0.166667
2-5 year-old child stage0.153846
LOWER IN fourth decade human stage0.125000
fourth decade human stage0.125000
adolescent stage0.125000
2-year-old human stage0.125000
LOWER IN 2-year-old human stage0.125000
state of colorado0.111111
kingdom of denmark0.111111
LOWER IN 2-5 year-old child stage0.076923
jiangsu province0.076923
LOWER IN ulcerative colitis0.076923
ulcerative colitis0.076923
french republic0.071429
oral cavity0.066667
sweden0.062500
LOWER IN child0.051282
dentition0.043478
saliva0.042553
mouth0.040000
state of california0.037037
homo sapiens0.024221
china0.016216
LOWER IN control0.015789
control0.015789
feces0.011594
united states of america0.011583
LOWER IN adult0.010753
adult0.010753
Fraction of annotations for the query sequences containing the term
TermScore
child0.935484
homo sapiens0.709677
6-year-old human stage0.564516
united states of america0.451613
7-year-old human stage0.403226
china0.387097
8-year-old human stage0.354839
supragingival dental plaque0.354839
supragingival plaque0.354839
feces0.290323
saliva0.290323
10-year-old human stage0.290323
11-year-old human stage0.290323
9-year-old human stage0.290323
dentition0.290323
state of nebraska0.290323
2-5 year-old child stage0.258065
dental caries0.258065
shandong province0.225806
6-12 year-old child stage0.193548
no dental caries0.112903
los angeles0.096774
state of california0.096774
adolescent stage0.096774
ulcerative colitis0.096774
control0.080645
asian0.080645
burmese0.080645
european0.080645
caucasian0.080645
state of colorado0.064516
mouth0.064516
oral cavity0.064516
age 8-120.064516
LOWER IN dental caries0.064516
sweden0.064516
zealand0.064516
kingdom of denmark0.064516
african american0.064516
hispanic0.064516
hispanic or latin american0.064516
guangzhou city prefecture0.064516
age 8-12 years0.048387
dental black stain0.048387
no dental black stain0.048387
iron deficiency anemia0.048387
no iron deficiency anemia0.048387
LOWER IN control0.048387
LOWER IN european0.048387
LOWER IN caucasian0.048387
LOWER IN asian0.048387
LOWER IN burmese0.048387
LOWER IN 6-12 year-old child stage0.032258
age 3-60.032258
LOWER IN age 8-120.032258
LOWER IN 2-5 year-old child stage0.032258
LOWER IN age 3-60.032258
LOWER IN adult0.032258
adult0.032258
LOWER IN child0.032258
cystic fibrosis0.032258
bordeaux0.032258
french republic0.032258
jiangsu province0.032258
LOWER IN ulcerative colitis0.032258
LOWER IN african american0.032258
LOWER IN hispanic or latin american0.032258
LOWER IN hispanic0.032258
LOWER IN 14-year-old human stage0.016129
LOWER IN 13-year-old human stage0.016129
LOWER IN age 13-140.016129
14-year-old human stage0.016129
13-year-old human stage0.016129
age 13-140.016129
LOWER IN fifth decade human stage0.016129
LOWER IN fourth decade human stage0.016129
LOWER IN 65-79 year-old human stage0.016129
fifth decade human stage0.016129
fourth decade human stage0.016129
65-79 year-old human stage0.016129
LOWER IN no iron deficiency anemia0.016129
LOWER IN iron deficiency anemia0.016129
LOWER IN no dental black stain0.016129
LOWER IN dental black stain0.016129
LOWER IN no dental caries0.016129
LOWER IN 6-year-old human stage0.016129
4-year-old human stage0.016129
LOWER IN 4-year-old human stage0.016129
LOWER IN 7-year-old human stage0.016129
2-year-old human stage0.016129
LOWER IN 2-year-old human stage0.016129
LOWER IN age 8-12 years0.016129
Number of experiments associating the term to the sequence
TermScore
child9.000000
homo sapiens7.000000
feces4.000000
united states of america3.000000
china3.000000
6-12 year-old child stage3.000000
6-year-old human stage3.000000
LOWER IN control3.000000
control3.000000
7-year-old human stage3.000000
2-5 year-old child stage2.000000
LOWER IN adult2.000000
adult2.000000
LOWER IN child2.000000
saliva2.000000
dental caries2.000000
LOWER IN dental caries2.000000
8-year-old human stage2.000000
supragingival dental plaque2.000000
supragingival plaque2.000000
age 8-12 years1.000000
state of colorado1.000000
mouth1.000000
oral cavity1.000000
LOWER IN 14-year-old human stage1.000000
LOWER IN 13-year-old human stage1.000000
LOWER IN 6-12 year-old child stage1.000000
age 3-61.000000
LOWER IN age 8-121.000000
LOWER IN age 13-141.000000
14-year-old human stage1.000000
13-year-old human stage1.000000
LOWER IN 2-5 year-old child stage1.000000
age 8-121.000000
age 13-141.000000
LOWER IN age 3-61.000000
LOWER IN fifth decade human stage1.000000
LOWER IN fourth decade human stage1.000000
LOWER IN 65-79 year-old human stage1.000000
fifth decade human stage1.000000
fourth decade human stage1.000000
65-79 year-old human stage1.000000
cystic fibrosis1.000000
bordeaux1.000000
french republic1.000000
jiangsu province1.000000
no dental caries1.000000
dental black stain1.000000
shandong province1.000000
no dental black stain1.000000
iron deficiency anemia1.000000
no iron deficiency anemia1.000000
LOWER IN no iron deficiency anemia1.000000
LOWER IN iron deficiency anemia1.000000
LOWER IN no dental black stain1.000000
LOWER IN dental black stain1.000000
LOWER IN no dental caries1.000000
LOWER IN ulcerative colitis1.000000
los angeles1.000000
state of california1.000000
adolescent stage1.000000
ulcerative colitis1.000000
sweden1.000000
10-year-old human stage1.000000
11-year-old human stage1.000000
9-year-old human stage1.000000
asian1.000000
LOWER IN european1.000000
dentition1.000000
state of nebraska1.000000
burmese1.000000
LOWER IN caucasian1.000000
LOWER IN asian1.000000
european1.000000
caucasian1.000000
LOWER IN burmese1.000000
LOWER IN 6-year-old human stage1.000000
4-year-old human stage1.000000
zealand1.000000
kingdom of denmark1.000000
LOWER IN 4-year-old human stage1.000000
LOWER IN 7-year-old human stage1.000000
2-year-old human stage1.000000
LOWER IN 2-year-old human stage1.000000
african american1.000000
LOWER IN african american1.000000
hispanic1.000000
hispanic or latin american1.000000
LOWER IN hispanic or latin american1.000000
LOWER IN hispanic1.000000
guangzhou city prefecture1.000000
LOWER IN age 8-12 years1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
711amnondominant age 8-12 years, child, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v41 / 9approvedNo
658amnon high in european caucasian compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 9approvedNo
658amnon high in caucasian european compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v31 / 9approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, dental caries, dental caries, no iron deficiency anemia2022-12-30v31 / 15approvedNo
596amnondominant 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 15approvedNo
658amnon high in african american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 15approvedNo
658amnon high in hispanic hispanic or latin american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 15approvedNo
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 17approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, dental black stain, no dental caries2022-12-30v31 / 18approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, no dental caries, no dental black stain2022-12-30v31 / 18approvedNo
997amnon high in no iron deficiency anemia compared to iron deficiency anemia in child china saliva 2-5 year-old child stage 6-year-old human stage shandong province dental caries dental caries 2022-12-30v31 / 18approvedNo
997amnondominant child, china, saliva, 2-5 year-old child stage, 6-year-old human stage, shandong province, dental caries, dental caries, iron deficiency anemia2022-12-30v31 / 19approvedNo
959amnondominant homo sapiens, feces, child, 6-12 year-old child stage, adolescent stage, united states of america, state of california, los angeles, control2022-12-19v41 / 19approvedNo
924amnondominant 8-year-old human stage, 7-year-old human stage, china, supragingival dental plaque, supragingival plaque, guangzhou city prefecture, child2022-07-27v31 / 19approvedNo
961amnondominant feces, homo sapiens, child, kingdom of denmark, zealand, 6-year-old human stage2022-12-20v41 / 21approvedNo
658amnon high in hispanic hispanic or latin american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v31 / 21approvedNo
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 21approvedNo
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 22approvedNo
924amnon high in control compared to dental caries dental caries in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v31 / 22approvedNo
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 23approvedNo
997amnon high in dental black stain compared to no dental black stain in no dental caries shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v31 / 24approvedNo
959amnondominant homo sapiens, feces, child, 6-12 year-old child stage, adolescent stage, united states of america, state of california, los angeles, ulcerative colitis, ulcerative colitis2022-12-19v41 / 24approvedNo
895amnondominant 6-12 year-old child stage, bordeaux, cystic fibrosis, french republic, child, homo sapiens, feces2022-04-16v41 / 25approvedNo
438amnondominant 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v41 / 27approvedNo
959amnon high in ulcerative colitis ulcerative colitis compared to control in homo sapiens feces child 6-12 year-old child stage adolescent stage united states of america state of california los angeles 2022-12-19v41 / 27approvedNo
924amnon high in dental caries dental caries compared to control in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v31 / 27approvedNo
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 28approvedNo
658amnon high in african american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 29approvedNo
997amnon high in no dental black stain compared to dental black stain in child china saliva 2-5 year-old child stage 6-year-old human stage shandong province no dental caries 2022-12-30v31 / 30approvedNo
658amnon high in european caucasian compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 30approvedNo
711amnoncommon age 8-12 years, child, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v41 / 37approvedNo
959amnoncommon ulcerative colitis, ulcerative colitis, los angeles, state of california, united states of america, adolescent stage, 6-12 year-old child stage, child, feces, homo sapiens2022-12-19v41 / 39approvedNo
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 50approvedNo
596amnoncommon 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 59approvedNo
895amnoncommon 6-12 year-old child stage, cystic fibrosis, bordeaux, french republic, child, feces, homo sapiens2022-04-16v41 / 65approvedNo
997amnon high in control no dental caries compared to dental caries dental caries in child china saliva 2-5 year-old child stage 6-year-old human stage shandong province 2022-12-30v31 / 74approvedNo
438amnonhigher in kindergarten compared to primary and middle school kids ( high in 2-5 year-old child stage age 3-6 compared to 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v41 / 76approvedNo
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 82approvedNo
959amnoncommon control, los angeles, state of california, united states of america, adolescent stage, 6-12 year-old child stage, child, feces, homo sapiens2022-12-19v41 / 83approvedNo
711amnon high in age 8-12 years child compared to adult in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v41 / 88approvedNo
997amnon high in iron deficiency anemia compared to no iron deficiency anemia in dental caries dental caries shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v31 / 89approvedNo
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 93approvedNo
961amnon high in 4-year-old human stage compared to 6-year-old human stage in zealand kingdom of denmark child homo sapiens feces 2022-12-20v41 / 97approvedNo
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 98approvedNo
961amnoncommon 6-year-old human stage, zealand, kingdom of denmark, child, homo sapiens, feces2022-12-20v41 / 101approvedNo
438amnoncommon 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v41 / 106approvedNo
997amnon high in dental caries dental caries compared to control no dental caries in shandong province 6-year-old human stage 2-5 year-old child stage saliva china child 2022-12-30v31 / 108approvedNo
658amnon high in asian burmese compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 118approvedNo
711amnon high in adult compared to age 8-12 years child in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v41 / 133approvedNo
997amnoncommon no dental caries, dental black stain, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 136approvedNo
997amnoncommon no dental black stain, no dental caries, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 141approvedNo
997amnoncommon no iron deficiency anemia, dental caries, dental caries, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 151approvedNo
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v31 / 157approvedNo
961amnon high in 6-year-old human stage compared to 4-year-old human stage in feces homo sapiens child kingdom of denmark zealand 2022-12-20v41 / 166approvedNo
658amnon high in asian burmese compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 166approvedNo
438amnonlower in kindergarten compared to primary and middle school kids ( high in 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 compared to 2-5 year-old child stage age 3-6 in homo sapiens feces china )2018-12-30v41 / 168approvedNo
924amnoncommon guangzhou city prefecture, 8-year-old human stage, 7-year-old human stage, child, supragingival dental plaque, supragingival plaque, china2022-07-27v31 / 181approvedNo
997amnoncommon iron deficiency anemia, dental caries, dental caries, shandong province, 6-year-old human stage, 2-5 year-old child stage, saliva, china, child2022-12-30v31 / 190approvedNo
959amnon high in control compared to ulcerative colitis ulcerative colitis in los angeles state of california united states of america adolescent stage 6-12 year-old child stage child feces homo sapiens 2022-12-19v41 / 194approvedNo
658amnon high in asian burmese compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v31 / 212approvedNo
438amnon high in 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage adult in homo sapiens feces china 2018-12-30v41 / 279approvedNo
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v41 / 486approvedNo

Problems / suggestions? Please email info AT dbbact DOT org