Summary for ontology term: 6-12 year-old child stage

Number of annotations with term: 34

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.064516
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.064516
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Eubacteriaceae;g__EubacteriumTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGCACCTTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCTTGCGAACTGGGGTGCTTGAGTGCAGGAGGGGAAAGTGGAATTCCTAGT0.064516
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.064516
d__Bacteria;p__Candidatus Saccharibacteria;g__Saccharibacteria_genera_incertae_sedisTACGTAGGGTGCAAGCATTATCCGGAGTGACTGGGCGTAAAGAGTTGCGTAGGCGGTTTAATAAGTGAATAGTGAAACCTGGTGGCTCAACCATACAGACTATTATTCAAACTGTTAAACTCGAGAATGGTAGAGGTAACTGGAATTTCT0.064516
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGCTTTTTAAGTCTGGAGTGAAAGCCCCTTTTTCAAGGAGGGGAGTGCTTTGGAGACTGGAGAGCTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.064516
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGCCGATTAAGTGTGGAGTGAAAGTCCACTTTTCAAGGGTGGAATTGCTTTGCAGACTGGTTGGCTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.064516
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.064516
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGCGTAGGCGGCCTGTTAAGCGGAATCTCTAATCTGAGGGCTCAACCCCCAGCCGGATTCCGAACTGGCAGGCTCGAGTTTGGTAGAGGAAGATGGAATTCCCAGT0.064516
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGTGTAAAGGGTGCGTAGGCGGGGAGTAAAGTCAGATGTGAAAGGCGTGTGCTCAACATACGGATTGCATTTGAAACTTACTTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCCAG0.064516

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.600000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.600000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.400000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGTGCAAGTCAGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTTGAAACTGTGCATCTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACAGCAAGTCTGATGTGAAAGCCCGGGGCCCAACCCCGGAACTGCATTGGAAACTGCTGGGCTTGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGGTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGCCAGACTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.400000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTCAGGAAAGTCTGGAGTAAAAGGCTATGGCTCAACCATAGTGTGCTCTGGAAACTGTCTGACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.400000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGAAAAGTCTGAAGTGAAAGGCAGTGGCTCAACCATTGTAGGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.400000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGATGGGGACGAACGTGCCTAATGCGAATAGTTTTAGGCAATGACGGTACCCATCGAGGAAGCCACGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCGACGCCGCGTGAGTGAAGAAGTATCTCGGTACGTAAAGCTCTATCAGCAGGGAAGAAAAAAGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGT0.255319
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATTCTGTGTGCACGAAGAAGGTTTTCGGATTGTAAAGTGCTTTCAGCAGGGAAGAAGGAAGTGACGGTACCTGCAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGCG0.253968
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGCACGGGACGAAAACCGAGCTTGAAAATATTGAGCTTGGGTGACGGTACCGAGCGAGGAAGCCACGG0.240000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CapnocytophagaTGAGGAATATTGGTCAATGGTCGGAAGACTGAACCAGCCATGCCGCGTGCAGGAAGAATGCCTTATGGGTTGTAAACTGCTTTTATATGGGAAGAATAAGGAGTACGTGTACTTTGATGACGGTACCATATGAATAAGCATCGGCTAACT0.235294
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCCGTGGTCAAGCCGCGACGTGGGTCGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.229508
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATTCTGTGTGCACGAAGAAGGTTTTCGGATTGTAAAGTGCTTTCAGCAGGGAAGAAGAAAGTGACGGTACCTGCAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGCG0.220183
d__Bacteria;p__"Bacteroidetes"TAGGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCATGCCGCGTGATGGATGACGGCCTTAGGGTTGTAAACATCTTTTCTACTAGAGGAATAGAGTTCACGTGTGGACAGACGACTGTATAGTAGGAATAAGGATCGGCTAACTC0.216216
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGTTAGGGACGAAGCCGCACCTGTTTTTGGGTGTGGTGACGGTACCTTTGTTAAGAAGCACCGGCTAA0.216216
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGAAGGCCTTCGGGTTGTAAACTCCTTTCGCCCGGGACGAAGCCCACCTGGTGGGTGACGGTACCGTGGAGAAGAAGCACCGGCTAACTACGTGCC0.205882

Annotations:

common ontology terms
term enrichment score
TermScore
7-year-old human stage0.641221
6-year-old human stage0.514286
8-year-old human stage0.514286
9-year-old human stage0.514286
10-year-old human stage0.514286
11-year-old human stage0.514286
state of nebraska0.339623
6-12 year-old child stage0.244898
child0.240000
burmese0.227273
supragingival dental plaque0.225000
asian0.204082
age 8-120.190476
caucasian0.185185
european0.185185
hispanic0.173913
supragingival plaque0.168224
hispanic or latin american0.160000
african american0.160000
age 8-12 years0.150000
LOWER IN burmese0.150000
LOWER IN asian0.139535
LOWER IN caucasian0.130435
LOWER IN european0.130435
state of colorado0.114286
bordeaux0.111111
age 3-60.105263
LOWER IN age 8-120.105263
LOWER IN age 3-60.105263
cystic fibrosis0.100000
LOWER IN hispanic0.100000
LOWER IN african american0.095238
LOWER IN hispanic or latin american0.095238
LOWER IN 6-12 year-old child stage0.090909
oral cavity0.088889
sweden0.085106
dentition0.080357
2-5 year-old child stage0.071429
LOWER IN 2-5 year-old child stage0.071429
jiangsu province0.071429
french republic0.066667
mouth0.061538
LOWER IN child0.057143
LOWER IN age 13-140.055556
age 13-140.055556
LOWER IN age 8-12 years0.055556
LOWER IN 14-year-old human stage0.054054
14-year-old human stage0.054054
LOWER IN 65-79 year-old human stage0.054054
65-79 year-old human stage0.054054
LOWER IN 7-year-old human stage0.054054
LOWER IN 13-year-old human stage0.052632
13-year-old human stage0.052632
LOWER IN fifth decade human stage0.052632
fifth decade human stage0.052632
2-year-old human stage0.050000
LOWER IN 2-year-old human stage0.050000
LOWER IN fourth decade human stage0.048780
fourth decade human stage0.048780
saliva0.036697
homo sapiens0.036232
LOWER IN adult0.019324
adult0.019324
united states of america0.015994
feces0.012403
china0.011257
Fraction of dbbact annotations with this term covered by the query
TermScore
bordeaux1.000000
7-year-old human stage0.666667
age 8-12 years0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
LOWER IN burmese0.500000
6-year-old human stage0.500000
8-year-old human stage0.500000
9-year-old human stage0.500000
10-year-old human stage0.500000
11-year-old human stage0.500000
burmese0.500000
LOWER IN age 8-12 years0.500000
6-12 year-old child stage0.400000
LOWER IN 14-year-old human stage0.333333
14-year-old human stage0.333333
LOWER IN 65-79 year-old human stage0.333333
65-79 year-old human stage0.333333
cystic fibrosis0.333333
LOWER IN asian0.333333
asian0.333333
hispanic0.333333
LOWER IN 7-year-old human stage0.333333
LOWER IN hispanic0.333333
LOWER IN 13-year-old human stage0.250000
13-year-old human stage0.250000
LOWER IN fifth decade human stage0.250000
fifth decade human stage0.250000
caucasian0.250000
european0.250000
state of nebraska0.250000
LOWER IN caucasian0.250000
LOWER IN european0.250000
LOWER IN african american0.250000
hispanic or latin american0.250000
LOWER IN hispanic or latin american0.250000
african american0.250000
LOWER IN 6-12 year-old child stage0.200000
2-year-old human stage0.166667
LOWER IN 2-year-old human stage0.166667
LOWER IN fourth decade human stage0.142857
fourth decade human stage0.142857
supragingival dental plaque0.142857
child0.138889
state of colorado0.111111
supragingival plaque0.100000
2-5 year-old child stage0.090909
LOWER IN 2-5 year-old child stage0.090909
jiangsu province0.090909
french republic0.076923
oral cavity0.071429
sweden0.066667
LOWER IN child0.055556
dentition0.043478
mouth0.041667
saliva0.021739
homo sapiens0.018450
LOWER IN adult0.011561
adult0.011561
united states of america0.008097
feces0.006369
china0.005814
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
child0.882353
united states of america0.647059
7-year-old human stage0.617647
dentition0.529412
state of nebraska0.529412
supragingival plaque0.529412
supragingival dental plaque0.529412
6-year-old human stage0.529412
8-year-old human stage0.529412
9-year-old human stage0.529412
10-year-old human stage0.529412
11-year-old human stage0.529412
feces0.235294
china0.176471
6-12 year-old child stage0.176471
caucasian0.147059
european0.147059
asian0.147059
burmese0.147059
oral cavity0.117647
state of colorado0.117647
mouth0.117647
age 8-120.117647
saliva0.117647
sweden0.117647
hispanic or latin american0.117647
hispanic0.117647
african american0.117647
age 8-12 years0.088235
LOWER IN asian0.088235
LOWER IN burmese0.088235
LOWER IN caucasian0.088235
LOWER IN european0.088235
age 3-60.058824
2-5 year-old child stage0.058824
LOWER IN age 8-120.058824
LOWER IN 6-12 year-old child stage0.058824
LOWER IN age 3-60.058824
LOWER IN 2-5 year-old child stage0.058824
LOWER IN adult0.058824
adult0.058824
LOWER IN child0.058824
french republic0.058824
cystic fibrosis0.058824
bordeaux0.058824
jiangsu province0.058824
LOWER IN african american0.058824
LOWER IN hispanic or latin american0.058824
LOWER IN hispanic0.058824
LOWER IN age 13-140.029412
LOWER IN 13-year-old human stage0.029412
LOWER IN 14-year-old human stage0.029412
age 13-140.029412
13-year-old human stage0.029412
14-year-old human stage0.029412
LOWER IN 65-79 year-old human stage0.029412
LOWER IN fourth decade human stage0.029412
LOWER IN fifth decade human stage0.029412
65-79 year-old human stage0.029412
fourth decade human stage0.029412
fifth decade human stage0.029412
2-year-old human stage0.029412
LOWER IN 7-year-old human stage0.029412
LOWER IN 2-year-old human stage0.029412
LOWER IN age 8-12 years0.029412
Exp. ID User ID Description Date Region Flag Sequences
711amnondominant homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 9
658amnon high in caucasian european compared to african american in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
658amnon high in caucasian european compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
596amnondominant homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 15
658amnon high in hispanic or latin american hispanic compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
658amnon high in african american compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 17
658amnon high in hispanic or latin american hispanic compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, supragingival dental plaque, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 22
658amnondominant homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 23
895amnondominant feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v4No1 / 25
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 27
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 28
658amnon high in african american compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 29
658amnon high in caucasian european compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 30
711amnoncommon homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 37
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 50
596amnoncommon homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 59
895amnoncommon feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v4No1 / 65
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
658amnoncommon homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 82
711amnon high in child age 8-12 years compared to adult in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 88
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 93
658amnoncommon homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, supragingival dental plaque, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 98
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
658amnon high in asian burmese compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 118
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 157
658amnon high in asian burmese compared to african american in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 166
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v4No1 / 168
658amnon high in asian burmese compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 212
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486

Problems / suggestions? Please email info AT dbbact DOT org