Summary for ontology term: 6-month-old human stage

Number of annotations with term: 16

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACATTAGAGACGGTACCTAACCAGAAAGCCACGGC0.125000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAAAGTCTGATCCAGCAATTCTGTGTGCACGATGACGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAAAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.062500
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.062500
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.062500
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAACTCTGTTGTTAGAGAAGAACAGCGCATAGAGTAACTGTTATGCGTGTGACGGTATCTAACCAGAAAGCCACGGC0.062500
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.062500
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTACGTAGGGGGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGTCTGTTAGGTCGGGAGTTAAATCCGGGGGCTCAACCCCCGTTCGCTCCCGATACCGGCAGACTTGAGTTTGGTAGGGGAAGGTGGAATTCCTAGT0.062500
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCTTCTTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAAGCTCAGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.062500
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.062500
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATAGGCAAGTCTGGAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGCAGATCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.062500

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACCCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAACTCCTG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGAGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACCCGGGCTTAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATGATTAAGTGGGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTCCAAACTGGTTATCTAGAGTGCAGGAGAGGAGAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTAATTGAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTAGCTAGAGTGTGGGAGAGGATGGTAGAATTCCAGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGTCGTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGATACTGGCGTCCTTGAGTGCGGTTGAGGTGTGCGGAATTCGTGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACATTAGAGACGGTACCTAACCAGAAAGCCACGGC0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGGAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACGCTGTGACGGTATCTTACCAGAAAGGGACGG0.206897
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCATAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATGGAAACTATGGAACTGGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.181818
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Erysipelotrichaceae_incertae_sedisGATGAACGCTGGCGGCATGCCTAATACATGCAAGTCGAACGAAGTTTCGAGGAAGCTTGCTTCCAAAGAGACTTAGTGGCGAACGGGTGAGTAACACGTAGGTAACCTGCCCATGTGTCCGGGATAACTGCTGGAAACGGTAGCTAAAAC0.160000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACGCTGTGACGGTATCTTACCAGAAAGGGACGG0.157895
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCTCGGCTTAACCGAGGAAGTGCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.150000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGACGGCAAGGCAAGTCTGAAGTGAAAGCCCGGTGCTTAACGCCGGGACTGCTTTGGAAACTGTTTAGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.148148
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAACGCTTCTTTCCTCCCGAGTGCTTGCACTCAATTGGAAAGAGGAGTGGCGGACGGGTGAGTAACACGTGGGTAACCTACCCATCAGAGGGGGATAACACTTGGAAACAGGTG0.148148
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGCTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.135135
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisGATGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAGCGAAGCACCTTGACGGATTTCTTCGGATTGAAGCCTTGGTGACTGAGCGGCGGACGGGTGAGTAACGCGTGGGTAACCTGCCTCATACAGGGGGATAACAGTTGGAAACGG0.133333

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
los angeles district1.000000
6-month-old human stage0.800000
hispanic0.333333
formula fed0.250000
hispanic or latin american0.250000
LOWER IN breast fed0.250000
breast fed0.250000
LOWER IN formula fed0.250000
LOWER IN 6-month-old human stage0.200000
1-month-old human stage0.166667
LOWER IN 1-month-old human stage0.166667
LOWER IN 2-year-old human stage0.166667
infant0.153846
LOWER IN 3-month-old human stage0.142857
LOWER IN 12-month-old human stage0.142857
state of california0.076923
sweden0.066667
kingdom of spain0.047619
child0.027778
saliva0.021739
female0.015873
homo sapiens0.014760
feces0.009554
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
6-month-old human stage0.937500
infant0.875000
feces0.750000
state of california0.625000
hispanic or latin american0.500000
los angeles district0.500000
hispanic0.500000
saliva0.250000
child0.250000
sweden0.250000
formula fed0.187500
breast fed0.187500
LOWER IN 3-month-old human stage0.125000
female0.125000
kingdom of spain0.125000
1-month-old human stage0.062500
LOWER IN 6-month-old human stage0.062500
LOWER IN 1-month-old human stage0.062500
LOWER IN 2-year-old human stage0.062500
LOWER IN 12-month-old human stage0.062500
LOWER IN breast fed0.062500
LOWER IN formula fed0.062500
Exp. ID User ID Description Date Region Flag Sequences
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 2-year-old human stage 3-month-old human stage 12-month-old human stage in homo sapiens saliva child sweden )2020-03-18v3No1 / 1
859amnon high in 1-month-old human stage compared to 6-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 8
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 13
596amnondominant homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 14
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 15
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 17
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
848amnoncommon feces, homo sapiens, infant, kingdom of spain, 6-month-old human stage2021-12-13v1No1 / 18
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 21
859amnon high in breast fed compared to formula fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 22
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
848amnondominant feces, homo sapiens, infant, kingdom of spain, 6-month-old human stage2021-12-13v1No1 / 25
596amnoncommon homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 35
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72

Problems / suggestions? Please email info AT dbbact DOT org