Summary for ontology term: 605 days

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCTTGCAAGTCTGAAGTGAAAACCCTGGGCTCAACCCTGGGATTGCTTTGGAAACTGTAGGACTGGAGTGTCGGAGGGGCATGTGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__AcidaminococcusTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGGCTTTTAAGTCCGACGTGAAAATGCGGGGCTTAACCCCGTATGGCGTTGGATACTGGAAGTCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaCACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCAGCTAGGTCGGGAGTCAAATCCGGGGGCCCAACCCCCGCCCGCTCCCGATACCGGCCGGCTTGAGTCTGGAAGGGGAAGGCGGAATTCCAAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATTGCAAGTCAGGTGTGAAATACATGGGCTTAACCCATGGGCTGCACTTGAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTGG0.500000
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGTTGCGTAAGCGCAAGGTGAAAGACCGAGGCTTAACTTCGGTGAGCCTTGTGAACTGCGTGACTTGAGTGCAGGAGGGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCGCGTTAAGTCAGCGGTGAAATCTCATGGCTCAACCATGGAACTGCCGTTGATACTGGCGTGCTCGAGTACGGACGGCGCCGGCGGAATGTGTCA0.500000
d__Bacteria;p__"Verrucomicrobia";c__Opitutae;o__Puniceicoccales;f__PuniceicoccaceaeTACGGAGACTACGAGCGTTACTCGGATTCACTGGGCGTAAAGGGAGCGCAGGCGGACTGGTGTGTTAGGTGTGAAATCTCGGAGCTTAACTTCGAAATTGCGCCTAAAACTATTAGTCTAGAGTATTGGAGAGGTAAGCGGAATTTCCGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Leuconostocaceae;g__WeissellaTACGTATGTTCCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGACGGTTATTTAAGTCTGAAGTGAAAGCCCTCAGCTCAACTGAGGAATTGCTTTGGAAACTGGATGACTTGAGTGCAGTAGAGGAAAGTGGAACTCCATG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGAGAGCGTAGACGGTAATGTAAGTCTGAAGTGAAATGCAGGGGCTTAACCCCTGAACTGCTTTGGAAACTATATAACTGGAGTACCGGAGGGGTAAGCGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCTTCGGCTCAACCGAAGAAGTGCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGAAGGGTGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGCCTATCAAGATAGCGGTGAAATGCCGGGGCTTAACCTCGGAACTGCCATTATTACTGGTAGGCTAGAATGACAGAGAGGATATTGGAATACCCAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCCACACAAGTCTGAAGTGAAACTCCACGGCTTAACCGTGGAACTGCTTTGGAAACTGTGCGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCCAG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGATAGTTAAGTCAGCGGTGAAATCTCACGGCTCAACCGTGGAACTGCCGTTGATACTGGCTGTCTGGAGTACGGACGGCGCCGGCGGAATGTGTCA0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCTCGGGGCTCAACCCCGGAACTGCTTTGGAAACTGTTTTACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGCGAAGGCGGTTTTGCAAGTCAACTGTCAAATCGCGGGGCTTAACCCCGCTCCGCAGTTGAAACTGTAAGACTGGAGGCACAGAGAGGCAGACAGAATTCCTGGT0.500000
d__BacteriaTACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCTTGTTAAGCGGGAGGTGAAATGCCGGCGCTCAACGTCGGAAGTGCCTCCCGAACTGGTGAGCTTGAATGACTCTGCCGTGGGAGGAATGTGTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGCGGCAAGTCAGAAGTGAAAATTATGGGCTCAACTCATAACCTGCTTTTGAAACTGTTGCTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGAAGGTTAAGCGTGACGTGAAATGTACCGGCTCAACCGGTGAATTGCGTCGCGAACTGGTTTTCTTGAGTGTGCAGAAGGAAGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGAAGATCAAGTCAGGTGTGAAAGGCATGGGCTCAACCCGTGGACTGCACTTGAAACTGGTCATCTTGAGTGTCGGAGGGGCAGGCGGAATTCCTGG0.500000
d__BacteriaTACATAGGTAGCGAGCGTTATCCGGAATAACTGGGTGTAAAGGGAGTGTAGGTGGATATGTAAGTCTGATGTGAAAGCCCGTGGCTTAACTGCGAGGATTGCACCAGAAACTGTATATCTAGAGTACGAGAGAGGCAAGTGGAATTCCTA0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGGAGATTAAGCGTGACGTGAAATGCCGCGGCTCAACCGTGGAAGTGCGTCGCGAACTGGTTTTCTTGAGTGTATTCGACGTCAGCGGAATTCGTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCAGCTAGGTCGGGAGTCAAATCCGGGGGCCCAACCCCCGTCCGCTCCCGATACCGGCCGGCTTGAGTCTGGCAGGGGAAGGTGGAATTCCCAGT0.500000
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGTTGCGTAAGCGCAAGGTGAAAGACCGAGGCTTAACTTCGGTGAGCCTTGTGAACTGCGTGACTTGAGTGCAGGAGGGGAAAGTGGAATTCCTAGT0.400000
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGAATTTATTGGGTGTAAAGCGTGTGTAGGCGGTTTAATTAGTCTAAGGTTTAAGTCCGAAGCTTAACTTCGGTTCGCCTTAGAAACTGTTTTACTTGAATGCGGTAGAGGCAAGTGGAATTTCTAGT0.400000
d__BacteriaTACAGAGGTCGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCGCGGCGTGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAAGTGCGTCCGAGACTGCCGCGCTCGAGTCCGGAAGGGGGAATCGGAATGCAGGG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTTACCTAAGCGAGAGGTTTAAGGCTATGGCTTAACTATAGTTCGCCTCCCGAACTGGGCAACTTGAGTGCAGGAGGGGAAAGCGGAATTCCTAGT0.400000
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGCCCTTTAAGCGAGAGGTTTAAGGCTATGGCTTAACCATAGTTCGCCTCCCGAACTGAAGGGCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.400000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAAGCAAGTCGGTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATCGAAACTGTTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.400000
d__Bacteria;p__Firmicutes;c__ClostridiaTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGCAGGCGGGACGGCAAGTTGGATGTGAAATACCGGGGCTTAACTCCGGAGCTGCATCCAAAACTGTTGTTCTTGAGTGGAGTAGAGGTAAGCGGAATTCCGAG0.400000
d__BacteriaTACGGAGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGCGGCGTGCCAAGTCAGGGGTGAAAGGTTCCGGCTCAACCGGGACAGTGCCCTTGATACTGGTGTGCTGGAGTGCGCTTGCCGTGGGAGGAATGAGTGG0.400000

Annotations:

common ontology terms
term enrichment score
TermScore
holstein-friesian bull0.666667
660 days0.500000
LOWER IN 605 days0.500000
605 days0.500000
LOWER IN 660 days0.500000
ireland0.333333
bos taurus0.105263
age0.090909
rumen0.083333
Fraction of dbbact annotations with this term covered by the query
TermScore
holstein-friesian bull0.500000
660 days0.500000
LOWER IN 605 days0.500000
605 days0.500000
LOWER IN 660 days0.500000
ireland0.200000
bos taurus0.055556
age0.047619
rumen0.043478
Fraction of annotations for the query sequences containing the term
TermScore
bos taurus1.000000
rumen1.000000
holstein-friesian bull1.000000
ireland1.000000
age1.000000
660 days0.500000
LOWER IN 605 days0.500000
605 days0.500000
LOWER IN 660 days0.500000

Problems / suggestions? Please email info AT dbbact DOT org