Summary for ontology term: acquired immunodeficiency syndrome

Number of annotations with term: 3

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGTGCTCAAGTTGAATGTGAAATGCAGAGGCTCAACCTCTGAATTGCGTTCAAAACTGAGTATCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Clostridium IVTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCGAGGCAAGTCAGGCGTGAAATCTATGGGCTTAACCCATAAACTGCGCTTGAAACTGTCTTGCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Erysipelotrichaceae_incertae_sedisTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCACGATAAGTCTGAAGTAAAAGGCAACAGCTCAACTGTTGTATGCTTTGGAAACTGTCGAGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGTACGTAGGTGGTTTCTTAAGCGCAGGGTATAAGGCAATGGCTTAACCATTGTTCGCCTTGCGAACTGGGGGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__BacteriaTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCGAGATAAGTCTGAGGTAAAAGCCCGTGGCTCAACCACGGTAAGCCTTGGAAACTGTCTGGCTGGAGTGCAGGAGAGGACAATGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGCAGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCCGGACTGCATTGGAAACTGTTGATCTTGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EggerthellaTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGAGCGCGTAGGCGGCCTCTCAAGCGGGATCTCTAATCCGAGGGCTCAACCCCCGGCCGGATCCCGAACTGGGAGGCTCGAGTTCGGTAGAGGCAGGCGGAATTCCCGGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGGAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTTCTGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACAGCAAGTCTGAAGTGAAATCCCCGGGCTCAACCCGGGAACTGCTTTGGAAACTGTTGGGCTGGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGTTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGCGTGTAGGCGGAGCTGCAAGTCAGATGTGAAATCCCGGGGCTCAACCCCGGAACTGCATTTGAAACTGTAGCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTCGTTCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.666667
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGTAGACGGCTGAGTAAGTTACTGGTGAAAGCCCAGCTTTTAAGGCTGGAATTGCCGGTAATACTGTTCAGCTTGAGTGCAGGAGAGGGAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGCATGCAAGTCAGATGTGAAATCTCAGGGCTTAACCCTGAAACTGCATTTGAAACTGTATGTCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG0.666667
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGAAGTGAAAGTCCTGCTTTCAAGGTGGGAAGTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.666667
d__Bacteria;p__FirmicutesTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGTGTAGGCGGCTAAGTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGCATAGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCCAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGAAGTGAAAGCCCGGTGCTTAACGCCGGGACTGCTTTGGAAACTGTTTGGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCAAGGCAAGCCAGAAGTGAAAACCCGGGGCTCAACCGCGGGATTGCTTTTGGAACTGTCATGCTAGAGTGCAGGAGGGGTGAGCGGAATTCCTAG0.333333
d__BacteriaTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTTGTTTAAGTCAGATGTGAAATACCCGGGCTTAACTCGGGGGCTGCATCTGATACTGGATAACTAGAGTGCAGGAGAGGAAAGTGGAATTCCTAG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGTGCTCAAGTTGAATGTGAAATGCAGAGGCTCAACCTCTGAATTGCGTTCAAAACTGAGTATCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGTACGTAGGTGGTTTCTTAAGCGCAGGGTATAAGGCAATGGCTTAACCATTGTTCGCCTTGCGAACTGGGGGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.142857
d__BacteriaTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCGAGATAAGTCTGAGGTAAAAGCCCGTGGCTCAACCACGGTAAGCCTTGGAAACTGTCTGGCTGGAGTGCAGGAGAGGACAATGGAATTCCATGT0.095238
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Erysipelotrichaceae_incertae_sedisTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCACGATAAGTCTGAAGTAAAAGGCAACAGCTCAACTGTTGTATGCTTTGGAAACTGTCGAGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.042553
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACAGCAAGTCTGAAGTGAAATCCCCGGGCTCAACCCGGGAACTGCTTTGGAAACTGTTGGGCTGGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.033898
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGGAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTTCTGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.021978
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EggerthellaTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGAGCGCGTAGGCGGCCTCTCAAGCGGGATCTCTAATCCGAGGGCTCAACCCCCGGCCGGATCCCGAACTGGGAGGCTCGAGTTCGGTAGAGGCAGGCGGAATTCCCGGT0.021053
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGCAGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCCGGACTGCATTGGAAACTGTTGATCTTGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.018692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Clostridium IVTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCGAGGCAAGTCAGGCGTGAAATCTATGGGCTTAACCCATAAACTGCGCTTGAAACTGTCTTGCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.017391
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.012048

Annotations:

common ontology terms
term enrichment score
TermScore
LOWER IN acquired immunodeficiency syndrome0.571429
amsterdam0.400000
acquired immunodeficiency syndrome0.400000
kingdom of the netherlands0.285714
homosexual0.222222
msm0.222222
LOWER IN hiv infection0.173913
hiv infection0.153846
adult0.011494
control0.010724
LOWER IN control0.010638
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN acquired immunodeficiency syndrome0.500000
acquired immunodeficiency syndrome0.500000
amsterdam0.250000
kingdom of the netherlands0.166667
homosexual0.166667
msm0.166667
LOWER IN hiv infection0.100000
hiv infection0.100000
adult0.005780
control0.005405
LOWER IN control0.005405
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
adult1.000000
kingdom of the netherlands1.000000
amsterdam1.000000
control0.666667
LOWER IN hiv infection0.666667
LOWER IN acquired immunodeficiency syndrome0.666667
hiv infection0.333333
acquired immunodeficiency syndrome0.333333
LOWER IN control0.333333
homosexual0.333333
msm0.333333

Problems / suggestions? Please email info AT dbbact DOT org