Summary for ontology term: acute severe colitis

Number of annotations with term: 3

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__HaemophilusTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGGTGTGAAAGCCCTGGGCTTAACCTAGGAATTGCATTTCAGACTGGGTAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.054054
GTTTTAATTTTTGTAGAGAAGGAGTCTTGCTATGTTGCCCAGGCTGGTCTCAAACTCCTGGGCTCAAGCAATCTGCCTGCCTTGGCCTCATAAAGTGCTAGGATTACAGGCGTAAGCCACCATGCCAAGCCACCTTCTTTTGATTTTTAC0.044444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__HungatellaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTAAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGTACTGCTTTGGAAACTGTTTGACTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.030769
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATAGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.022346
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTGTTGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.021622
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATGTCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.019704
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.018634
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__IntestinibacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.015936
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.014870
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGTCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.014286

Annotations:

common ontology terms
term enrichment score
TermScore
acute severe colitis0.666667
before antibiotics0.400000
LOWER IN amoxicillin0.400000
LOWER IN doxycycline0.400000
LOWER IN vancomycin0.285714
ulcerative colitis0.222222
LOWER IN metronidazole0.200000
LOWER IN antibiotic0.105263
child0.054054
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
acute severe colitis0.500000
before antibiotics0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
LOWER IN vancomycin0.250000
LOWER IN metronidazole0.142857
ulcerative colitis0.125000
LOWER IN antibiotic0.062500
child0.027778
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
ulcerative colitis1.000000
child1.000000
acute severe colitis1.000000
before antibiotics0.333333
LOWER IN antibiotic0.333333
LOWER IN vancomycin0.333333
LOWER IN metronidazole0.333333
LOWER IN amoxicillin0.333333
LOWER IN doxycycline0.333333

Problems / suggestions? Please email info AT dbbact DOT org