Summary for ontology term: adult

Number of annotations with term: 1065

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.005758
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCCAGGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTTGAAACTGCAGGGCTAGAGTGCAGGAGGGGCAAGTGGAATTCCTAG0.005758
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.005758
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTCGTTCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.005758
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTCAACTCGTGAACTGCATTTGAAACTACTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.005758
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGCAAGTTGGAAGTGAAATCCGGGGGCTTAACCCCCGAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.005758
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.004798
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCCTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTAAGCCGCCGAAACTGGAGGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.004798
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.004798
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.004798

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.280000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.280000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EggerthellaTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGAGCGCGTAGGCGGCCTCTCAAGCGGGATCTCTAATCCGAGGGCTCAACCCCCGGCCGGATCCCGAACTGGGAGGCTCGAGTTCGGTAGAGGCAGGCGGAATTCCCGGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTGTGTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTGGAAACTATGTAACTAGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CoprobacillusTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCAATAGAGGTCTGCGGTGAAAGCCTGAAGCTAAACTTCAGTAAGCCGTGGAAACCAAATAGCTAGAGTGCAGTAGAGGATCGTGGAATTCCATGT0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AbiotrophiaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGTGTAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAATTCCATG0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.160000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.160000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.160000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.266758
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.261759
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.253832
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.252602
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.246770
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTATCTTACCAGAAAGGGACGG0.239521
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.235606
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.232530
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGG0.224649
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.222798

Annotations:

common ontology terms
term enrichment score
TermScore
adult1.002626
homo sapiens0.692971
feces0.407448
united states of america0.249948
female0.176834
control0.176313
china0.173340
saliva0.162282
skin0.117026
human adult stage0.113116
state of new york0.106599
LOWER IN control0.097283
subgingival plaque0.084711
kingdom of spain0.083098
city0.065680
canada0.063241
rural community0.061947
periodontitis0.058073
oral cavity0.057516
obesity0.057296
male0.057159
dentition0.055315
mouth mucosa0.055013
brazil0.053936
research facility0.053333
subgingival dental plaque0.050974
oral wash0.048966
state of california0.045512
ulcerative colitis0.044676
amsterdam0.043439
czech republic0.042516
kingdom of the netherlands0.040840
guangzhou city prefecture0.039939
LOWER IN adult0.039458
frog0.039158
biopsy0.039158
japan0.039030
fourth decade human stage0.038426
epidermis0.038161
pregnancy0.038043
province of ontario0.036759
buccal mucosa0.036697
taiwan0.036641
age 25-45 years0.036530
high bmi0.036493
crohn's disease0.035982
belgium0.035768
vagina0.035714
italy0.035465
municipality of beijing0.034934
mouth0.034335
commonwealth of pennsylvania0.030937
supragingival plaque0.030842
pair of nares0.030779
homosexual0.029170
msm0.029170
thailand0.029029
human late adulthood stage0.029001
south korea0.028834
farm0.028552
state of florida0.028505
germany0.027411
australia0.026468
republic of china0.025783
tongue0.025618
supragingival dental plaque0.025618
poland0.025478
united kingdom0.025457
state of michigan0.025455
hospital0.025187
state of texas0.024978
large intestine0.024119
third decade human stage0.024046
palatine tonsil0.023926
hiv infection0.023459
zhejiang province0.023277
ireland0.023009
intestine0.022619
egypt0.022039
gay0.022039
cambridgeshire0.022039
tanzania0.021918
newt0.021798
macaca mulatta0.021680
hispanic or latin american0.021563
human early adulthood stage0.021183
colombia0.020888
monkey0.020779
sweden0.020424
type 2 diabetes mellitus0.020377
chronic periodontitis0.020342
msw0.020308
heterosexual0.020308
LOWER IN ulcerative colitis0.020205
nasal cavity0.020198
LOWER IN oral wash0.019937
captive0.019264
low bmi0.018519
overweight body mass index status0.018519
sputum0.018490
Fraction of dbbact annotations with this term covered by the query
TermScore
cigarette smoking1.333333
adult1.032258
third trimester1.000000
LOWER IN 65-79 year-old human stage1.000000
65-79 year-old human stage1.000000
non-pregnant1.000000
LOWER IN non-pregnant1.000000
vegetarian diet1.000000
LOWER IN vegetarian diet1.000000
non-smoker1.000000
LOWER IN 4-year-old human stage1.000000
no dental caries1.000000
LOWER IN non-smoker1.000000
LOWER IN cigarette smoking1.000000
pig farm1.000000
chicken farm1.000000
LOWER IN chicken farm1.000000
LOWER IN pig farm1.000000
cardiovascular risk group1.000000
large intestine1.000000
smoker1.000000
subgingival dental plaque0.833333
buccal mucosa0.800000
third decade human stage0.800000
taiwan0.750000
type 2 diabetes mellitus0.750000
fourth decade human stage0.750000
oral wash0.714286
toronto0.666667
slovak republic0.666667
athlete0.666667
umbilicus0.666667
LOWER IN tadpole0.666667
tadpole0.666667
shanghai district0.666667
low bmi0.666667
LOWER IN low bmi0.666667
cuba0.666667
nasal cavity mucosa0.666667
overweight body mass index status0.666667
age 25-45 years0.666667
chronic periodontitis0.666667
milan0.666667
republic of china0.666667
25-44 year-old human stage0.666667
LOWER IN 25-44 year-old human stage0.666667
LOWER IN iga positive fraction0.666667
iga negative fraction0.666667
LOWER IN iga negative fraction0.666667
iga positive fraction0.666667
osteopilus septentrionalis0.666667
plant fiber cell0.666667
LOWER IN plant fiber cell0.666667
LOWER IN smoker0.666667
high bmi0.642857
saliva0.638298
obesity0.615385
amsterdam0.600000
high physical activity0.600000
LOWER IN msw0.600000
LOWER IN heterosexual0.600000
msw0.600000
heterosexual0.600000
sputum0.600000
dermal layer of tongue0.600000
palatine tonsil0.600000
clostridium difficile infection0.600000
guangzhou city prefecture0.600000
LOWER IN buccal mucosa0.600000
homo sapiens0.574394
pregnancy0.538462
rural community0.538462
state of new york0.538462
subgingival plaque0.533333
taipei city0.500000
low anterior resection0.500000
LOWER IN low anterior resection0.500000
LOWER IN short bowel syndrome0.500000
short bowel syndrome0.500000
phoenix0.500000
state of arizona0.500000
invasive carcinoma0.500000
invasive cervical carcinoma0.500000
cervical carcinoma0.500000
dysplasia of cervix0.500000
LOWER IN dysplasia of cervix0.500000
centererians0.500000
LOWER IN centenerians0.500000
age 12-23 years0.500000
LOWER IN age 12-23 years0.500000
LOWER IN induced periodontitis0.500000
induced periodontitis0.500000
morning0.500000
age 21-28 years0.500000
egypt0.500000
camel0.500000
camelus dromedarius0.500000
LOWER IN fresh clover diet0.500000
clover hay diet0.500000
fresh clover diet0.500000
Fraction of annotations for the query sequences containing the term
TermScore
adult0.974648
homo sapiens0.873239
feces0.523944
united states of america0.289202
china0.173709
control0.126761
female0.108920
saliva0.092958
skin0.075117
human adult stage0.065728
LOWER IN control0.059155
state of new york0.059155
research facility0.046948
subgingival plaque0.046009
kingdom of spain0.046009
canada0.037559
city0.036620
rural community0.032864
male0.031925
periodontitis0.030986
oral cavity0.030986
dentition0.030047
brazil0.030047
obesity0.030047
mouth mucosa0.029108
subgingival dental plaque0.026291
oral wash0.025352
state of california0.025352
LOWER IN adult0.023474
ulcerative colitis0.023474
czech republic0.022535
amsterdam0.022535
kingdom of the netherlands0.021596
guangzhou city prefecture0.020657
province of ontario0.020657
epidermis0.020657
japan0.020657
frog0.020657
biopsy0.020657
pregnancy0.019718
fourth decade human stage0.019718
taiwan0.018779
vagina0.018779
belgium0.018779
mouth0.018779
buccal mucosa0.018779
crohn's disease0.018779
high bmi0.018779
age 25-45 years0.018779
municipality of beijing0.018779
italy0.018779
pair of nares0.015962
commonwealth of pennsylvania0.015962
supragingival plaque0.015962
farm0.015962
homosexual0.015023
msm0.015023
human late adulthood stage0.015023
south korea0.015023
state of florida0.015023
germany0.015023
australia0.015023
united kingdom0.015023
thailand0.015023
poland0.014085
tongue0.013146
state of texas0.013146
hospital0.013146
supragingival dental plaque0.013146
state of michigan0.013146
republic of china0.013146
hiv infection0.012207
sweden0.012207
intestine0.012207
zhejiang province0.012207
third decade human stage0.012207
palatine tonsil0.012207
large intestine0.012207
ireland0.012207
monkey0.011268
macaca mulatta0.011268
egypt0.011268
gay0.011268
hispanic or latin american0.011268
tanzania0.011268
newt0.011268
cambridgeshire0.011268
colombia0.011268
human early adulthood stage0.011268
msw0.010329
heterosexual0.010329
type 2 diabetes mellitus0.010329
nasal cavity0.010329
captive0.010329
chronic periodontitis0.010329
LOWER IN ulcerative colitis0.010329
LOWER IN oral wash0.010329
LOWER IN child0.009390
state of arizona0.009390
LOWER IN female0.009390
Exp. ID User ID Description Date Region Flag Sequences
578amnon high in hiv infection compared to control in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v3No1 / 1
606amnonnegatively correlated with age in human penis skin ( high in young age compared to old age in penis skin adult south africa homo sapiens male organism male )2020-04-15v3No1 / 1
114amnondominant rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 1
680amnon high in bifidobacterium longum probiotic probiotic compared to control in obesity adult novosibirsk russia feces homo sapiens 2028-03-04v3No1 / 1
689amnon high in non c. diff diarrhea compared to clostridium difficile infection clostridium difficile colitis in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v4No1 / 1
723amnonlower in females that gave birth during last 6 months ( high in birth in over 6 months compared to birth during last 6 months in municipality of yogyakarta vagina adult female indonesia homo sapiens )2021-01-02v3No1 / 1
736amnon high in control compared to helminthiasis parasitic helminthiasis infectious disease in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 1
467amnonhigher in arabinoxylan and resistant starch diet compared to normal diet ( high in plant fiber cell high fiber high arabinoxylan and resistant starch diet compared to control diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 1
806amnon high in cigarette smoking nicotine dependence smoker compared to non-smoker in mouth mucosa buccal mucosa homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 1
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens russia adult 2020-01-05v3No1 / 2
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult mouth mucosa buccal mucosa 2020-01-09v3No1 / 2
694amnon high in control compared to polycystic ovary syndrome in china shanghai district obesity adult female feces homo sapiens 2028-03-17v3No1 / 2
725amnon high in control compared to periodontitis acute pericementitis in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 2
849amnon high in multiple sclerosis multiple sclerosis compared to control in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 2
850amnoncommon in vitro fertilization clinic, adult, anambra state, nigeria, female organism, vagina, homo sapiens2021-12-16v4No1 / 2
869amnon high in before roux-en-y gastric bypass surgery compared to after roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 2
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage amsterdam kingdom of the netherlands male adult vancomycin antibiotic homo sapiens feces 2022-02-19v3No1 / 2
877amnon high in low breath methane content compared to high breath methane content in human early adulthood stage adult homo sapiens feces austria 2022-03-08v4No1 / 2
529amnonlower in CRC patients that underwent low anterior resection ( high in control compared to low anterior resection in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 3
66amnon high in male compared to female in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
66amnon high in female compared to male in homo sapiens saliva amsterdam adult 2017-02-18v4No1 / 3
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 3
593amnon high in osteoarthritis compared to rheumatoid arthritis in homo sapiens feces adult south korea 2020-03-08v3No1 / 3
689amnon high in clostridium difficile infection clostridium difficile colitis compared to non c. diff diarrhea in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v4No1 / 3
725amnon high in control compared to periodontitis acute pericementitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 3
806amnon high in buccal mucosa mouth mucosa compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 3
833amnon high in athlete high exercise compared to normal exercise in homo sapiens feces age 60-65 years slovak republic adult 2021-09-11v1No1 / 3
492amnoncommon skin, adult, cuba, frog, eleutherodactylus atkinsi2019-02-27v4No1 / 3
803amnon high in control compared to type 2 diabetes mellitus in human late adulthood stage commonwealth of massachusetts caribbean latino adult united states of america feces homo sapiens 2021-06-18v4No1 / 3
32amnon high in infant compared to adult in homo sapiens saliva bolivia 2016-12-05v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
593amnon high in rheumatoid arthritis compared to osteoarthritis in homo sapiens feces adult south korea 2020-03-08v3No1 / 4
597amnon high in gout compared to control in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
597amnon high in control compared to gout in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
685amnon high in control compared to helicobacter pylori infectious disease in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 4
715amnon high in 65-79 year-old human stage compared to third decade human stage fourth decade human stage in oesophageal brush esophagus australia adult homo sapiens 2028-05-22v4No1 / 4
716amnon high in chronic bad breath halitosis compared to control in tongue china dermal layer of tongue homo sapiens adult 2028-05-22v3No1 / 4
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in homo sapiens feces adult )2018-04-19v4No1 / 4
850amnoncommon sperm, semen, male organism, in vitro fertilization clinic, anambra state, nigeria, adult, homo sapiens2021-12-16v4No1 / 4
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 5
97amnondominant calophya, adult, brazil, state of florida2017-04-01v4No1 / 5
644amnonhigher in younger adults (total age range 20-80) ( high in young age compared to old age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 5
685amnon high in evening compared to morning in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 5
731amnonhigher in oropharingeal otic fluid drainage compared to buccal mucosa ( high in oropharynx compared to buccal mucosa mouth mucosa in adult state of michigan united states of america homo sapiens )2021-01-09v4No1 / 5
779amnon high in ulcerative colitis compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 5
794amnon high in antiretroviral therapy human immunodeficiency virus infectious disease hiv infection compared to control in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 5
806amnon high in hard palate compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 5
831amnon high in control compared to pancreatic cancer in israel adult feces homo sapiens 2021-09-11v3No1 / 5
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens subgingival dental plaque subgingival plaque china adult municipality of shanghai periodontitis chronic periodontitis 2021-09-11v3No1 / 5
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 5
519amnon high in control compared to dental caries in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 5
113amnondominant danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 6
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 6
670amnondominant dolphin parasite, croatia, opatija, anisakis pegreffii, adult organism, adult2020-09-26v4No1 / 6
703amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v3No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 6
773amnon high in recurrent tonsillitis tonsillitis compared to iga glomerulonephritis in homo sapiens adult japan tonsillectomy palatine tonsil 2021-04-23v4No1 / 6
400amnonpositively correlated with bmi ( high in high bmi compared to low bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 6
856amnon high in control compared to ulcerative colitis ulcerative colitis in rectum intestinal mucosa human adult stage adult china biopsy homo sapiens 2022-01-09v3No1 / 6
868amnon high in iga negative fraction compared to iga positive fraction in human adult stage province of alberta clostridium difficile infection canada adult clostridium difficile colitis homo sapiens feces 2022-02-12v4No1 / 6
535amnoncommon in healthy adult vaginal samples (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, control)2019-07-25v4No1 / 7
551amnondominant egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 7
632amnondominant caecum, cecal content, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 7
644amnonpositively correalted with bmi ( high in high bmi body mass index compared to low bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 7
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 7
663amnondominant lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 7
685amnon high in helicobacter pylori infectious disease compared to control in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 7
717amnondominant dorsum, back, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 7
734amnon high in vegetarian diet compared to omnivore diet in republic of china taiwan adult feces homo sapiens 2021-01-22v3No1 / 7
277amnon high in nasopharynx compared to nasal cavity pair of nares in homo sapiens belgium adult 2018-01-23v4No1 / 7
354amnon high in saliva oral wash compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 7
806amnon high in oral wash oral cavity compared to saliva in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 7
378amnon high in periodontitis compared to control in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 7
833amnon high in normal exercise compared to athlete high exercise in adult slovak republic age 60-65 years feces homo sapiens 2021-09-11v1No1 / 7
841amnon high in iga negative fraction compared to iga positive fraction in human adult stage state of texas adult saliva united states of america homo sapiens 2021-11-08v4No1 / 7
850amnon high in semen sperm male organism compared to vagina female organism in in vitro fertilization clinic anambra state nigeria adult homo sapiens 2021-12-16v4No1 / 7
930amnon high in non-smoker compared to cigarette smoking in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 7
526amnonhigh freq in bile of Cholelithiasis patients (dominant homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 7
594amnondominant adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 8
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 8
180amnondominant dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 8
717amnondominant upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 8
749amnondominant third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 8
819amnondominant dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v1No1 / 8
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 8
483amnondominant hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-13v4No1 / 8
516amnoncommon homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 8
535amnon high in dysplasia of cervix compared to control in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 9
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in amsterdam kingdom of the netherlands adult homosexual msm feces homo sapiens 2020-05-31v4No1 / 9
630amnon high in high physical activity compared to sedentary low physical activity in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 9
678amnon high in tooth disease black dental staining compared to control in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v3No1 / 9
693amnon high in control compared to polycystic ovary syndrome in graz city district austria adult feces homo sapiens female 2028-03-16v1No1 / 9
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
773amnonhigh in non iga bound bacteria compared to iga bound bacteria ( high in iga negative fraction compared to iga positive fraction in homo sapiens adult japan tonsillectomy palatine tonsil )2021-04-23v4No1 / 9
773amnonhigh in iga bound bacteria compared to non iga bound bacteria ( high in iga positive fraction compared to iga negative fraction in homo sapiens adult japan tonsillectomy palatine tonsil )2021-04-23v4No1 / 9
775amnon high in control compared to lichen planus in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 9
819amnondominant adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v1No1 / 9
819amnondominant skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 9
866amnon high in ulcerative colitis ulcerative colitis compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 9
868amnonhigher in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga positive fraction compared to iga negative fraction in province of alberta canada adult homo sapiens feces )2022-02-12v4No1 / 9
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high arabinoxylan and resistant starch diet plant fiber cell high fiber arabinoxylan diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 9
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult lip mouth mucosa lower labial mucosa 2020-01-09v3No1 / 10
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 10
632amnondominant feces, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 10
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 10
711amnondominant adult, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 10
724amnon high in pregnancy pregnancy trimester 2 compared to non-pregnant in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 10
724amnondominant non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 10
749amnondominant third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 10
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (dominant newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 10
353amnonhigh freq. in wild Triturus cristatus newts skin (dominant newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 10
354amnondominant homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 10
806amnon high in dentition supragingival plaque supragingival dental plaque compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 10
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
868amnonlower in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga negative fraction compared to iga positive fraction in canada province of alberta adult feces homo sapiens )2022-02-12v4No1 / 10
519amnon high in dental caries compared to control in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 10
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, control)2019-07-25v4No1 / 11
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 11
535amnonhcommon in adult vaginal samples with cervical dysplasia (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, dysplasia of cervix)2019-07-25v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 11
567amnoncommon belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 11
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 11
670amnon high in larval stage compared to adult adult organism in dolphin parasite croatia opatija anisakis pegreffii 2020-09-26v4No1 / 11
717amnondominant chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 11
717amnondominant plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 11
757amnon high in female compared to male in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 11
354amnondominant homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 11
806amnon high in palatine tonsil compared to oral wash oral cavity in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 11
819amnon high in low atmospheric pollution dalian city prefecture compared to high atmospheric pollution baoding city prefecture in age 25-45 years china scalp adult skin female homo sapiens 2021-07-12v1No1 / 11
819amnondominant dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 11
849amnon high in control compared to multiple sclerosis multiple sclerosis in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 11
492amnondominant skin, adult, cuba, frog, eleutherodactylus atkinsi2019-02-27v4No1 / 11
556amnondominant homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 12
567amnoncommon belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 12
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 12
118amnoncommon in captive reared butterfly (common butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, adult, body proper, whole body, forest ecosystem)2017-04-11v4No1 / 12
684amnondominant middle nasal meatus, nasal cavity, nasal cavity mucosa, nose, commonwealth of pennsylvania, united states of america, adult, homo sapiens2028-03-05v1No1 / 12
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 12
717amnondominant palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 12
717amnondominant external nose, outer nose, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 12
724amnondominant pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 12
773amnon high in iga glomerulonephritis compared to recurrent tonsillitis tonsillitis in homo sapiens adult japan tonsillectomy palatine tonsil 2021-04-23v4No1 / 12
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 12
796amnon high in control compared to graves' disease in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 12
354amnondominant homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 12
806amnondominant gingiva, keratinized gingiva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 12
806amnon high in saliva compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 12
873amnondominant urban community, human adult stage, commonwealth of pennsylvania, adult, united states of america, homo sapiens, feces2022-03-03v1No1 / 12
918amnon high in non-pregnant compared to third trimester pregnancy in female japan human early adulthood stage adult homo sapiens saliva 2022-07-15v3No1 / 12
941amnondominant homo sapiens, feces, thailand, farm, adult, nan province, village, rural community, chicken farm2022-11-25v4No1 / 12
567amnondominant belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 13
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 13
594amnondominant adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 13
97amnoncommon calophya, adult, brazil, state of florida2017-04-01v4No1 / 13
636amnoncommon hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 13
644amnondominant adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 13
717amnondominant armpit, axilla, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 13
725amnondominant control, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 13
731amnondominant buccal mucosa, mouth mucosa, adult, state of michigan, united states of america, homo sapiens2021-01-09v4No1 / 13
833amnondominant high exercise, athlete, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v1No1 / 13
400amnonhigh freq. in hmong (chinese) females from thailand (dominant homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
868amnon high in iga positive fraction compared to iga negative fraction in clostridium difficile colitis clostridium difficile infection human adult stage adult province of alberta canada homo sapiens feces 2022-02-12v4No1 / 13
930amnon high in cigarette smoking compared to non-smoker in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 13
930amnondominant human adult stage, cigarette smoking, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 13
492amnondominant brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 13
492amnondominant brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 13
492amnondominant skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 13
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 13
806amnondominant oral cavity, mouth, oral wash, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 13
516amnondominant homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 13
546amnondominant homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 14
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth czech republic adult 2020-01-09v3No1 / 14
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult lip mouth mucosa lower labial mucosa 2020-01-09v3No1 / 14
576amnondominant homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 14
576amnondominant homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 14
118amnoncommon in wild butterfly (common butterfly, heliconius erato, panama, whole body, adult, body proper, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 14
118amnon high in adult compared to pupa shelled egg in butterfly heliconius erato panama tropical and subtropical moist broadleaf forest biome body proper whole body forest ecosystem 2017-04-11v4No1 / 14
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 14
684amnoncommon middle nasal meatus, nasal cavity, nasal cavity mucosa, nose, commonwealth of pennsylvania, united states of america, adult, homo sapiens2028-03-05v1No1 / 14
693amnondominant graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 14
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v4No1 / 14
725amnondominant chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
725amnondominant acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
734amnon high in omnivore diet compared to vegetarian diet in republic of china taiwan adult feces homo sapiens 2021-01-22v3No1 / 14
277amnondominant homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 14
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v4No1 / 14
831amnondominant israel, adult, feces, homo sapiens, pancreatic cancer2021-09-11v3No1 / 14
834amnondominant homo sapiens, feces, japan, adult2021-09-11v1No1 / 14
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 14
850amnondominant in vitro fertilization clinic, anambra state, female organism, nigeria, adult, vagina, homo sapiens2021-12-16v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 14
873amnondominant human adult stage, rural community, africa, tanzania, adult, homo sapiens, feces2022-03-03v1No1 / 14
438amnondominant tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v4No1 / 14
930amnondominant human adult stage, non-smoker, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 14
469amnondominant homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
651amnondominant control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
651amnondominant parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
380amnondominant tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 15
671amnondominant female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 15
685amnondominant oral cavity, mouth mucosa, australia, adult, homo sapiens2028-03-08v3No1 / 15
707amnon high in systemic lupus erythematosus compared to control in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 15
723amnoncommon municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 15
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 15
276amnondominant feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 15
779amnon high in crohn's disease compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 15
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 15
354amnondominant homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 15
806amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 15
819amnoncommon dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v1No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 15
846amnondominant stimulated saliva, human adult stage, commonwealth of massachusetts, adult, saliva, united states of america, homo sapiens2021-11-20v3No1 / 15
850amnondominant in vitro fertilization clinic, anambra state, sperm, semen, male organism, nigeria, adult, homo sapiens2021-12-16v4No1 / 15
873amnondominant human adult stage, botswana, rural community, africa, adult, homo sapiens, feces2022-03-03v1No1 / 15
409amnondominant homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 15
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
802amnondominant cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v4No1 / 15
805amnondominant sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v3No1 / 15
502amnondominant homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
806amnondominant dorsum of tongue, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 15
524amnondominant homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 15
532amnondominant homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 16
535amnonhigh freq. in adult vaginal samples with cervical dysplasia (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, dysplasia of cervix)2019-07-25v4No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 16
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in homo sapiens feces sichuan province )2016-12-06v4No1 / 16
567amnondominant belgium, adult, homo sapiens, nasopharynx2019-12-05v4No1 / 16
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult tongue 2020-01-09v3No1 / 16
606amnonpositively correlated with age in human penis skin ( high in old age compared to young age in penis skin adult south africa homo sapiens male organism male )2020-04-15v3No1 / 16
118amnonhigh freq. in wild butterfly (dominant butterfly, heliconius erato, panama, whole body, adult, body proper, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
652amnondominant sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 16
663amnondominant pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v4No1 / 16
678amnondominant control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 16
680amnondominant obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 16
683amnondominant during antibiotics treatment in feces (dominant metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v4No1 / 16
717amnondominant upper leg skin, inner thigh, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 16
723amnondominant feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 16
725amnondominant chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 16
728amnoncommon clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 16
753amnondominant zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v4No1 / 16
310amnondominant homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
794amnondominant control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 16
345amnondominant homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 16
348amnondominant homo sapiens, saliva, italy, adult2018-07-16v4No1 / 16
371amnonnegatively correlated with age in amerindian saliva ( high in obsolete_juvenile stage infant compared to adult in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v4No1 / 16
884amnondominant human adult stage, state of california, adult, united states of america, homo sapiens, feces2022-03-24v4No1 / 16
941amnondominant homo sapiens, feces, thailand, farm, pig farm, adult, nan province, village, rural community2022-11-25v4No1 / 16
943amnonhigher before 6 day plant based diet ( high in normal diet compared to vegetarian diet plant based diet in cardiovascular risk group state of florida united states of america adult feces homo sapiens )2022-11-25v3No1 / 16
945amnondominant homo sapiens, oral cavity, oral wash, adult, united states of america2022-11-29v4No1 / 16
492amnondominant skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 16
492amnondominant skin, adult, rana catesbeiana, lithobates catesbeianus, bullfrog, brazil, frog2019-02-27v4No1 / 16
493amnondominant homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 16
519amnondominant homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 16
526amnonhigh freq. in bile of healthy controls (dominant control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 16
32amnondominant homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens russia adult 2020-01-05v3No1 / 17
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 17
606amnondominant penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 17
630amnondominant madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 17
636amnoncommon oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 17
639amnondominant nature reserve, adult, wild, australia, feces, european rabbit, oryctolagus cuniculus2020-08-21v3No1 / 17
640amnondominant saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 17
663amnondominant low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 17
724amnoncommon non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 17
725amnondominant periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 17
743amnondominant feces, farm, captive, italy, adult, european hare, lepus europaeus2021-02-21v3No1 / 17
277amnondominant homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 17
278amnondominant homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 17
289amnondominant homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 17
290amnondominant homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 17
775amnondominant jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 17
353amnonhigh freq. in captive Triturus cristatus newts skin (dominant newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 17
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 17
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 17
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to obsolete_juvenile stage infant in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 17
849amnondominant fourth decade human stage, china, multiple sclerosis, multiple sclerosis, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 17
852amnondominant non-smoker, canada, adult, saliva, homo sapiens2021-12-17v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
867amnondominant gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 17
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 17
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 17
941amnondominant homo sapiens, feces, thailand, adult, nan province, village, rural community2022-11-25v4No1 / 17
492amnondominant brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 17
526amnon high in control compared to cholelithiasis in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 17
532amnondominant homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 18
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 18
623amnoncommon skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 18
627amnondominant feces, pregnancy, adult, female, china2020-05-16v3No1 / 18
630amnon high in low physical activity sedentary compared to high physical activity in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 18
636amnon high in tracheal aspirate endotracheal aspirate trachea compared to oropharynx oropharyngeal swab in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 18
650amnondominant asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 18
663amnondominant poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 18
663amnondominant poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 18
663amnondominant mouth, oral wash, poland, adult, homo sapiens2020-09-22v4No1 / 18
715amnondominant oesophageal brush, esophagus, australia, adult, homo sapiens2028-05-22v4No1 / 18
716amnondominant chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 18
717amnon high in male organism male compared to female organism female in inner thigh upper leg skin adult province of ontario canada epidermis skin homo sapiens 2028-05-22v3No1 / 18
724amnoncommon pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 18
293amnondominant homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v4No1 / 18
294amnondominant homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
774amnondominant control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 18
339amnondominant homo sapiens, feces, adult, india2018-05-24v4No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant ketogenic diet, obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
806amnondominant mouth mucosa, buccal mucosa, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 18
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
831amnondominant israel, adult, feces, homo sapiens, control2021-09-11v3No1 / 18
833amnondominant homo sapiens, feces, age 60-65 years, slovak republic, adult, normal exercise2021-09-11v1No1 / 18
841amnondominant human adult stage, state of texas, adult, saliva, united states of america, homo sapiens2021-11-08v4No1 / 18
874amnondominant human late adulthood stage, buffalo, postmenopausal, subgingival dental plaque, subgingival plaque, state of new york, female, united states of america, homo sapiens2022-03-04v3No1 / 18
875amnondominant human late adulthood stage, saen thong subdistrict, village, rural community, thailand, adult, homo sapiens, feces2022-03-04v3No1 / 18
880amnondominant human adult stage, kingdom of denmark, adult, homo sapiens, feces2022-03-12v3No1 / 18
892amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-04-07v4No1 / 18
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 18
430amnondominant 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v4No1 / 18
922amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-07-25v4No1 / 18
944amnondominant large intestine, biopsy, adult, ireland, control2022-11-26v3No1 / 18
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 18
492amnondominant brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 18
806amnondominant homo sapiens, adult, pair of nares, external naris, state of new york, united states of america2021-06-19v3No1 / 18
806amnondominant hard palate, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 18
519amnondominant homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 18
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 19
66amnondominant homo sapiens, saliva, amsterdam, adult2017-02-18v4No1 / 19
567amnondominant belgium, adult, homo sapiens, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 19
574amnondominant feces, homo sapiens, russia, adult2020-01-05v3No1 / 19
118amnonhigh freq. in captive reared butterfly (dominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, adult, body proper, whole body, forest ecosystem)2017-04-11v4No1 / 19
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 19
121amnondominant homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
678amnondominant tooth disease, black dental staining, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 19
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 19
707amnon high in control compared to systemic lupus erythematosus in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 19
723amnondominant adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
725amnondominant control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 19
732amnondominant municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 19
736amnondominant tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 19
276amnondominant feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 19
757amnondominant feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 19
292amnondominant homo sapiens, adult, feces, control, china2018-02-05v4No1 / 19
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
774amnondominant tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 19
330amnon high in infant age 1 year compared to fourth decade human stage adult in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
796amnondominant control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 19
806amnondominant palatine tonsil, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 19
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis, gingival erosive oral lichen planus, oral lichen planus2021-09-11v3No1 / 19
401amnondominant homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 19
404amnondominant homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 19
867amnondominant gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 19
871amnon high in iga positive fraction compared to iga negative fraction in before antibiotics human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 19
438amnondominant 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 19
455amnondominant homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
943amnondominant homo sapiens, feces, adult, united states of america, state of florida, cardiovascular risk group2022-11-25v3No1 / 19
944amnondominant ireland, adult, biopsy, large intestine, crohn's disease, crohn's disease2022-11-26v3No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to chepang forager in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 19
477amnondominant homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
803amnondominant human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 19
516amnondominant homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 19
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 20
591amnon high in parkinson's disease compared to control in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v4No1 / 20
594amnondominant adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in homo sapiens feces china adult 2020-03-30v4No1 / 20
629amnondominant amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 20
629amnondominant msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 20
639amnondominant lepus europaeus, european brown hare, nature reserve, adult, wild, australia, feces2020-08-21v3No1 / 20
650amnondominant state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 20
663amnondominant obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 20
677amnondominant palatine tonsil, south korea, adult, tonsil, homo sapiens2028-03-01v3No1 / 20
703amnondominant saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 20
720amnondominant autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 20
734amnondominant vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 20
277amnoncommon homo sapiens, belgium, adult, nasopharynx2018-01-23v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 20
292amnondominant homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
328amnonlower in feces compared to intestinal mucosa in mice ( high in mucosa intestine digestive tract compared to feces in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 20
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis2021-09-11v3No1 / 20
394amnondominant homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
851amnondominant milan, italy, adult, homo sapiens, feces2021-12-16v3No1 / 20
866amnon high in control compared to ulcerative colitis ulcerative colitis in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 20
869amnondominant human adult stage, high bmi, kingdom of the netherlands, adult, obesity, homo sapiens, feces2022-02-18v3No1 / 20
409amnondominant homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 20
941amnon high in pig farm compared to chicken farm in farm rural community village nan province adult thailand feces homo sapiens 2022-11-25v4No1 / 20
944amnondominant ulcerative colitis, ulcerative colitis, large intestine, biopsy, adult, ireland2022-11-26v3No1 / 20
484amnondominant feces, adult, 17-29-years-old human, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 20
492amnondominant skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 20
803amnondominant human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 20
805amnon high in nicotine dependence cigarette smoking smoker compared to non-smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v3No1 / 20
529amnonhigh freq. in patients that underwent low anterior resection (dominant homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 21
567amnoncommon belgium, adult, homo sapiens, anterior naris, pair of nares2019-12-05v4No1 / 21
575amnonhigh freq. in professional martial arts athletes (dominant young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v3No1 / 21
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth czech republic adult 2020-01-09v3No1 / 21
576amnondominant homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 21
581amnondominant in red swamp crayfish grown in flooded rice field (dominant procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v3No1 / 21
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 21
593amnondominant homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
597amnondominant homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 21
663amnon high in low bmi compared to obese body mass index status high bmi obesity in adult switzerland poland feces homo sapiens 2020-09-22v4No1 / 21
703amnondominant dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 21
716amnondominant control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 21
717amnondominant inner nostril, pair of nares, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 21
720amnondominant control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 21
726amnondominant tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 21
728amnondominant clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 21
734amnondominant omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 21
278amnondominant homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 21
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
773amnondominant iga glomerulonephritis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 21
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 21
320amnondominant homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
330amnondominant fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v4No1 / 21
794amnondominant antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 21
814amnondominant high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 21
835amnondominant feces, homo sapiens, japan, adult2021-09-11v3No1 / 21
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
867amnon high in third trimester compared to second trimester in gestational diabetes gestational diabetes human adult stage turin township italy adult pregnancy female homo sapiens feces 2022-02-09v3No1 / 21
870amnondominant fourth decade human stage, third decade human stage, auckland city, new zealand, adult, homo sapiens, feces2022-02-18v3No1 / 21
409amnondominant homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
877amnondominant human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v4No1 / 21
918amnon high in third trimester pregnancy compared to non-pregnant in human early adulthood stage japan adult saliva female homo sapiens 2022-07-15v3No1 / 21
928amnondominant human early adulthood stage, kuwait, adult, homo sapiens, feces2022-08-16v3No1 / 21
806amnondominant saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 21
576amnon high in mouth mucosa compared to tongue in homo sapiens czech republic adult 2020-01-09v3No1 / 22
593amnondominant homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
629amnondominant female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 22
650amnondominant african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 22
670amnon high in adult adult organism compared to larval stage in dolphin parasite croatia opatija anisakis pegreffii 2020-09-26v4No1 / 22
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 22
707amnondominant fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 22
715amnon high in third decade human stage fourth decade human stage compared to 65-79 year-old human stage in oesophageal brush esophagus australia adult homo sapiens 2028-05-22v4No1 / 22
720amnon high in control compared to autoimmune hepatitis in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, state of michigan, adult, oropharynx)2021-01-09v4No1 / 22
736amnon high in 2-year-old human stage 1-year-old human stage age 1-3 years child compared to female adult in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 22
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 22
284amnondominant homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 22
293amnondominant homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
779amnondominant control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
806amnoncommon gingiva, keratinized gingiva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 22
819amnoncommon adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v1No1 / 22
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 22
851amnondominant sigmoid colon brushing, milan, italy, adult, sigmoid colon, colonic mucosa, homo sapiens2021-12-16v3No1 / 22
404amnonpositively correlated with fiber intake ( high in plant fiber cell high filber compared to low fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 22
918amnondominant human early adulthood stage, third trimester, japan, adult, saliva, pregnancy, female, homo sapiens2022-07-15v3No1 / 22
918amnondominant human early adulthood stage, non-pregnant, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 22
455amnondominant homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
944amnon high in crohn's disease crohn's disease compared to ulcerative colitis ulcerative colitis in large intestine biopsy adult ireland 2022-11-26v3No1 / 22
467amnondominant homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
502amnondominant homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
542amnon high in child age 1-7 years compared to adult age 12-23 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 23
566amnon high in insomnia compared to control in homo sapiens feces china adult 2019-11-24v4No1 / 23
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult tongue 2020-01-09v3No1 / 23
73amnondominant homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
601amnondominant homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 23
623amnondominant skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 23
634amnondominant high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 23
636amnondominant hospital, commonwealth of pennsylvania, united states of america, trachea, tracheal aspirate, endotracheal aspirate, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
636amnondominant oropharynx, oropharyngeal swab, hospital, commonwealth of pennsylvania, united states of america, respiratory failure, acute respiratory failure, adult, homo sapiens2020-08-08v4No1 / 23
694amnondominant china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 23
712amnondominant kazan, adult, russia, saliva, homo sapiens2028-05-21v3No1 / 23
717amnoncommon bellybutton, umbilicus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 23
717amnon high in female organism female compared to male organism male in inner thigh upper leg skin adult province of ontario canada epidermis skin homo sapiens 2028-05-22v3No1 / 23
734amnondominant coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 23
303amnondominant homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
773amnondominant recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 23
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 23
312amnondominant feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
346amnonhigher in pupae compared to larva and adult in fruit fly ( high in pupa compared to adult larva larval stage in italy body proper whole body mediterranean fruit fly ceratitis capitata )2018-06-11v4No1 / 23
832amnondominant homo sapiens, feces, adult, ibadan, nigeria2021-09-11v4No1 / 23
841amnondominant human adult stage, state of texas, adult, united states of america, homo sapiens, feces2021-11-08v4No1 / 23
394amnondominant homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
843amnondominant non-celiac gluten sensitivity, human adult stage, italy, adult, feces2021-11-17v3No1 / 23
856amnondominant human adult stage, china, intestinal mucosa, biopsy, adult, rectum, control, homo sapiens2022-01-09v3No1 / 23
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, lithobates catesbeianus, frog2019-02-27v4No1 / 23
532amnoncommon homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 24
554amnondominant homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 24
566amnondominant feces, china, homo sapiens, adult2019-11-24v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 24
597amnondominant homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 24
601amnon high in type 2 diabetes mellitus compared to control in homo sapiens feces china adult 2020-03-30v4No1 / 24
643amnondominant adult, south korea, feces, homo sapiens2020-08-30v4No1 / 24
670amnoncommon dolphin parasite, croatia, opatija, anisakis pegreffii, adult organism, adult2020-09-26v4No1 / 24
683amnondominant state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 24
685amnon high in morning compared to evening in oral cavity mouth mucosa australia adult homo sapiens 2028-03-08v3No1 / 24
717amnondominant bellybutton, umbilicus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 24
721amnonhigher in high protein weight loss diet compared to control diet ( high in high protein diet weight loss diet weight loss compared to control diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v4No1 / 24
723amnondominant municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 24
745amnondominant adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 24
745amnon high in human late adulthood stage compared to 25-44 year-old human stage in adult midwest region united states of america feces homo sapiens 2021-02-25v3No1 / 24
753amnondominant china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v4No1 / 24
322amnondominant frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 24
338amnon high in adult compared to tadpole amphibian larval stage larval stage in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 24
354amnon high in induced sputum sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 24
849amnondominant fourth decade human stage, china, zhejiang province, adult, control, homo sapiens, feces2021-12-14v3No1 / 24
947amnondominant feces, homo sapiens, adult, united states of america, commonwealth of pennsylvania2022-12-02v4No1 / 24
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
471amnondominant digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 25
640amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 25
663amnoncommon pair of nares, nasal cavity, poland, adult, homo sapiens2020-09-22v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v4No1 / 25
707amnondominant fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 25
717amnoncommon armpit, axilla, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 25
721amnondominant obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v4No1 / 25
723amnoncommon adult, female, breast milk material, breast milk, homo sapiens, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
290amnondominant homo sapiens, feces, adult, city, china2018-02-01v4No1 / 25
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 25
796amnondominant graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 25
856amnondominant human adult stage, china, ulcerative colitis, intestinal mucosa, biopsy, adult, ulcerative colitis, rectum, homo sapiens2022-01-09v3No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 26
650amnonpositively correlated with BMI ( high in high bmi body mass index compared to low bmi in feces adult homo sapiens united states of america state of new york )2020-09-09v4No1 / 26
689amnondominant non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 26
354amnoncommon homo sapiens, united states of america, adult, pair of nares, nasal cavity, nasal brush2018-07-30v4No1 / 26
869amnon high in after roux-en-y gastric bypass surgery compared to before roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 26
438amnondominant fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 26
941amnon high in chicken farm compared to pig farm in homo sapiens feces thailand adult nan province village rural community farm 2022-11-25v4No1 / 26
802amnondominant feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 26
529amnondominant homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 27
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v4No1 / 27
685amnoncommon oral cavity, mouth mucosa, australia, adult, homo sapiens2028-03-08v3No1 / 27
717amnoncommon inner nostril, pair of nares, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 27
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
404amnon high in hard stool compared to normal stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 27
943amnonlower before 6 day plant based diet ( high in vegetarian diet plant based diet compared to normal diet in homo sapiens feces adult united states of america state of florida cardiovascular risk group )2022-11-25v3No1 / 27
944amnoncommon crohn's disease, crohn's disease, large intestine, biopsy, adult, ireland2022-11-26v3No1 / 27
651amnon high in female compared to male in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 28
779amnon high in control compared to ulcerative colitis in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 28
806amnon high in gingiva keratinized gingiva compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 28
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 28
841amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america state of texas saliva homo sapiens 2021-11-08v4No1 / 28
693amnon high in polycystic ovary syndrome compared to control in graz city district austria adult feces homo sapiens female 2028-03-16v1No1 / 29
711amnoncommon adult, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 29
724amnon high in non-pregnant compared to pregnancy trimester 2 pregnancy in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 29
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
806amnoncommon dorsum of tongue, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
591amnon high in control compared to parkinson's disease in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v4No1 / 30
774amnon high in tonsillitis compared to control in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
869amnon high in iga negative fraction compared to iga positive fraction in high bmi obesity human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 30
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage before antibiotics amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 30
492amnoncommon brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 30
651amnon high in male compared to female in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 31
652amnon high in control compared to rheumatoid arthritis in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 31
681amnondominant seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 31
796amnon high in graves' disease compared to control in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
492amnoncommon brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 31
806amnoncommon hard palate, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 31
578amnon high in control compared to hiv infection in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v3No1 / 32
717amnoncommon upper leg skin, inner thigh, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 32
717amnoncommon external nose, outer nose, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 32
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in adult midwest region united states of america feces homo sapiens 2021-02-25v3No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
354amnon high in sputum induced sputum compared to bronchial brush bronchus bronchial epithelium in homo sapiens united states of america adult 2018-07-30v4No1 / 32
806amnon high in pair of nares external naris compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 32
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 32
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
646amnoncommon adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 33
354amnon high in saliva oral wash compared to bronchial epithelium bronchial brush bronchus in homo sapiens united states of america adult 2018-07-30v4No1 / 33
856amnoncommon ulcerative colitis, ulcerative colitis, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 33
629amnon high in control compared to acquired immunodeficiency syndrome hiv infection in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 34
492amnoncommon brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 34
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult mouth mucosa buccal mucosa 2020-01-09v3No1 / 35
871amnon high in iga positive fraction compared to iga negative fraction in vancomycin antibiotic human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 35
180amnoncommon dermanyssus gallinae, red poulty mite, czech republic, poulty farm, adult2017-08-14v4No1 / 36
749amnoncommon third decade human stage, seoul, female, south korea, adult, skin of cheek, skin, homo sapiens2021-03-10v4No1 / 36
749amnoncommon third decade human stage, skin of forehead, seoul, female, south korea, adult, skin, homo sapiens2021-03-10v4No1 / 36
944amnon high in ulcerative colitis ulcerative colitis compared to crohn's disease crohn's disease in ireland adult biopsy large intestine 2022-11-26v3No1 / 36
651amnon high in parkinson's disease compared to control in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 37
681amnoncommon seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 37
277amnoncommon homo sapiens, belgium, adult, nasal cavity, pair of nares2018-01-23v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, austria, adult, graz city district2018-06-11v4No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 37
873amnon high in hunter gatherer hadza compared to burunge sandawe maasai in tanzania rural community africa human adult stage commonwealth of pennsylvania adult homo sapiens feces 2022-03-03v1No1 / 37
567amnon high in nasopharynx compared to anterior naris pair of nares in homo sapiens adult belgium 2019-12-05v4No1 / 38
723amnonhigher in females that gave birth during last 6 months ( high in birth during last 6 months compared to birth in over 6 months in municipality of yogyakarta vagina adult female indonesia homo sapiens )2021-01-02v3No1 / 38
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in homo sapiens feces adult )2018-04-19v4No1 / 38
866amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 38
944amnoncommon ulcerative colitis, ulcerative colitis, large intestine, biopsy, adult, ireland2022-11-26v3No1 / 38
944amnoncommon ireland, adult, biopsy, large intestine, ulcerative colitis, ulcerative colitis2022-11-26v3No1 / 38
806amnoncommon homo sapiens, adult, pair of nares, external naris, state of new york, united states of america2021-06-19v3No1 / 38
677amnoncommon palatine tonsil, south korea, adult, tonsil, homo sapiens2028-03-01v3No1 / 39
725amnon high in periodontitis acute pericementitis compared to control in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in chronic periodontitis periodontitis municipality of shanghai adult china subgingival plaque subgingival dental plaque homo sapiens 2021-09-11v3No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
806amnoncommon mouth mucosa, buccal mucosa, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 40
378amnon high in deep pocket depth depth > 3mm compared to shallow pocket depth depth < 3mm in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 40
835amnoncommon adult, japan, homo sapiens, feces2021-09-11v3No1 / 40
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 40
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in buccal mucosa mouth mucosa compared to oropharynx in adult state of michigan united states of america homo sapiens )2021-01-09v4No1 / 41
806amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 41
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 42
725amnon high in periodontitis acute pericementitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 43
831amnoncommon pancreatic cancer, homo sapiens, feces, adult, israel2021-09-11v3No1 / 43
606amnoncommon penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v3No1 / 44
652amnon high in rheumatoid arthritis compared to control in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 44
663amnon high in obese body mass index status high bmi obesity compared to low bmi in adult switzerland poland feces homo sapiens 2020-09-22v4No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v3No1 / 44
717amnoncommon dorsum, back, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 44
725amnon high in periodontitis chronic periodontitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 44
757amnon high in male compared to female in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 44
871amnonlower before antibiotic treatment compared to after treatment ( high in vancomycin antibiotic compared to before antibiotics in human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces )2022-02-19v3No1 / 44
773amnoncommon recurrent tonsillitis, tonsillitis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 45
869amnon high in iga positive fraction compared to iga negative fraction in human adult stage high bmi kingdom of the netherlands adult obesity homo sapiens feces 2022-02-18v3No1 / 45
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
873amnon high in burunge sandawe maasai compared to hunter gatherer hadza in human adult stage rural community commonwealth of pennsylvania africa tanzania adult homo sapiens feces 2022-03-03v1No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 47
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 47
640amnon high in dentition supragingival dental plaque supragingival plaque compared to saliva in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 47
717amnoncommon upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 47
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 47
546amnoncommon homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 48
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
806amnoncommon palatine tonsil, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 48
806amnon high in oral wash oral cavity compared to hard palate in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 48
856amnoncommon control, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 48
869amnoncommon human adult stage, high bmi, obesity, adult, kingdom of the netherlands, feces, homo sapiens2022-02-18v3No1 / 48
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 49
576amnon high in tongue compared to mouth mucosa in homo sapiens czech republic adult 2020-01-09v3No1 / 50
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
339amnon high in under-1-year-old human stage infant compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
834amnoncommon adult, japan, feces, homo sapiens2021-09-11v1No1 / 50
849amnoncommon zhejiang province, fourth decade human stage, adult, multiple sclerosis, multiple sclerosis, china, homo sapiens, feces2021-12-14v3No1 / 50
725amnoncommon control, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 51
796amnoncommon control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 51
598amnonhigher in mouthwash of students compared to teachers ( high in 14-year-old human stage 13-year-old human stage child age 13-15 years compared to adult in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 52
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 52
651amnon high in control compared to parkinson's disease in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 52
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 52
796amnoncommon graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
867amnoncommon gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 52
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 54
773amnoncommon iga glomerulonephritis, homo sapiens, adult, japan, tonsillectomy, palatine tonsil2021-04-23v4No1 / 54
944amnon high in crohn's disease crohn's disease compared to control in large intestine biopsy adult ireland 2022-11-26v3No1 / 54
578amnon high in sweden compared to kingdom of spain in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 55
653amnon high in saliva compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in metronidazole vancomycin neomycin antibiotic compared to control in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 55
707amnoncommon fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 55
745amnoncommon adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 55
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
774amnon high in control compared to tonsillitis in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 55
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 55
819amnon high in low atmospheric pollution dalian city prefecture compared to high atmospheric pollution baoding city prefecture in skin of cheek age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 55
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 56
650amnoncommon state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 56
717amnoncommon chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 56
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
775amnon high in lichen planus compared to control in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 56
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
928amnoncommon human early adulthood stage, adult, kuwait, feces, homo sapiens2022-08-16v3No1 / 56
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 56
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v1No1 / 57
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 57
717amnoncommon palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 57
753amnon high in canis lupus wolf zoological garden captive compared to farm dog breeding center canis lupus familiaris dog in china adult feces 2021-03-12v4No1 / 57
806amnon high in oral wash oral cavity compared to buccal mucosa mouth mucosa in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 57
944amnoncommon control, ireland, adult, biopsy, large intestine2022-11-26v3No1 / 57
644amnon high in male compared to female in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 58
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 58
717amnoncommon plantar part of pes, bottom of foot, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 58
806amnon high in oral wash oral cavity compared to supragingival plaque supragingival dental plaque dentition in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 58
866amnon high in iga negative fraction compared to iga positive fraction in human adult stage adult homo sapiens united states of america feces 2022-02-08v4No1 / 58
877amnon high in high breath methane content compared to low breath methane content in human early adulthood stage austria adult homo sapiens feces 2022-03-08v4No1 / 58
338amnon high in amphibian larval stage larval stage tadpole compared to adult in andrias japonicus japanese giant salamander skin japan 2018-05-21v4No1 / 59
843amnoncommon non-celiac gluten sensitivity, italy, feces, human adult stage, adult2021-11-17v3No1 / 59
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 60
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
944amnon high in ulcerative colitis ulcerative colitis compared to control in large intestine biopsy adult ireland 2022-11-26v3No1 / 60
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
819amnoncommon dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 61
849amnoncommon control, fourth decade human stage, china, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 61
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
851amnoncommon feces, milan, italy, adult, homo sapiens2021-12-16v3No1 / 62
943amnoncommon cardiovascular risk group, state of florida, united states of america, adult, feces, homo sapiens2022-11-25v3No1 / 62
575amnoncommon in professional martial arts athletes (common young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v3No1 / 63
630amnon high in female compared to male in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
630amnon high in male compared to female in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
726amnoncommon tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 63
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
945amnon high in 65-79 year-old human stage compared to 25-44 year-old human stage in homo sapiens oral cavity oral wash adult united states of america 2022-11-29v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
930amnoncommon non-smoker, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 64
640amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 65
354amnoncommon homo sapiens, united states of america, adult, bronchial brush, bronchus, bronchial epithelium2018-07-30v4No1 / 65
875amnoncommon saen thong subdistrict, village, rural community, thailand, adult, human late adulthood stage, feces, homo sapiens2022-03-04v3No1 / 65
576amnoncommon homo sapiens, czech republic, adult, lip, mouth mucosa, lower labial mucosa2020-01-09v3No1 / 66
650amnoncommon asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 66
734amnoncommon coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 66
852amnoncommon non-smoker, canada, adult, saliva, homo sapiens2021-12-17v4No1 / 66
576amnoncommon homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 67
114amnon high in adult compared to tadpole in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 67
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
874amnoncommon buffalo, state of new york, united states of america, postmenopausal, human late adulthood stage, female, subgingival plaque, subgingival dental plaque, homo sapiens2022-03-04v3No1 / 67
941amnoncommon chicken farm, rural community, village, nan province, adult, farm, thailand, feces, homo sapiens2022-11-25v4No1 / 67
941amnoncommon rural community, village, nan province, adult, thailand, feces, homo sapiens2022-11-25v4No1 / 67
945amnoncommon united states of america, adult, oral wash, oral cavity, homo sapiens2022-11-29v4No1 / 67
805amnon high in non-smoker compared to cigarette smoking nicotine dependence smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v3No1 / 67
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 68
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 69
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 69
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
846amnoncommon commonwealth of massachusetts, united states of america, human adult stage, adult, stimulated saliva, saliva, homo sapiens2021-11-20v3No1 / 69
941amnoncommon rural community, village, nan province, adult, pig farm, farm, thailand, feces, homo sapiens2022-11-25v4No1 / 69
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
819amnon high in scalp compared to skin of cheek in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 70
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
803amnoncommon human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 70
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
576amnoncommon homo sapiens, czech republic, adult, mouth mucosa, buccal mucosa2020-01-09v3No1 / 71
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 71
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 71
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
851amnoncommon sigmoid colon brushing, colonic mucosa, sigmoid colon, milan, italy, adult, homo sapiens2021-12-16v3No1 / 71
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
870amnoncommon auckland city, fourth decade human stage, third decade human stage, adult, new zealand, homo sapiens, feces2022-02-18v3No1 / 71
114amnoncommon rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 72
653amnon high in tongue dermal layer of tongue compared to saliva in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 72
663amnon high in poland compared to switzerland in adult feces homo sapiens 2020-09-22v4No1 / 72
716amnoncommon control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
873amnon high in tanzania botswana rural community compared to urban community commonwealth of pennsylvania united states of america in human adult stage adult homo sapiens feces 2022-03-03v1No1 / 73
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in chepang forager compared to tharu agrarian in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 73
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
634amnoncommon high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 74
774amnoncommon tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 74
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v4No1 / 74
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 75
299amnon high in control compared to mouth neoplasm cancer in saliva adult homo sapiens china 2018-02-27v4No1 / 75
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
663amnon high in switzerland compared to poland in adult feces homo sapiens 2020-09-22v4No1 / 76
322amnoncommon frog, osteopilus septentrionalis, united states of america, state of florida, research facility, adult, digestive system2018-04-23v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, 17-29-years-old human, homo sapiens2019-02-13v4No1 / 76
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common oropharynx, adult, state of michigan, united states of america, homo sapiens)2021-01-09v4No1 / 77
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
819amnoncommon skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 77
930amnoncommon cigarette smoking, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 77
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
736amnon high in adult female compared to 2-year-old human stage 1-year-old human stage age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
880amnoncommon kingdom of denmark, human adult stage, adult, feces, homo sapiens2022-03-12v3No1 / 79
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
483amnoncommon hawaii, pearl harbor, research facility, hydroides elegans, tubeworm, united states of america, adult2019-02-13v4No1 / 80
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 81
678amnon high in control compared to tooth disease black dental staining in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v3No1 / 81
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
873amnoncommon botswana, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v1No1 / 81
650amnon high in male compared to female in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 82
707amnoncommon fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
716amnoncommon chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
721amnon high in high protein diet weight loss weight loss diet compared to high fiber fiber diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
663amnoncommon lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 84
353amnoncommon in captive Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, research facility, united kingdom)2018-07-30v4No1 / 84
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
629amnon high in heterosexual msw compared to homosexual msm in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 85
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 85
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
731amnoncommon buccal mucosa, mouth mucosa, adult, state of michigan, united states of america, homo sapiens2021-01-09v4No1 / 85
867amnoncommon gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 85
802amnoncommon cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v4No1 / 85
277amnon high in pair of nares nasal cavity compared to nasopharynx in homo sapiens belgium adult 2018-01-23v4No1 / 86
353amnoncommon in captive Lissotriton vulgaris newts skin (common newt, adult, skin, cambridgeshire, research facility, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
841amnoncommon feces, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
947amnoncommon commonwealth of pennsylvania, united states of america, adult, homo sapiens, feces2022-12-02v4No1 / 86
806amnoncommon oral cavity, mouth, oral wash, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 86
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to 2-5 year-old child stage child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
806amnon high in oral wash oral cavity compared to palatine tonsil in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 87
892amnoncommon saliva, united states of america, human adult stage, adult, homo sapiens2022-04-07v4No1 / 87
430amnoncommon 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v4No1 / 87
711amnon high in age 8-12 years child compared to adult in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v4No1 / 88
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
884amnoncommon state of california, united states of america, human adult stage, adult, feces, homo sapiens2022-03-24v4No1 / 88
922amnoncommon human adult stage, united states of america, saliva, adult, homo sapiens2022-07-25v4No1 / 88
805amnoncommon sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v3No1 / 88
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
703amnoncommon dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 89
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
803amnoncommon human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
114amnon high in tadpole compared to adult in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 90
137amnon high in juvenile stage compared to adult in gopherus polyphemus gopher tortoise feces united states of america state of florida 2017-04-17v4No1 / 91
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
715amnoncommon oesophageal brush, esophagus, australia, adult, homo sapiens2028-05-22v4No1 / 92
725amnoncommon chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 92
774amnoncommon control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 92
866amnon high in control compared to crohn's disease crohn's disease in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 92
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
836amnoncommon oral lichen planus, gingival erosive oral lichen planus, chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
918amnoncommon non-pregnant, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 93
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to digestive tract intestine mucosa in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 94
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
471amnoncommon digestive system, frog, osteopilus septentrionalis, research facility, united states of america, adult, state of florida2019-01-14v4No1 / 94
723amnonhigher in children age 2-4 years compared to mothers ( high in 2-5 year-old child stage child compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
678amnoncommon tooth disease, black dental staining, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 96
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
922amnon high in child 4-year-old human stage compared to human adult stage adult in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
753amnoncommon zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v4No1 / 98
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
554amnoncommon homo sapiens, egypt, adult, primary endodontic infection, root canal, root canal infection, dentition2019-09-10v3No1 / 102
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
877amnoncommon human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v4No1 / 102
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
693amnoncommon graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 104
918amnoncommon third trimester, pregnancy, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 104
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 104
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
663amnoncommon mouth, oral wash, poland, adult, homo sapiens2020-09-22v4No1 / 106
712amnoncommon kazan, adult, russia, saliva, homo sapiens2028-05-21v3No1 / 106
806amnoncommon saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 106
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
802amnoncommon feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 109
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
438amnoncommon 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
794amnon high in control compared to antiretroviral therapy human immunodeficiency virus infectious disease hiv infection in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 112
873amnoncommon urban community, commonwealth of pennsylvania, united states of america, human adult stage, adult, homo sapiens, feces2022-03-03v1No1 / 112
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 113
567amnon high in control compared to chronic rhinosinusitis sinusitis in homo sapiens adult belgium nasopharynx 2019-12-05v4No1 / 114
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
703amnoncommon saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 115
438amnoncommon fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 115
492amnoncommon skin, adult, germany, bufo bufo, toad, common toad2019-02-27v4No1 / 115
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 116
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
743amnoncommon feces, farm, captive, italy, adult, european hare, lepus europaeus2021-02-21v3No1 / 119
113amnon high in adult compared to larval stage in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 120
753amnoncommon china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 121
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
581amnoncommon in red swamp crayfish grown in flooded rice field (common procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v3No1 / 122
636amnon high in oropharynx oropharyngeal swab compared to trachea endotracheal aspirate tracheal aspirate in hospital commonwealth of pennsylvania united states of america respiratory failure acute respiratory failure adult homo sapiens 2020-08-08v4No1 / 122
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
873amnoncommon tanzania, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v1No1 / 125
806amnon high in dorsum of tongue compared to oral wash oral cavity in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 126
753amnon high in farm dog breeding center canis lupus familiaris dog compared to captive zoological garden canis lupus wolf in china adult feces 2021-03-12v4No1 / 127
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
841amnoncommon saliva, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 129
330amnoncommon fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v4No1 / 130
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
851amnon high in feces compared to colonic mucosa sigmoid colon brushing sigmoid colon in adult milan italy homo sapiens 2021-12-16v3No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
578amnon high in kingdom of spain compared to sweden in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 133
711amnon high in adult compared to age 8-12 years child in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
775amnoncommon jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 133
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 134
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 135
551amnon high in fresh clover diet compared to clover hay diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 136
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
725amnoncommon periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
945amnon high in 25-44 year-old human stage compared to 65-79 year-old human stage in united states of america adult oral wash oral cavity homo sapiens 2022-11-29v4No1 / 142
330amnon high in fourth decade human stage adult compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 147
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 154
833amnoncommon normal exercise, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v1No1 / 154
833amnoncommon homo sapiens, feces, age 60-65 years, slovak republic, adult, athlete, high exercise2021-09-11v1No1 / 154
836amnoncommon chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
725amnoncommon control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 156
653amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 157
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
678amnoncommon control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
322amnon high in adult compared to tadpole in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 163
652amnoncommon sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 166
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
594amnon high in ngoantet rural community compared to city yaounde in homo sapiens feces cameroon adult 2020-03-12v4No1 / 172
851amnon high in colonic mucosa sigmoid colon brushing sigmoid colon compared to feces in milan italy adult homo sapiens 2021-12-16v3No1 / 174
806amnon high in oral wash oral cavity compared to pair of nares external naris in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 178
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
639amnoncommon lepus europaeus, european brown hare, nature reserve, adult, wild, australia, feces2020-08-21v3No1 / 182
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 185
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens adult belgium anterior naris pair of nares 2019-12-05v4No1 / 191
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
944amnon high in control compared to ulcerative colitis ulcerative colitis in ireland adult biopsy large intestine 2022-11-26v3No1 / 199
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 205
725amnoncommon chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 206
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in msw heterosexual compared to homosexual gay msm in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 220
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
873amnon high in botswana compared to tanzania in africa rural community human adult stage adult homo sapiens feces 2022-03-03v1No1 / 226
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
873amnon high in urban community commonwealth of pennsylvania united states of america compared to tanzania botswana africa rural community in human adult stage adult feces homo sapiens 2022-03-03v1No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to 14-year-old human stage 13-year-old human stage child age 13-15 years in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 232
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 232
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to vancomycin antibiotic in human adult stage amsterdam kingdom of the netherlands feces male homo sapiens adult )2022-02-19v3No1 / 232
639amnon high in european brown hare lepus europaeus compared to oryctolagus cuniculus european rabbit in nature reserve adult wild australia feces 2020-08-21v3No1 / 235
492amnoncommon skin, adult, rana catesbeiana, bullfrog, lithobates catesbeianus, frog, japan2019-02-27v4No1 / 236
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in young adult stage soldiers compared to tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage adult age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
725amnoncommon acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 240
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in skin of cheek age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 242
945amnon high in smoker cigarette smoking compared to non-smoker in homo sapiens oral cavity oral wash adult united states of america 2022-11-29v4No1 / 242
944amnon high in control compared to crohn's disease crohn's disease in ireland adult biopsy large intestine 2022-11-26v3No1 / 256
945amnon high in non-smoker compared to cigarette smoking smoker in united states of america adult oral wash oral cavity homo sapiens 2022-11-29v4No1 / 256
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
892amnon high in adult human adult stage compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v4No1 / 275
137amnon high in adult compared to juvenile stage in gopherus polyphemus gopher tortoise feces united states of america state of florida 2017-04-17v4No1 / 277
438amnon high in 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage adult in homo sapiens feces china 2018-12-30v4No1 / 279
639amnoncommon nature reserve, adult, wild, australia, feces, european rabbit, oryctolagus cuniculus2020-08-21v3No1 / 280
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 281
806amnon high in oral wash oral cavity compared to keratinized gingiva gingiva in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 288
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
551amnon high in diet clover hay diet compared to fresh clover diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 291
653amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 291
922amnon high in human adult stage adult compared to 4-year-old human stage child in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 291
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 306
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
322amnon high in tadpole compared to adult in frog osteopilus septentrionalis united states of america state of florida research facility digestive system 2018-04-23v4No1 / 320
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
471amnon high in adult compared to tadpole in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 328
873amnon high in tanzania compared to botswana in human adult stage rural community africa adult homo sapiens feces 2022-03-03v1No1 / 333
532amnon high in control compared to short bowel syndrome in homo sapiens feces czech republic adult 2019-07-21v1No1 / 334
542amnon high in adult age 12-23 years compared to child age 1-7 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 337
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in adult age 25-45 years female china scalp skin homo sapiens 2021-07-12v1No1 / 337
671amnon high in state of california compared to state of oregon in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 355
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
353amnoncommon in wild Lissotriton vulgaris newts skin (common newt, adult, skin, lissotriton vulgaris, cambridgeshire, united kingdom)2018-07-30v4No1 / 418
353amnoncommon in wild Triturus cristatus newts skin (common newt, adult, skin, cambridgeshire, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
339amnon high in adult compared to under-1-year-old human stage infant in homo sapiens feces india 2018-05-24v4No1 / 457
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
650amnon high in european caucasian compared to asian in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 475
639amnon high in oryctolagus cuniculus european rabbit compared to lepus europaeus european brown hare in nature reserve adult wild australia feces 2020-08-21v3No1 / 480
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to msw heterosexual in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 519
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
725amnon high in subgingival dental plaque subgingival plaque compared to buccal mucosa mouth mucosa in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 544
471amnon high in tadpole compared to adult in digestive system frog osteopilus septentrionalis research facility united states of america state of florida 2019-01-14v4No1 / 648
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 698
632amnoncommon feces, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 848
632amnon high in feces compared to caecum cecal content in adult united states of america state of texas research facility horse equus caballus 2020-06-10v4No1 / 897
632amnoncommon caecum, cecal content, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 914
632amnon high in caecum cecal content compared to feces in adult united states of america state of texas research facility horse equus caballus 2020-06-10v4No1 / 943
671amnon high in female adult compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 947
819amnon high in skin of cheek compared to scalp in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 1684
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in newt adult skin cambridgeshire lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org