Summary for ontology term: adult

Number of annotations with term: 1014

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.006054
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCCAGGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTTGAAACTGCAGGGCTAGAGTGCAGGAGGGGCAAGTGGAATTCCTAG0.006054
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.006054
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTCGTTCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.006054
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTCAACTCGTGAACTGCATTTGAAACTACTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.006054
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGCAAGTTGGAAGTGAAATCCGGGGGCTTAACCCCCGAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.006054
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.005045
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTCTTAAGTCTGATGTAAAAGGCAGTGGCTCAACCATTGTGTGCATTGGAAACTGGGAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.005045
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.005045
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAGACAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGCCTTGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.005045

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.280000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.240000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EggerthellaTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGAGCGCGTAGGCGGCCTCTCAAGCGGGATCTCTAATCCGAGGGCTCAACCCCCGGCCGGATCCCGAACTGGGAGGCTCGAGTTCGGTAGAGGCAGGCGGAATTCCCGGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTGTGTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTGGAAACTATGTAACTAGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CoprobacillusTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCAATAGAGGTCTGCGGTGAAAGCCTGAAGCTAAACTTCAGTAAGCCGTGGAAACCAAATAGCTAGAGTGCAGTAGAGGATCGTGGAATTCCATGT0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.160000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.160000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.160000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.160000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.269695
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.263083
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.252218
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.251980
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.247492
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.235940
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTATCTTACCAGAAAGGGACGG0.232595
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.230479
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGG0.224039
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.222669

Annotations:

common ontology terms
term enrichment score
TermScore
adult1.014368
homo sapiens0.701272
feces0.425561
united states of america0.241096
china0.184229
control0.179109
female0.176707
saliva0.153420
skin0.122387
human adult stage0.109199
state of new york0.101064
LOWER IN control0.098763
kingdom of spain0.086854
subgingival plaque0.078182
city0.069307
canada0.067758
obesity0.061420
male0.061400
mouth mucosa0.057955
dentition0.057866
research facility0.057176
brazil0.056358
periodontitis0.052144
rural community0.050776
oral cavity0.049559
state of california0.047745
amsterdam0.045889
czech republic0.044527
kingdom of the netherlands0.043396
subgingival dental plaque0.042247
guangzhou city prefecture0.041878
frog0.041019
epidermis0.040741
fourth decade human stage0.040443
oral wash0.039971
LOWER IN adult0.039909
province of ontario0.039146
buccal mucosa0.038499
taiwan0.038437
high bmi0.038355
age 25-45 years0.038314
belgium0.037477
vagina0.037418
italy0.037343
municipality of beijing0.037244
mouth0.036036
pregnancy0.034286
supragingival plaque0.032443
pair of nares0.032268
homosexual0.030593
msm0.030593
human late adulthood stage0.030593
south korea0.030407
japan0.030041
germany0.028912
ulcerative colitis0.028902
commonwealth of pennsylvania0.028633
australia0.028152
republic of china0.027053
poland0.026991
supragingival dental plaque0.026962
tongue0.026871
state of michigan0.026781
united kingdom0.026711
hospital0.026398
state of texas0.026168
third decade human stage0.025316
palatine tonsil0.025105
hiv infection0.024590
zhejiang province0.024590
intestine0.023739
crohn's disease0.023613
egypt0.023121
cambridgeshire0.023121
gay0.023121
tanzania0.023121
macaca mulatta0.022857
newt0.022857
hispanic or latin american0.022599
state of florida0.022535
monkey0.021858
colombia0.021858
sweden0.021505
type 2 diabetes mellitus0.021387
chronic periodontitis0.021349
heterosexual0.021311
msw0.021311
nasal cavity0.021191
LOWER IN oral wash0.020903
captive0.020370
farm0.019766
gestational diabetes0.019531
overweight body mass index status0.019436
low bmi0.019436
sputum0.019405
state of arizona0.019342
indonesia0.019342
municipality of yogyakarta0.019342
austria0.019280
state of colorado0.018886
Fraction of dbbact annotations with this term covered by the query
TermScore
crohn's disease5.000000
LOWER IN crohn's disease5.000000
cuba2.000000
periodontitis1.250000
iga positive fraction1.200000
LOWER IN iga negative fraction1.200000
iga negative fraction1.200000
LOWER IN iga positive fraction1.200000
obesity1.142857
adult1.057803
phoenix1.000000
LOWER IN periodontitis1.000000
pupa1.000000
bronchus1.000000
LOWER IN bronchus1.000000
third trimester1.000000
glasgow1.000000
columbia1.000000
irritable bowel syndrome1.000000
LOWER IN irritable bowel syndrome1.000000
gestational diabetes1.000000
turin township1.000000
LOWER IN pupa1.000000
auckland city1.000000
third decade human stage1.000000
diarrhea1.000000
LOWER IN botswana1.000000
botswana1.000000
postmenopausal1.000000
buffalo1.000000
saen thong subdistrict1.000000
LOWER IN cuba1.000000
LOWER IN 4-year-old human stage1.000000
LOWER IN acute pancreatitis1.000000
LOWER IN pancreatitis1.000000
acute pancreatitis1.000000
pancreatitis1.000000
atherosclerosis1.000000
bile1.000000
fourth decade human stage0.857143
buccal mucosa0.800000
subgingival dental plaque0.800000
taiwan0.750000
amsterdam0.750000
type 2 diabetes mellitus0.750000
clostridium difficile infection0.750000
high bmi0.692308
toronto0.666667
osteopilus septentrionalis0.666667
tadpole0.666667
LOWER IN tadpole0.666667
tonsillitis0.666667
slovak republic0.666667
republic of china0.666667
overweight body mass index status0.666667
shanghai district0.666667
nasal cavity mucosa0.666667
age 25-45 years0.666667
athlete0.666667
LOWER IN rheumatoid arthritis0.666667
rheumatoid arthritis0.666667
chronic periodontitis0.666667
milan0.666667
low bmi0.666667
LOWER IN low bmi0.666667
umbilicus0.666667
plant fiber cell0.666667
LOWER IN plant fiber cell0.666667
clostridium difficile colitis0.666667
LOWER IN 65-79 year-old human stage0.666667
65-79 year-old human stage0.666667
LOWER IN polycystic ovary syndrome0.666667
smoker0.666667
cigarette smoking0.666667
LOWER IN tonsillitis0.666667
ulcerative colitis0.625000
LOWER IN ulcerative colitis0.625000
saliva0.608696
guangzhou city prefecture0.600000
sputum0.600000
palatine tonsil0.600000
LOWER IN buccal mucosa0.600000
high physical activity0.600000
LOWER IN heterosexual0.600000
LOWER IN msw0.600000
heterosexual0.600000
msw0.600000
dermal layer of tongue0.600000
human adult stage0.590909
homo sapiens0.583026
oral wash0.571429
supragingival dental plaque0.571429
mouth mucosa0.555556
rural community0.545455
low anterior resection0.500000
taipei city0.500000
LOWER IN low anterior resection0.500000
LOWER IN short bowel syndrome0.500000
short bowel syndrome0.500000
state of arizona0.500000
Fraction of annotations for the query sequences containing the term
TermScore
adult0.974359
homo sapiens0.879684
feces0.534517
united states of america0.282051
china0.182446
control0.129191
female0.108481
saliva0.087771
skin0.078895
LOWER IN control0.060158
human adult stage0.060158
state of new york0.056213
research facility0.049310
kingdom of spain0.048323
subgingival plaque0.042406
canada0.039448
city0.038462
male0.033531
dentition0.031558
brazil0.031558
obesity0.031558
mouth mucosa0.030572
periodontitis0.026627
oral cavity0.026627
rural community0.026627
state of california0.026627
LOWER IN adult0.023669
czech republic0.023669
amsterdam0.023669
kingdom of the netherlands0.022682
guangzhou city prefecture0.021696
frog0.021696
province of ontario0.021696
epidermis0.021696
subgingival dental plaque0.021696
oral wash0.020710
fourth decade human stage0.020710
taiwan0.019724
vagina0.019724
high bmi0.019724
italy0.019724
belgium0.019724
age 25-45 years0.019724
buccal mucosa0.019724
mouth0.019724
municipality of beijing0.019724
pregnancy0.017751
pair of nares0.016765
supragingival plaque0.016765
germany0.015779
japan0.015779
united kingdom0.015779
homosexual0.015779
msm0.015779
human late adulthood stage0.015779
south korea0.015779
australia0.015779
ulcerative colitis0.014793
poland0.014793
commonwealth of pennsylvania0.014793
republic of china0.013807
supragingival dental plaque0.013807
tongue0.013807
state of michigan0.013807
state of texas0.013807
hospital0.013807
intestine0.012821
hiv infection0.012821
palatine tonsil0.012821
sweden0.012821
zhejiang province0.012821
third decade human stage0.012821
crohn's disease0.011834
macaca mulatta0.011834
monkey0.011834
state of florida0.011834
egypt0.011834
cambridgeshire0.011834
newt0.011834
gay0.011834
colombia0.011834
tanzania0.011834
hispanic or latin american0.011834
nasal cavity0.010848
LOWER IN oral wash0.010848
heterosexual0.010848
msw0.010848
type 2 diabetes mellitus0.010848
chronic periodontitis0.010848
farm0.010848
captive0.010848
state of arizona0.009862
overweight body mass index status0.009862
austria0.009862
LOWER IN female0.009862
sputum0.009862
state of colorado0.009862
low bmi0.009862
gestational diabetes0.009862
indonesia0.009862
Exp. ID User ID Description Date Region Flag Sequences
578amnon high in hiv infection compared to control in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 1
606amnonnegatively correlated with age in human penis skin ( high in young age compared to old age in homo sapiens skin adult south africa penis male organism male )2020-04-15v3No1 / 1
114amnondominant united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 1
680amnon high in probiotic bifidobacterium longum probiotic compared to control in feces homo sapiens obesity adult russia novosibirsk 2028-03-04v3No1 / 1
689amnon high in non c. diff diarrhea compared to clostridium difficile colitis clostridium difficile infection in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 1
467amnonhigher in arabinoxylan and resistant starch diet compared to normal diet ( high in high fiber plant fiber cell high arabinoxylan and resistant starch diet compared to control diet in feces homo sapiens metabolic syndrome adult kingdom of denmark )2019-01-14v4No1 / 1
723amnonlower in females that gave birth during last 6 months ( high in birth in over 6 months compared to birth during last 6 months in homo sapiens female vagina adult indonesia municipality of yogyakarta )2021-01-02v3No1 / 1
736amnon high in control compared to parasitic helminthiasis infectious disease helminthiasis in feces homo sapiens female adult tanzania pemba island 2021-01-25v3No1 / 1
806amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens united states of america mouth mucosa adult state of new york buccal mucosa 2021-06-19v3No1 / 1
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens adult russia 2020-01-05v3No1 / 2
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth mucosa adult czech republic buccal mucosa 2020-01-09v3No1 / 2
849amnon high in multiple sclerosis multiple sclerosis compared to control in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 2
850amnoncommon homo sapiens, vagina, adult, nigeria, female organism, anambra state, in vitro fertilization clinic2021-12-16v4No1 / 2
869amnon high in before roux-en-y gastric bypass surgery compared to after roux-en-y gastric bypass surgery in feces homo sapiens adult kingdom of the netherlands human adult stage 2022-02-18v3No1 / 2
871amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens antibiotic vancomycin adult male kingdom of the netherlands amsterdam human adult stage 2022-02-19v3No1 / 2
877amnon high in low breath methane content compared to high breath methane content in feces homo sapiens adult austria human early adulthood stage 2022-03-08v4No1 / 2
694amnon high in control compared to polycystic ovary syndrome in feces homo sapiens female obesity adult china shanghai district 2028-03-17v3No1 / 2
725amnon high in control compared to periodontitis acute pericementitis in homo sapiens mouth mucosa adult buccal mucosa china municipality of beijing 2021-01-03v3No1 / 2
529amnonlower in CRC patients that underwent low anterior resection ( high in control compared to low anterior resection in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 3
66amnon high in male compared to female in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
66amnon high in female compared to male in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 3
806amnon high in mouth mucosa buccal mucosa compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 3
593amnon high in osteoarthritis compared to rheumatoid arthritis in feces homo sapiens adult south korea 2020-03-08v3No1 / 3
833amnon high in athlete high exercise compared to normal exercise in feces homo sapiens adult slovak republic age 60-65 years 2021-09-11v1No1 / 3
689amnon high in clostridium difficile colitis clostridium difficile infection compared to non c. diff diarrhea in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 3
725amnon high in control compared to periodontitis acute pericementitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 3
492amnoncommon skin, adult, cuba, frog, eleutherodactylus atkinsi2019-02-27v4No1 / 3
803amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens united states of america adult commonwealth of massachusetts caribbean latino human late adulthood stage 2021-06-18v4No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 3
32amnon high in infant compared to adult in homo sapiens saliva bolivia 2016-12-05v4No1 / 4
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in feces homo sapiens adult )2018-04-19v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, adult, amsterdam)2017-02-19v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, adult, amsterdam)2017-02-19v4No1 / 4
593amnon high in rheumatoid arthritis compared to osteoarthritis in feces homo sapiens adult south korea 2020-03-08v3No1 / 4
597amnon high in gout compared to control in feces homo sapiens adult zhejiang province china 2020-03-23v3No1 / 4
597amnon high in control compared to gout in feces homo sapiens adult zhejiang province china 2020-03-23v3No1 / 4
850amnoncommon homo sapiens, adult, nigeria, male organism, semen, sperm, anambra state, in vitro fertilization clinic2021-12-16v4No1 / 4
685amnon high in control compared to helicobacter pylori infectious disease in homo sapiens oral cavity mouth mucosa adult australia 2028-03-08v3No1 / 4
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in feces homo sapiens city adult colombia )2019-01-10v4No1 / 4
715amnon high in 65-79 year-old human stage compared to third decade human stage fourth decade human stage in homo sapiens esophagus adult australia oesophageal brush 2028-05-22v4No1 / 4
716amnon high in halitosis chronic bad breath compared to control in homo sapiens tongue adult dermal layer of tongue china 2028-05-22v3No1 / 4
779amnon high in ulcerative colitis compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 5
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, adult, amsterdam)2017-02-19v4No1 / 5
806amnon high in hard palate compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 5
831amnon high in control compared to pancreatic cancer in feces homo sapiens adult israel 2021-09-11v3No1 / 5
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens periodontitis adult subgingival plaque subgingival dental plaque chronic periodontitis china municipality of shanghai 2021-09-11v3No1 / 5
97amnondominant adult, brazil, state of florida, calophya2017-04-01v4No1 / 5
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 5
644amnonhigher in younger adults (total age range 20-80) ( high in young age compared to old age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 5
794amnon high in hiv infection human immunodeficiency virus infectious disease antiretroviral therapy compared to control in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 5
685amnon high in evening compared to morning in homo sapiens oral cavity mouth mucosa adult australia 2028-03-08v3No1 / 5
731amnonhigher in oropharingeal otic fluid drainage compared to buccal mucosa ( high in oropharynx compared to mouth mucosa buccal mucosa in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 5
519amnon high in control compared to dental caries in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 5
400amnonpositively correlated with bmi ( high in high bmi compared to low bmi in feces homo sapiens adult thailand )2018-11-18v4No1 / 6
856amnon high in control compared to ulcerative colitis ulcerative colitis in homo sapiens rectum adult biopsy intestinal mucosa china human adult stage 2022-01-09v3No1 / 6
113amnondominant united states of america, research facility, intestine, adult, danio rerio, zebra fish2017-04-10v4No1 / 6
868amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 6
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 6
670amnondominant adult, adult organism, croatia, opatija, anisakis pegreffii, dolphin parasite2020-09-26v4No1 / 6
703amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 6
773amnon high in tonsillitis recurrent tonsillitis compared to iga glomerulonephritis in homo sapiens adult palatine tonsil japan tonsillectomy 2021-04-23v4No1 / 6
535amnoncommon in healthy adult vaginal samples (common homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 7
551amnondominant rumen, adult, egypt, camel, camelus dromedarius2019-08-27v3No1 / 7
354amnon high in saliva oral wash compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 7
806amnon high in oral cavity oral wash compared to saliva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 7
378amnon high in periodontitis compared to control in homo sapiens dentition adult brazil subgingival plaque mouth 2018-09-14v4No1 / 7
833amnon high in normal exercise compared to athlete high exercise in feces homo sapiens adult slovak republic age 60-65 years 2021-09-11v1No1 / 7
841amnon high in iga negative fraction compared to iga positive fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v4No1 / 7
850amnon high in male organism semen sperm compared to vagina female organism in homo sapiens adult nigeria anambra state in vitro fertilization clinic 2021-12-16v4No1 / 7
632amnondominant united states of america, research facility, caecum, adult, equus caballus, state of texas, cecal content, horse2020-06-10v4No1 / 7
644amnonpositively correalted with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 7
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 7
717amnondominant homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 7
663amnondominant homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 7
685amnon high in helicobacter pylori infectious disease compared to control in homo sapiens oral cavity mouth mucosa adult australia 2028-03-08v3No1 / 7
734amnon high in vegetarian diet compared to omnivore diet in feces homo sapiens adult taiwan republic of china 2021-01-22v3No1 / 7
277amnon high in nasopharynx compared to nasal cavity pair of nares in homo sapiens adult belgium 2018-01-23v4No1 / 7
526amnonhigh freq in bile of Cholelithiasis patients (dominant homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 7
594amnondominant feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 8
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 8
180amnondominant adult, czech republic, dermanyssus gallinae, red poulty mite, poulty farm2017-08-14v4No1 / 8
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 8
483amnondominant united states of america, research facility, adult, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 8
819amnondominant homo sapiens, female, skin, adult, scalp, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 8
749amnondominant homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 8
516amnoncommon homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 8
535amnon high in dysplasia of cervix compared to control in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v4No1 / 9
775amnon high in control compared to lichen planus in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 9
819amnondominant homo sapiens, female, skin, adult, scalp, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 9
819amnondominant homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 9
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in feces homo sapiens adult kingdom of the netherlands amsterdam homosexual msm 2020-05-31v4No1 / 9
630amnon high in high physical activity compared to sedentary low physical activity in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 9
866amnon high in ulcerative colitis ulcerative colitis compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 9
868amnonhigher in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga positive fraction compared to iga negative fraction in feces homo sapiens adult canada province of alberta )2022-02-12v4No1 / 9
678amnon high in tooth disease black dental staining compared to control in homo sapiens adult kingdom of spain supragingival plaque supragingival dental plaque 2028-03-02v3No1 / 9
693amnon high in control compared to polycystic ovary syndrome in feces homo sapiens female adult austria graz city district 2028-03-16v1No1 / 9
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high fiber plant fiber cell high arabinoxylan and resistant starch diet arabinoxylan diet in feces homo sapiens metabolic syndrome adult kingdom of denmark )2019-01-14v4No1 / 9
294amnon high in irritable bowel syndrome compared to control in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 9
773amnonhigh in non iga bound bacteria compared to iga bound bacteria ( high in iga negative fraction compared to iga positive fraction in homo sapiens adult palatine tonsil japan tonsillectomy )2021-04-23v4No1 / 9
773amnonhigh in iga bound bacteria compared to non iga bound bacteria ( high in iga positive fraction compared to iga negative fraction in homo sapiens adult palatine tonsil japan tonsillectomy )2021-04-23v4No1 / 9
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (dominant skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 10
353amnonhigh freq. in wild Triturus cristatus newts skin (dominant skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 10
354amnondominant homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 10
806amnon high in dentition supragingival plaque supragingival dental plaque compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 10
576amnon high in aphthous stomatitis compared to control in homo sapiens mouth mucosa adult czech republic lip lower labial mucosa 2020-01-09v3No1 / 10
378amnon high in control compared to periodontitis in homo sapiens dentition adult brazil subgingival plaque mouth 2018-09-14v4No1 / 10
629amnon high in hiv infection acquired immunodeficiency syndrome compared to control in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v4No1 / 10
632amnondominant feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 10
868amnonlower in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga negative fraction compared to iga positive fraction in feces homo sapiens adult canada province of alberta )2022-02-12v4No1 / 10
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 10
749amnondominant homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 10
711amnondominant homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 10
724amnondominant homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 10
724amnon high in pregnancy pregnancy trimester 2 compared to non-pregnant in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 10
519amnon high in dental caries compared to control in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 10
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 11
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 11
535amnonhcommon in adult vaginal samples with cervical dysplasia (common homo sapiens, united states of america, female, vagina, adult, state of arizona, phoenix, dysplasia of cervix)2019-07-25v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 11
354amnondominant homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 11
567amnoncommon homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 11
806amnon high in palatine tonsil compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 11
819amnondominant homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 11
819amnon high in dalian city prefecture low atmospheric pollution compared to baoding city prefecture high atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 11
849amnon high in control compared to multiple sclerosis multiple sclerosis in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 11
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 11
670amnon high in larval stage compared to adult adult organism in croatia opatija anisakis pegreffii dolphin parasite 2020-09-26v4No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 11
492amnondominant skin, adult, cuba, frog, eleutherodactylus atkinsi2019-02-27v4No1 / 11
757amnon high in female compared to male in feces homo sapiens adult brazil santa catarina state 2021-03-28v3No1 / 11
328amnondominant feces, research facility, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 12
796amnon high in control compared to graves' disease in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v3No1 / 12
556amnondominant feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 12
354amnondominant homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 12
567amnoncommon homo sapiens, adult, belgium, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 12
806amnon high in saliva compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 12
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 12
118amnoncommon in captive reared butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 12
873amnondominant feces, homo sapiens, united states of america, adult, commonwealth of pennsylvania, human adult stage, urban community2022-03-03v1No1 / 12
806amnondominant homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 12
684amnondominant homo sapiens, united states of america, nasal cavity, nasal cavity mucosa, adult, commonwealth of pennsylvania, nose, middle nasal meatus2028-03-05v1No1 / 12
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 12
724amnondominant homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 12
773amnon high in iga glomerulonephritis compared to tonsillitis recurrent tonsillitis in homo sapiens adult palatine tonsil japan tonsillectomy 2021-04-23v4No1 / 12
567amnondominant homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 13
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 13
594amnondominant feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 13
833amnondominant feces, homo sapiens, adult, slovak republic, athlete, age 60-65 years, high exercise2021-09-11v1No1 / 13
97amnoncommon adult, brazil, state of florida, calophya2017-04-01v4No1 / 13
636amnoncommon homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, respiratory failure, acute respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 13
400amnonhigh freq. in hmong (chinese) females from thailand (dominant feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
868amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 13
644amnondominant feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 13
717amnondominant homo sapiens, axilla, skin, adult, canada, province of ontario, epidermis, armpit2028-05-22v3No1 / 13
725amnondominant homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 13
492amnondominant skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 13
492amnondominant skin, adult, brazil, frog, lesser foam frog, scinax perereca2019-02-27v4No1 / 13
492amnondominant skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 13
731amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 13
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
806amnondominant homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 13
516amnondominant homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 13
546amnondominant homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 14
576amnon high in aphthous stomatitis compared to control in homo sapiens adult czech republic mouth 2020-01-09v3No1 / 14
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic lip lower labial mucosa 2020-01-09v3No1 / 14
576amnondominant homo sapiens, mouth mucosa, adult, czech republic, lip, lower labial mucosa2020-01-09v3No1 / 14
576amnondominant homo sapiens, mouth mucosa, adult, czech republic, buccal mucosa2020-01-09v3No1 / 14
831amnondominant feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 14
834amnondominant feces, homo sapiens, adult, japan2021-09-11v1No1 / 14
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 14
850amnondominant homo sapiens, vagina, adult, nigeria, female organism, anambra state, in vitro fertilization clinic2021-12-16v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in feces homo sapiens city adult colombia 2018-11-20v4No1 / 14
118amnoncommon in wild butterfly (common body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 14
118amnon high in adult compared to pupa shelled egg in body proper panama butterfly heliconius erato whole body tropical and subtropical moist broadleaf forest biome forest ecosystem 2017-04-11v4No1 / 14
873amnondominant feces, homo sapiens, adult, tanzania, africa, rural community, human adult stage2022-03-03v1No1 / 14
646amnondominant homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 14
438amnondominant feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 14
684amnoncommon homo sapiens, united states of america, nasal cavity, nasal cavity mucosa, adult, commonwealth of pennsylvania, nose, middle nasal meatus2028-03-05v1No1 / 14
693amnondominant feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 14
469amnondominant homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
477amnondominant feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 )2028-05-23v4No1 / 14
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 14
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 14
734amnon high in omnivore diet compared to vegetarian diet in feces homo sapiens adult taiwan republic of china 2021-01-22v3No1 / 14
277amnondominant homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 14
502amnon high in control compared to schizophrenia in feces homo sapiens united states of america adult 2019-03-12v4No1 / 14
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
328amnondominant research facility, intestine, mucosa, digestive tract, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 15
354amnondominant homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 15
378amnondominant homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 15
805amnondominant homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 15
846amnondominant homo sapiens, united states of america, saliva, adult, commonwealth of massachusetts, human adult stage, stimulated saliva2021-11-20v3No1 / 15
850amnondominant homo sapiens, adult, nigeria, male organism, semen, sperm, anambra state, in vitro fertilization clinic2021-12-16v4No1 / 15
873amnondominant feces, homo sapiens, adult, africa, rural community, botswana, human adult stage2022-03-03v1No1 / 15
409amnondominant homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 15
651amnondominant feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 15
651amnondominant feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 15
380amnondominant feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 15
671amnondominant feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 15
685amnondominant homo sapiens, oral cavity, mouth mucosa, adult, australia2028-03-08v3No1 / 15
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 15
470amnondominant feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 15
723amnoncommon homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 15
819amnoncommon homo sapiens, female, skin, adult, scalp, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 15
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in feces homo sapiens female adult tanzania pemba island 2021-01-25v3No1 / 15
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 15
276amnondominant feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 15
502amnondominant feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 15
806amnondominant homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 15
806amnondominant homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 15
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 15
532amnondominant feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 16
310amnondominant feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 16
535amnonhigh freq. in adult vaginal samples with cervical dysplasia (dominant homo sapiens, united states of america, female, vagina, adult, state of arizona, phoenix, dysplasia of cervix)2019-07-25v4No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v4No1 / 16
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in feces homo sapiens sichuan province )2016-12-06v4No1 / 16
345amnondominant homo sapiens, nasal cavity, nasal cavity mucosa, adult, austria, graz city district2018-06-11v4No1 / 16
348amnondominant homo sapiens, saliva, adult, italy2018-07-16v4No1 / 16
567amnondominant homo sapiens, nasopharynx, adult, belgium2019-12-05v4No1 / 16
576amnon high in aphthous stomatitis compared to control in homo sapiens tongue adult czech republic 2020-01-09v3No1 / 16
371amnonnegatively correlated with age in amerindian saliva ( high in infant obsolete_juvenile stage compared to adult in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 16
606amnonpositively correlated with age in human penis skin ( high in old age compared to young age in homo sapiens skin adult south africa penis male organism male )2020-04-15v3No1 / 16
118amnonhigh freq. in wild butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
884amnondominant feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v4No1 / 16
652amnondominant homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 16
663amnondominant homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 16
794amnondominant feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 16
678amnondominant homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 16
680amnondominant feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 16
723amnondominant feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 16
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 16
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
492amnondominant skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 16
492amnondominant skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 16
493amnondominant homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 16
753amnondominant feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 16
519amnondominant homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 16
526amnonhigh freq. in bile of healthy controls (dominant homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 16
32amnondominant homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 17
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 17
353amnonhigh freq. in captive Triturus cristatus newts skin (dominant research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 17
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 17
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens adult russia 2020-01-05v3No1 / 17
591amnondominant feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 17
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
368amnondominant feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 17
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to infant obsolete_juvenile stage in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 17
606amnondominant homo sapiens, skin, adult, south africa, penis, male organism, male2020-04-15v3No1 / 17
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
636amnoncommon homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 17
849amnondominant feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 17
852amnondominant homo sapiens, saliva, adult, canada, non-smoker2021-12-17v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 17
639amnondominant feces, nature reserve, adult, oryctolagus cuniculus, australia, wild, european rabbit2020-08-21v3No1 / 17
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 17
630amnondominant feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 17
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 17
663amnondominant feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 17
428amnondominant feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 17
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in feces homo sapiens city adult colombia )2019-01-10v4No1 / 17
724amnoncommon homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 17
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 17
492amnondominant skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 17
743amnondominant feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 17
277amnondominant homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
289amnondominant feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 17
290amnondominant feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 17
526amnon high in control compared to cholelithiasis in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 17
532amnondominant feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 18
339amnondominant feces, homo sapiens, adult, india2018-05-24v4No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 18
567amnon high in chronic rhinosinusitis sinusitis compared to control in homo sapiens nasopharynx adult belgium 2019-12-05v4No1 / 18
724amnoncommon homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 18
368amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 18
831amnondominant feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 18
833amnondominant feces, homo sapiens, adult, slovak republic, age 60-65 years, normal exercise2021-09-11v1No1 / 18
841amnondominant homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 18
806amnondominant homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 18
636amnon high in tracheal aspirate trachea endotracheal aspirate compared to oropharynx oropharyngeal swab in homo sapiens united states of america hospital adult commonwealth of pennsylvania acute respiratory failure respiratory failure 2020-08-08v4No1 / 18
623amnoncommon homo sapiens, united states of america, skin, adult, commonwealth of pennsylvania, skin of body, umbilicus2020-05-10v3No1 / 18
627amnondominant feces, female, pregnancy, adult, china2020-05-16v3No1 / 18
630amnon high in sedentary low physical activity compared to high physical activity in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 18
874amnondominant homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 18
875amnondominant feces, homo sapiens, adult, thailand, rural community, village, saen thong subdistrict, human late adulthood stage2022-03-04v3No1 / 18
880amnondominant feces, homo sapiens, adult, kingdom of denmark, human adult stage2022-03-12v3No1 / 18
650amnondominant feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 18
892amnondominant homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v4No1 / 18
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 18
663amnondominant feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 18
663amnondominant homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 18
428amnondominant feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 18
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 18
715amnondominant homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 18
716amnondominant homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 18
717amnon high in male male organism compared to female female organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 18
477amnondominant feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 18
492amnondominant skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 18
806amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 18
293amnondominant feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 18
294amnondominant feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 18
519amnondominant homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 18
774amnondominant homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 18
542amnondominant research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 19
774amnondominant homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 19
330amnon high in infant age 1 year compared to adult fourth decade human stage in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 19
796amnondominant feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 19
66amnondominant homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 19
567amnondominant homo sapiens, adult, belgium, maxillary sinus, ethmoid sinus2019-12-05v4No1 / 19
574amnondominant feces, homo sapiens, adult, russia2020-01-05v3No1 / 19
836amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, oral lichen planus, china, municipality of shanghai, gingival erosive oral lichen planus2021-09-11v3No1 / 19
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
401amnondominant feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 19
404amnondominant feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 19
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 19
118amnonhigh freq. in captive reared butterfly (dominant body proper, adult, panama, butterfly, heliconius erato, whole body, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 19
871amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens adult male kingdom of the netherlands amsterdam before antibiotics human adult stage 2022-02-19v3No1 / 19
121amnondominant feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 19
438amnondominant feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 19
678amnondominant homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 19
455amnondominant feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to forager chepang in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 19
477amnondominant feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 19
723amnondominant homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 19
725amnondominant homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 19
732amnondominant feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 19
736amnondominant feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 19
803amnondominant feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 19
276amnondominant feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 19
806amnondominant homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 19
757amnondominant feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 19
292amnondominant feces, homo sapiens, control, adult, china2018-02-05v4No1 / 19
299amnondominant homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
516amnondominant feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 19
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 20
328amnonlower in feces compared to intestinal mucosa in mice ( high in intestine mucosa digestive tract compared to feces in research facility mus musculus balb/c adult brazil mouse )2018-04-30v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 20
591amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 20
594amnondominant homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens adult china 2020-03-30v4No1 / 20
836amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of shanghai2021-09-11v3No1 / 20
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
851amnondominant feces, homo sapiens, adult, italy, milan2021-12-16v3No1 / 20
639amnondominant feces, nature reserve, adult, australia, wild, lepus europaeus, european brown hare2020-08-21v3No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 20
629amnondominant feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 20
866amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 20
869amnondominant feces, homo sapiens, obesity, adult, kingdom of the netherlands, high bmi, human adult stage2022-02-18v3No1 / 20
409amnondominant homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 20
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
663amnondominant feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 20
677amnondominant homo sapiens, tonsil, adult, palatine tonsil, south korea2028-03-01v3No1 / 20
703amnondominant homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 20
720amnondominant feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 20
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 20
492amnondominant skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 20
734amnondominant feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 20
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 20
805amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 20
277amnoncommon homo sapiens, nasopharynx, adult, belgium2018-01-23v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 20
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 20
529amnonhigh freq. in patients that underwent low anterior resection (dominant feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 21
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
320amnondominant feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 21
330amnondominant feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 21
794amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 21
814amnondominant feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 21
567amnoncommon homo sapiens, pair of nares, adult, belgium, anterior naris2019-12-05v4No1 / 21
575amnonhigh freq. in professional martial arts athletes (dominant feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 21
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth adult czech republic 2020-01-09v3No1 / 21
576amnondominant homo sapiens, tongue, adult, czech republic2020-01-09v3No1 / 21
581amnondominant in red swamp crayfish grown in flooded rice field (dominant rice field, intestine, adult, jiangsu province, fish, china, procambarus clarkii, red swamp crayfish)2020-01-21v3No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 21
593amnondominant feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 21
835amnondominant feces, homo sapiens, adult, japan2021-09-11v3No1 / 21
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 21
404amnon high in normal stool compared to hard stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 21
867amnon high in third trimester compared to second trimester in feces homo sapiens female pregnancy adult italy gestational diabetes gestational diabetes turin township human adult stage 2022-02-09v3No1 / 21
870amnondominant feces, homo sapiens, adult, new zealand, auckland city, third decade human stage, fourth decade human stage2022-02-18v3No1 / 21
409amnondominant feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 21
877amnondominant feces, homo sapiens, adult, austria, human early adulthood stage2022-03-08v4No1 / 21
663amnon high in low bmi compared to obesity obese body mass index status high bmi in feces homo sapiens adult poland switzerland 2020-09-22v4No1 / 21
703amnondominant homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 21
716amnondominant homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 21
717amnondominant homo sapiens, pair of nares, skin, adult, canada, province of ontario, epidermis, inner nostril2028-05-22v3No1 / 21
720amnondominant feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 21
726amnondominant homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 21
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
734amnondominant feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 21
278amnondominant homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 21
290amnon high in small village rural community compared to city in feces homo sapiens adult china 2018-02-01v4No1 / 21
806amnondominant homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 21
773amnondominant homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 21
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
720amnon high in control compared to autoimmune hepatitis in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 22
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
576amnon high in mouth mucosa compared to tongue in homo sapiens adult czech republic 2020-01-09v3No1 / 22
378amnondominant homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 22
851amnondominant homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 22
404amnonpositively correlated with fiber intake ( high in plant fiber cell high filber compared to low fiber in feces homo sapiens city adult colombia )2018-11-20v4No1 / 22
593amnondominant feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
629amnondominant feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 22
806amnoncommon homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 22
650amnondominant feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 22
670amnon high in adult adult organism compared to larval stage in croatia opatija anisakis pegreffii dolphin parasite 2020-09-26v4No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
715amnon high in third decade human stage fourth decade human stage compared to 65-79 year-old human stage in homo sapiens esophagus adult australia oesophageal brush 2028-05-22v4No1 / 22
467amnondominant feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 22
819amnoncommon homo sapiens, female, skin, adult, scalp, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 22
736amnon high in child age 1-3 years 2-year-old human stage 1-year-old human stage compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
278amnon high in periodontitis compared to control in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 22
502amnondominant feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 22
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 22
293amnondominant feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 22
312amnondominant feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 23
346amnonhigher in pupae compared to larva and adult in fruit fly ( high in pupa compared to larval stage larva adult in body proper ceratitis capitata italy whole body mediterranean fruit fly )2018-06-11v4No1 / 23
566amnon high in insomnia compared to control in feces homo sapiens adult china 2019-11-24v4No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
576amnon high in control compared to aphthous stomatitis in homo sapiens tongue adult czech republic 2020-01-09v3No1 / 23
73amnondominant feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 23
601amnondominant feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 23
634amnondominant homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 23
841amnondominant feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
843amnondominant feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 23
623amnondominant homo sapiens, united states of america, skin, adult, commonwealth of pennsylvania, skin of body, umbilicus2020-05-10v3No1 / 23
856amnondominant homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 23
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, epidermis, umbilicus, bellybutton2028-05-22v3No1 / 23
832amnondominant feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 23
694amnondominant feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 23
712amnondominant homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 23
717amnon high in female female organism compared to male male organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 23
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, frog, lithobates catesbeianus2019-02-27v4No1 / 23
734amnondominant feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 23
303amnondominant feces, homo sapiens, adult, germany2018-03-12v4No1 / 23
773amnondominant homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 23
532amnoncommon feces, homo sapiens, adult, czech republic, short bowel syndrome2019-07-21v1No1 / 24
322amnondominant digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 24
554amnondominant homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 24
338amnon high in adult compared to larval stage tadpole amphibian larval stage in skin andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 24
354amnon high in sputum induced sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
566amnondominant feces, homo sapiens, adult, china2019-11-24v4No1 / 24
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 24
597amnondominant feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 24
378amnondominant homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v4No1 / 24
601amnon high in type 2 diabetes mellitus compared to control in feces homo sapiens adult china 2020-03-30v4No1 / 24
849amnondominant feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 24
643amnondominant feces, homo sapiens, adult, south korea2020-08-30v4No1 / 24
670amnoncommon adult, adult organism, croatia, opatija, anisakis pegreffii, dolphin parasite2020-09-26v4No1 / 24
683amnondominant feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 24
685amnon high in morning compared to evening in homo sapiens oral cavity mouth mucosa adult australia 2028-03-08v3No1 / 24
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
717amnondominant homo sapiens, skin, adult, canada, province of ontario, epidermis, umbilicus, bellybutton2028-05-22v3No1 / 24
471amnondominant digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 24
721amnonhigher in high protein weight loss diet compared to control diet ( high in weight loss weight loss diet high protein diet compared to control diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 )2028-05-23v4No1 / 24
723amnondominant homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
745amnon high in human late adulthood stage compared to 25-44 year-old human stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 24
753amnondominant feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 24
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
796amnondominant feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 25
580amnondominant feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 25
856amnondominant homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 25
640amnondominant homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 25
663amnoncommon homo sapiens, nasal cavity, pair of nares, adult, poland2020-09-22v4No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
717amnoncommon homo sapiens, axilla, skin, adult, canada, province of ontario, epidermis, armpit2028-05-22v3No1 / 25
721amnondominant feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 25
723amnoncommon homo sapiens, female, breast milk, adult, breast milk material, indonesia, municipality of yogyakarta2021-01-02v3No1 / 25
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
354amnoncommon homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 26
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
869amnon high in after roux-en-y gastric bypass surgery compared to before roux-en-y gastric bypass surgery in feces homo sapiens adult kingdom of the netherlands human adult stage 2022-02-18v3No1 / 26
650amnonpositively correlated with BMI ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 26
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
689amnondominant feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 26
802amnondominant feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 26
529amnondominant feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 27
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 27
404amnon high in hard stool compared to normal stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 27
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
685amnoncommon homo sapiens, oral cavity, mouth mucosa, adult, australia2028-03-08v3No1 / 27
717amnoncommon homo sapiens, pair of nares, skin, adult, canada, province of ontario, epidermis, inner nostril2028-05-22v3No1 / 27
779amnon high in control compared to ulcerative colitis in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 28
806amnon high in gingiva keratinized gingiva compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 28
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens dentition adult brazil subgingival plaque mouth periodontitis 2018-09-13v4No1 / 28
841amnon high in iga positive fraction compared to iga negative fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v4No1 / 28
651amnon high in female compared to male in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 28
693amnon high in polycystic ovary syndrome compared to control in feces homo sapiens female adult austria graz city district 2028-03-16v1No1 / 29
711amnoncommon homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 29
724amnon high in non-pregnant compared to pregnancy pregnancy trimester 2 in homo sapiens female vagina adult egypt ismailia age 25-45 years 2021-01-03v3No1 / 29
806amnoncommon homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 29
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 29
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
320amnoncommon feces, homo sapiens, adult, crohn's disease2018-04-19v4No1 / 30
774amnon high in tonsillitis compared to control in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v3No1 / 30
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 30
869amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens obesity adult kingdom of the netherlands high bmi human adult stage 2022-02-18v3No1 / 30
871amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens adult male kingdom of the netherlands amsterdam before antibiotics human adult stage 2022-02-19v3No1 / 30
492amnoncommon skin, adult, brazil, frog, lesser foam frog, scinax perereca2019-02-27v4No1 / 30
796amnon high in graves' disease compared to control in feces homo sapiens adult taiwan republic of china taoyuan city 2021-06-10v3No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
651amnon high in male compared to female in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 31
652amnon high in control compared to rheumatoid arthritis in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 31
681amnondominant feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 31
492amnoncommon skin, adult, brazil, frog, dendropsophus minutus, lesser treefrog2019-02-27v4No1 / 31
806amnoncommon homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 31
354amnon high in sputum induced sputum compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 32
806amnon high in pair of nares external naris compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 32
578amnon high in control compared to hiv infection in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 32
404amnonnegatively correlated with fiber intake ( high in low fiber compared to high fiber plant fiber cell in feces homo sapiens city adult colombia )2018-11-20v4No1 / 32
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 32
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 32
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 33
354amnon high in saliva oral wash compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 33
856amnoncommon homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 33
646amnoncommon homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 33
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in feces homo sapiens adult kingdom of the netherlands amsterdam 2020-05-31v4No1 / 34
492amnoncommon skin, adult, brazil, frog, leptodactylus latrans, lesser foam frog2019-02-27v4No1 / 34
576amnon high in control compared to aphthous stomatitis in homo sapiens mouth mucosa adult czech republic buccal mucosa 2020-01-09v3No1 / 35
871amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens antibiotic vancomycin adult male kingdom of the netherlands amsterdam human adult stage 2022-02-19v3No1 / 35
180amnoncommon adult, czech republic, dermanyssus gallinae, red poulty mite, poulty farm2017-08-14v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of cheek, south korea, third decade human stage2021-03-10v4No1 / 36
749amnoncommon homo sapiens, female, skin, adult, seoul, skin of forehead, south korea, third decade human stage2021-03-10v4No1 / 36
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
345amnoncommon homo sapiens, nasal cavity, nasal cavity mucosa, adult, austria, graz city district2018-06-11v4No1 / 37
873amnon high in hunter gatherer hadza compared to maasai sandawe burunge in feces homo sapiens adult tanzania africa commonwealth of pennsylvania rural community human adult stage 2022-03-03v1No1 / 37
651amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 37
681amnoncommon feces, homo sapiens, adult, seoul, south korea2028-03-04v3No1 / 37
277amnoncommon homo sapiens, nasal cavity, pair of nares, adult, belgium2018-01-23v4No1 / 37
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in feces homo sapiens adult )2018-04-19v4No1 / 38
567amnon high in nasopharynx compared to pair of nares anterior naris in homo sapiens adult belgium 2019-12-05v4No1 / 38
866amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 38
723amnonhigher in females that gave birth during last 6 months ( high in birth during last 6 months compared to birth in over 6 months in homo sapiens female vagina adult indonesia municipality of yogyakarta )2021-01-02v3No1 / 38
806amnoncommon homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 39
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in homo sapiens periodontitis adult subgingival plaque subgingival dental plaque chronic periodontitis china municipality of shanghai 2021-09-11v3No1 / 39
677amnoncommon homo sapiens, tonsil, adult, palatine tonsil, south korea2028-03-01v3No1 / 39
725amnon high in periodontitis acute pericementitis compared to control in homo sapiens mouth mucosa adult buccal mucosa china municipality of beijing 2021-01-03v3No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, control, bile, gallbladder, adult, kingdom of spain)2019-07-14v3No1 / 39
378amnon high in depth > 3mm deep pocket depth compared to depth < 3mm shallow pocket depth in homo sapiens dentition adult brazil subgingival plaque mouth periodontitis 2018-09-13v4No1 / 40
835amnoncommon feces, homo sapiens, adult, japan2021-09-11v3No1 / 40
113amnoncommon united states of america, research facility, intestine, adult, danio rerio, zebra fish2017-04-10v4No1 / 40
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 40
806amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 40
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in mouth mucosa buccal mucosa compared to oropharynx in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 41
806amnoncommon homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 41
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 42
831amnoncommon feces, homo sapiens, adult, israel, pancreatic cancer2021-09-11v3No1 / 43
725amnon high in periodontitis acute pericementitis compared to control in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 43
717amnoncommon homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 44
606amnoncommon homo sapiens, skin, adult, south africa, penis, male organism, male2020-04-15v3No1 / 44
871amnonlower before antibiotic treatment compared to after treatment ( high in antibiotic vancomycin compared to before antibiotics in feces homo sapiens adult male kingdom of the netherlands amsterdam human adult stage )2022-02-19v3No1 / 44
652amnon high in rheumatoid arthritis compared to control in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 44
663amnon high in obesity obese body mass index status high bmi compared to low bmi in feces homo sapiens adult poland switzerland 2020-09-22v4No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in homo sapiens adult germany type 2 diabetes mellitus city of dresden 2028-04-02v3No1 / 44
725amnon high in periodontitis chronic periodontitis compared to control in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 44
757amnon high in male compared to female in feces homo sapiens adult brazil santa catarina state 2021-03-28v3No1 / 44
869amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens obesity adult kingdom of the netherlands high bmi human adult stage 2022-02-18v3No1 / 45
773amnoncommon homo sapiens, adult, palatine tonsil, tonsillitis, japan, tonsillectomy, recurrent tonsillitis2021-04-23v4No1 / 45
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
873amnon high in maasai sandawe burunge compared to hunter gatherer hadza in feces homo sapiens adult tanzania africa commonwealth of pennsylvania rural community human adult stage 2022-03-03v1No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
640amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 47
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
546amnoncommon homo sapiens, saliva, adult, slovak republic, morning, age 21-28 years2019-08-07v3No1 / 48
806amnon high in oral cavity oral wash compared to hard palate in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 48
856amnoncommon homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 48
869amnoncommon feces, homo sapiens, obesity, adult, kingdom of the netherlands, high bmi, human adult stage2022-02-18v3No1 / 48
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
806amnoncommon homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 48
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
576amnon high in tongue compared to mouth mucosa in homo sapiens adult czech republic 2020-01-09v3No1 / 50
834amnoncommon feces, homo sapiens, adult, japan2021-09-11v1No1 / 50
849amnoncommon feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 50
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
796amnoncommon feces, homo sapiens, control, adult, taiwan, republic of china, taoyuan city2021-06-10v3No1 / 51
725amnoncommon homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 51
796amnoncommon feces, homo sapiens, adult, taiwan, graves' disease, republic of china, taoyuan city2021-06-10v3No1 / 52
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
598amnonhigher in mouthwash of students compared to teachers ( high in child age 13-15 years 13-year-old human stage 14-year-old human stage compared to adult in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 52
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 52
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 52
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
278amnon high in periodontitis compared to control in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 52
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
773amnoncommon homo sapiens, adult, palatine tonsil, iga glomerulonephritis, japan, tonsillectomy2021-04-23v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
819amnon high in dalian city prefecture low atmospheric pollution compared to baoding city prefecture high atmospheric pollution in homo sapiens female skin adult skin of cheek china age 25-45 years 2021-07-12v1No1 / 55
578amnon high in sweden compared to kingdom of spain in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 55
814amnoncommon feces, homo sapiens, female, obesity, adult, obese body mass index status, germany, high bmi, overweight body mass index status, age 50-70 years2021-06-30v4No1 / 55
653amnon high in saliva compared to tongue dermal layer of tongue in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
492amnoncommon skin, adult, chile, frog, eupsophus vertebralis2019-02-27v4No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
774amnon high in control compared to tonsillitis in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v3No1 / 55
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
775amnon high in lichen planus compared to control in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 56
532amnon high in short bowel syndrome compared to control in feces homo sapiens adult czech republic 2019-07-21v1No1 / 57
806amnon high in oral cavity oral wash compared to mouth mucosa buccal mucosa in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 57
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
806amnon high in oral cavity oral wash compared to dentition supragingival plaque supragingival dental plaque in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 58
866amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 58
877amnon high in high breath methane content compared to low breath methane content in feces homo sapiens adult austria human early adulthood stage 2022-03-08v4No1 / 58
644amnon high in male compared to female in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 58
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 58
338amnon high in larval stage tadpole amphibian larval stage compared to adult in skin andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 59
843amnoncommon feces, adult, italy, human adult stage, non-celiac gluten sensitivity2021-11-17v3No1 / 59
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
831amnoncommon feces, homo sapiens, control, adult, israel2021-09-11v3No1 / 60
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, vegetarian diet2021-01-22v3No1 / 60
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
849amnoncommon feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
593amnoncommon feces, homo sapiens, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
851amnoncommon feces, homo sapiens, adult, italy, milan2021-12-16v3No1 / 62
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
630amnon high in female compared to male in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
630amnon high in male compared to female in feces homo sapiens adult kingdom of spain madrid 2020-05-31v3No1 / 63
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 65
640amnoncommon homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 65
875amnoncommon feces, homo sapiens, adult, thailand, rural community, village, saen thong subdistrict, human late adulthood stage2022-03-04v3No1 / 65
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, lip, lower labial mucosa2020-01-09v3No1 / 66
852amnoncommon homo sapiens, saliva, adult, canada, non-smoker2021-12-17v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
734amnoncommon feces, homo sapiens, adult, taiwan, coronary heart disease, republic of china2021-01-22v3No1 / 66
576amnoncommon homo sapiens, tongue, adult, czech republic2020-01-09v3No1 / 67
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
874amnoncommon homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 67
805amnon high in non-smoker compared to nicotine dependence smoker cigarette smoking in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 67
757amnoncommon feces, homo sapiens, adult, brazil, santa catarina state2021-03-28v3No1 / 67
574amnoncommon feces, homo sapiens, adult, russia2020-01-05v3No1 / 68
593amnoncommon feces, homo sapiens, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon feces, homo sapiens, adult, taiwan, republic of china, omnivore diet2021-01-22v3No1 / 68
378amnoncommon homo sapiens, control, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth2018-09-14v4No1 / 69
846amnoncommon homo sapiens, united states of america, saliva, adult, commonwealth of massachusetts, human adult stage, stimulated saliva2021-11-20v3No1 / 69
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
723amnoncommon feces, homo sapiens, female, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 69
819amnon high in scalp compared to skin of cheek in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 70
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in feces homo sapiens adult thailand )2018-11-18v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 70
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
576amnoncommon homo sapiens, mouth mucosa, adult, czech republic, buccal mucosa2020-01-09v3No1 / 71
394amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 71
851amnoncommon homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 71
404amnon high in municipality of santiago de cali bucaramanga barranquilla compared to bogota medellin metropolitan area in feces homo sapiens city adult colombia 2018-11-20v4No1 / 71
870amnoncommon feces, homo sapiens, adult, new zealand, auckland city, third decade human stage, fourth decade human stage2022-02-18v3No1 / 71
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, switzerland2020-09-22v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
114amnoncommon united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 72
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 72
663amnon high in poland compared to switzerland in feces homo sapiens adult 2020-09-22v4No1 / 72
716amnoncommon homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 72
873amnon high in tanzania rural community botswana compared to united states of america commonwealth of pennsylvania urban community in feces homo sapiens adult human adult stage 2022-03-03v1No1 / 73
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in forager chepang compared to tharu agrarian in feces homo sapiens adult nepal himalayas rural community )2019-01-28v4No1 / 73
774amnoncommon homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 74
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
634amnoncommon homo sapiens, saliva, adult, germany, high physical activity, endurance athlete2020-06-16v3No1 / 74
832amnoncommon feces, homo sapiens, adult, nigeria, ibadan2021-09-11v4No1 / 74
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 75
794amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, human immunodeficiency virus infectious disease, municipality of logrono, antiretroviral therapy2021-06-08v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 75
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
322amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 76
663amnon high in switzerland compared to poland in feces homo sapiens adult 2020-09-22v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
556amnoncommon feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 77
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in feces homo sapiens obesity adult estonia high bmi )2021-06-13v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi)2021-06-13v3No1 / 77
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
630amnoncommon feces, homo sapiens, adult, kingdom of spain, madrid2020-06-01v3No1 / 78
529amnoncommon feces, homo sapiens, control, adult, taipei city, taiwan2019-07-18v3No1 / 79
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
880amnoncommon feces, homo sapiens, adult, kingdom of denmark, human adult stage2022-03-12v3No1 / 79
732amnoncommon feces, homo sapiens, adult, kingdom of spain, municipality of reus2021-01-11v3No1 / 79
736amnon high in female adult compared to child age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth > 3mm, deep pocket depth, mouth, periodontitis2018-09-14v4No1 / 80
483amnoncommon united states of america, research facility, adult, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 80
339amnoncommon feces, homo sapiens, adult, india2018-05-24v4No1 / 81
873amnoncommon feces, homo sapiens, adult, africa, rural community, botswana, human adult stage2022-03-03v1No1 / 81
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
678amnon high in control compared to tooth disease black dental staining in homo sapiens adult kingdom of spain supragingival plaque supragingival dental plaque 2028-03-02v3No1 / 81
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
650amnon high in male compared to female in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 82
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
716amnoncommon homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 82
721amnon high in weight loss weight loss diet high protein diet compared to high fiber fiber diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
353amnoncommon in captive Triturus cristatus newts skin (common research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 84
378amnoncommon homo sapiens, dentition, adult, brazil, subgingival plaque, depth < 3mm, shallow pocket depth, mouth, periodontitis2018-09-14v4No1 / 84
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
404amnon high in lean body mass low bmi compared to high bmi in feces homo sapiens city adult colombia 2018-11-20v4No1 / 84
663amnoncommon homo sapiens, lung, bronchoalveolar lavage, adult, poland2020-09-22v4No1 / 84
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
629amnon high in heterosexual msw compared to homosexual msm in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 85
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 85
663amnoncommon feces, homo sapiens, adult, switzerland, low bmi2020-09-22v4No1 / 85
680amnoncommon feces, homo sapiens, obesity, adult, russia, novosibirsk2028-03-04v3No1 / 85
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
353amnoncommon in captive Lissotriton vulgaris newts skin (common research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
277amnon high in nasal cavity pair of nares compared to nasopharynx in homo sapiens adult belgium 2018-01-23v4No1 / 86
806amnoncommon homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 86
806amnon high in oral cavity oral wash compared to palatine tonsil in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 87
892amnoncommon homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child 2-5 year-old child stage in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
404amnon high in female compared to male in feces homo sapiens city adult colombia 2018-11-20v4No1 / 88
884amnoncommon feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v4No1 / 88
711amnon high in child age 8-12 years compared to adult in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 88
805amnoncommon homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 88
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
703amnoncommon homo sapiens, dentition, adult, germany, subgingival plaque, subgingival dental plaque, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
114amnon high in tadpole compared to adult in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 90
137amnon high in juvenile stage compared to adult in feces united states of america state of florida gopherus polyphemus gopher tortoise 2017-04-17v4No1 / 91
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
866amnon high in control compared to crohn's disease crohn's disease in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 92
715amnoncommon homo sapiens, esophagus, adult, australia, oesophageal brush2028-05-22v4No1 / 92
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 92
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 92
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common feces, homo sapiens, obesity, adult, estonia, high bmi, ketogenic diet)2021-06-13v3No1 / 93
836amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, oral lichen planus, china, municipality of shanghai, gingival erosive oral lichen planus2021-09-11v3No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to intestine mucosa digestive tract in research facility mus musculus balb/c adult brazil mouse )2018-04-30v4No1 / 94
348amnoncommon homo sapiens, saliva, adult, italy2018-07-16v4No1 / 94
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
471amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
723amnonhigher in children age 2-4 years compared to mothers ( high in child 2-5 year-old child stage compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
492amnoncommon skin, adult, brazil, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
736amnoncommon feces, homo sapiens, female, adult, tanzania, pemba island2021-01-25v3No1 / 95
678amnoncommon homo sapiens, adult, kingdom of spain, supragingival plaque, supragingival dental plaque, tooth disease, black dental staining2028-03-02v3No1 / 96
278amnoncommon homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 96
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
477amnoncommon feces, homo sapiens, adult, nepal, himalayas, forager, rural community, chepang2019-01-28v4No1 / 97
532amnoncommon feces, homo sapiens, control, adult, czech republic2019-07-21v1No1 / 98
663amnoncommon feces, homo sapiens, adult, poland, low bmi2020-09-22v4No1 / 98
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
554amnoncommon homo sapiens, dentition, adult, egypt, root canal, primary endodontic infection, root canal infection2019-09-10v3No1 / 102
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
877amnoncommon feces, homo sapiens, adult, austria, human early adulthood stage2022-03-08v4No1 / 102
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
693amnoncommon feces, homo sapiens, female, adult, austria, graz city district2028-03-16v1No1 / 104
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
519amnoncommon homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 104
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
663amnoncommon homo sapiens, adult, poland, oral wash, mouth2020-09-22v4No1 / 106
712amnoncommon homo sapiens, saliva, adult, russia, kazan2028-05-21v3No1 / 106
806amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 106
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
328amnoncommon research facility, intestine, mucosa, digestive tract, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 109
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
794amnon high in control compared to hiv infection human immunodeficiency virus infectious disease antiretroviral therapy in feces homo sapiens adult kingdom of spain municipality of logrono 2021-06-08v4No1 / 112
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
873amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of pennsylvania, human adult stage, urban community2022-03-03v1No1 / 112
663amnoncommon feces, homo sapiens, obesity, adult, obese body mass index status, poland2020-09-22v4No1 / 112
594amnoncommon homo sapiens, saliva, adult, cameroon2020-03-12v4No1 / 113
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens nasopharynx adult belgium 2019-12-05v4No1 / 114
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in feces homo sapiens adult taipei city taiwan )2019-07-18v3No1 / 115
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
703amnoncommon homo sapiens, saliva, adult, germany, type 2 diabetes mellitus, city of dresden2028-04-02v3No1 / 115
492amnoncommon skin, adult, germany, toad, bufo bufo, common toad2019-02-27v4No1 / 115
32amnoncommon homo sapiens, saliva, adult, bolivia2016-12-05v4No1 / 116
328amnoncommon feces, research facility, mus musculus, balb/c, adult, brazil, mouse2018-04-30v4No1 / 116
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
743amnoncommon feces, farm, adult, italy, captive, lepus europaeus, european hare2021-02-21v3No1 / 119
113amnon high in adult compared to larval stage in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 120
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
393amnon high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 121
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
294amnon high in control compared to irritable bowel syndrome in feces homo sapiens adult kingdom of spain 2018-02-09v4No1 / 121
581amnoncommon in red swamp crayfish grown in flooded rice field (common rice field, intestine, adult, jiangsu province, fish, china, procambarus clarkii, red swamp crayfish)2020-01-21v3No1 / 122
636amnon high in oropharynx oropharyngeal swab compared to tracheal aspirate trachea endotracheal aspirate in homo sapiens united states of america hospital adult commonwealth of pennsylvania acute respiratory failure respiratory failure 2020-08-08v4No1 / 122
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 123
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
873amnoncommon feces, homo sapiens, adult, tanzania, africa, rural community, human adult stage2022-03-03v1No1 / 125
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 126
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
841amnoncommon homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 129
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens bile gallbladder adult kingdom of spain 2019-07-14v3No1 / 131
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
851amnon high in feces compared to colonic mucosa sigmoid colon sigmoid colon brushing in homo sapiens adult italy milan 2021-12-16v3No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
794amnoncommon feces, homo sapiens, control, adult, kingdom of spain, municipality of logrono2021-06-08v4No1 / 133
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 135
551amnon high in fresh clover diet compared to clover hay diet in rumen adult egypt camel camelus dromedarius 2019-08-27v3No1 / 136
594amnoncommon feces, homo sapiens, adult, rural community, cameroon, ngoantet2020-03-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
330amnon high in adult fourth decade human stage compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 149
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
833amnoncommon feces, homo sapiens, adult, slovak republic, age 60-65 years, normal exercise2021-09-11v1No1 / 154
833amnoncommon feces, homo sapiens, adult, slovak republic, athlete, age 60-65 years, high exercise2021-09-11v1No1 / 154
629amnon high in homosexual msm compared to heterosexual msw in feces homo sapiens adult male kingdom of the netherlands amsterdam 2020-05-31v4No1 / 154
836amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of shanghai2021-09-11v3No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, bile, gallbladder, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
725amnoncommon homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 156
653amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 157
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 159
678amnoncommon homo sapiens, control, adult, kingdom of spain, supragingival plaque, supragingival dental plaque2028-03-02v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
322amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 163
652amnoncommon homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 166
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
529amnoncommon in patients that underwent low anterior resection (common feces, homo sapiens, adult, taipei city, taiwan, low anterior resection)2019-07-18v3No1 / 172
594amnon high in rural community ngoantet compared to city yaounde in feces homo sapiens adult cameroon 2020-03-12v4No1 / 172
851amnon high in colonic mucosa sigmoid colon sigmoid colon brushing compared to feces in homo sapiens adult italy milan 2021-12-16v3No1 / 174
806amnon high in oral cavity oral wash compared to pair of nares external naris in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 178
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
639amnoncommon feces, nature reserve, adult, australia, wild, lepus europaeus, european brown hare2020-08-21v3No1 / 182
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
567amnon high in control compared to sinusitis chronic rhinosinusitis in homo sapiens pair of nares adult belgium anterior naris 2019-12-05v4No1 / 191
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 205
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 206
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
873amnon high in botswana compared to tanzania in feces homo sapiens adult africa rural community human adult stage 2022-03-03v1No1 / 226
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
873amnon high in united states of america commonwealth of pennsylvania urban community compared to tanzania africa rural community botswana in feces homo sapiens adult human adult stage 2022-03-03v1No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to child age 13-15 years 13-year-old human stage 14-year-old human stage in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 232
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to antibiotic vancomycin in feces homo sapiens adult male kingdom of the netherlands amsterdam human adult stage )2022-02-19v3No1 / 232
639amnon high in lepus europaeus european brown hare compared to oryctolagus cuniculus european rabbit in feces nature reserve adult australia wild 2020-08-21v3No1 / 235
492amnoncommon skin, adult, rana catesbeiana, bullfrog, frog, lithobates catesbeianus, japan2019-02-27v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 240
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult skin of cheek china age 25-45 years 2021-07-12v1No1 / 242
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
892amnon high in adult human adult stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 275
137amnon high in adult compared to juvenile stage in feces united states of america state of florida gopherus polyphemus gopher tortoise 2017-04-17v4No1 / 277
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
639amnoncommon feces, nature reserve, adult, oryctolagus cuniculus, australia, wild, european rabbit2020-08-21v3No1 / 280
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
806amnon high in oral cavity oral wash compared to gingiva keratinized gingiva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 288
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
551amnon high in diet clover hay diet compared to fresh clover diet in rumen adult egypt camel camelus dromedarius 2019-08-27v3No1 / 291
653amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 291
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
322amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 320
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
471amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 328
873amnon high in tanzania compared to botswana in feces homo sapiens adult africa rural community human adult stage 2022-03-03v1No1 / 333
532amnon high in control compared to short bowel syndrome in feces homo sapiens adult czech republic 2019-07-21v1No1 / 334
542amnon high in adult age 12-23 years compared to child age 1-7 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 337
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 337
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
551amnoncommon rumen, adult, egypt, camel, camelus dromedarius2019-08-27v3No1 / 370
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
353amnoncommon in wild Triturus cristatus newts skin (common skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
639amnon high in oryctolagus cuniculus european rabbit compared to lepus europaeus european brown hare in feces nature reserve adult australia wild 2020-08-21v3No1 / 480
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
725amnon high in subgingival plaque subgingival dental plaque compared to mouth mucosa buccal mucosa in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 544
471amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 648
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 698
632amnoncommon feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 848
632amnon high in feces compared to caecum cecal content in united states of america research facility adult equus caballus state of texas horse 2020-06-10v4No1 / 897
632amnoncommon united states of america, research facility, caecum, adult, equus caballus, state of texas, cecal content, horse2020-06-10v4No1 / 914
632amnon high in caecum cecal content compared to feces in united states of america research facility adult equus caballus state of texas horse 2020-06-10v4No1 / 943
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org