Summary for ontology term: adult organism

Number of annotations with term: 93

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurovumTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGCGCGCAGGCGGCCTTGTAAGTTGGATGTGAAAGCCTACGGCTCAACCGTAGAACTGCATCCAAAACTACTAGGCTAGAGTGTGGGAGAGGAAGATGGAATTAGTTG0.046512
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGTTTACTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTGATACTGGTAGGCTAGAGTATGGTAGAGGGGGGTAGAATTCATAG0.046512
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTAGTTAAGTCGGATGTGAAAGCCCTGGGCTCAACCTGGGAACTGCATTCGATACTGGCCAACTAGAGTACGAGAGAGGGAGGTAGAATTCCACG0.046512
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurovumTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGCGCGCAGGCGGCCATTTAAGTTGGATGTGAAAGCCTACGGCTCAACCGTAGAACTGCATCCAAAACTATTTGGCTAGAGTGTGGGAGAGGAAGATGGAATTAGTTG0.046512
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGGTCAGTCAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTGATACTGCTAAGCTAGAGTATGGTAGAGGCAAGTGGAATTCCAGG0.046512
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurovumTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGCGCGCAGGCGGCCTTTTAAGTTGGATGTGAAAGCCTATGGCTCAACCATAGAACTGCATCCAAAACTATCAGGCTAGAGTGTGGGAGAGGAAGATGGAATTAGTTG0.046512
d__BacteriaTACGAAGGTCCCGAGCGTTATTCGGAATCACTGGGCGTAAAGAGTACGTAGGCGGTTTGGTAAGTCAGGTGTGAAATCCCGGAGCTCAACTTCGGAACTGCACCCGATACTGCTAGACTGGAGTAATGGAGAGGCAGGTGGAATTCTCGG0.046512
d__Bacteria;p__"Verrucomicrobia"TACGAAGGTCCCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGCGTGGAAAGTCAGGTGTGAAAGCCCGGGGCTCAACCCCGGAATTGCACCCGATACTCCCACGCTAGAGTAATGGAGGGGAGTCTGGAATTTACGG0.046512
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCGGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.034884
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGTGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCTTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTATTAAGCCGCCGAAACTGGAAGACTTGAGTGCAGGAGAGGAAAGTGGAATTCTCAGT0.034884

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.444444
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTATCCAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTAGTAGGCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.333333
d__Bacteria;p__"Proteobacteria"TACGAAGGGTGCTAGCGTTGTTCGGAATTATTGGGCGTAAAGCGTATGTAGGCGGCTTGGTAAGTCAATTGTGAAATCCCTAGGCTCAACCTAGGAACTGCAATCGAAACTGCCTTGCTTGAGTTCGGTAGGGGATAGTGGAACTCCTAG0.333333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__Vibrionaceae;g__VibrioTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAACCGCATTTGAAACTGGCAGGCTAGAGTACTGTAGAGGGGGGTAGAATTTCAGG0.333333
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGATTGTTAAGTCAGATGTGAAATACCCGGGCTCAACCTGGGAATTGCGTTTGATACTGGCAATCTAGAGTATGGTAGAGGGTAGTGGAATTCCTGG0.333333
d__BacteriaTACGTAGGGTGCAAGCGTTAATCGGAATCATTGGGCGTAAAGGGTGCGTAGGCGGATACATAAGCTTGATGTGAAATCCCTGGGCTTAACCTAGGAACTGCATTAAGGACGATGTATCTAGAGTTCGGTAGAGGGGGGTAGAATTCCATG0.333333
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTATTAAGCCAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTGGAACTGATTCGCTAGAGTACAGTAGAGGGTGGTGGAATTTCCAG0.333333
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__CryomorphaceaeTACGGAGGGTGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTATTATAAGTCAGTGGTGAAAGCCTACAGCTTAACTGTAGAACTGCCATTGATACTGTAGTACTTGAGTTCGGTCGAAGTTGGCGGAATATGTAG0.222222
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.222222

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTCTTAAGTGGGATGTGAAATACCCGGGCTCAACCTGGGTGCTGCATTCCAAACTGGGAATCTAGAGTGCAGGAGGGGAGAGTGGAATTCCTAG0.269841
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGTGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCTTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTATTAAGCCGCCGAAACTGGAAGACTTGAGTGCAGGAGAGGAAAGTGGAATTCTCAGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTCTTAAGTGGGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTCCAAACTGGGAATCTAGAGTGCAGGAGGGGAGAGTGGAATTCCTAG0.241379
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACTCTTAAGTCAGTTGTGAAATACGGCGGCTCAACCGTCGGACTGCAGTTGATACTGGGAGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.240000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae"TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTTGGTAAGTCTGATGTGGAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCAGACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT0.230769
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGTCAGGAGTTAAAGGCTACGGCTCAACCGTAGTAAGCTCCTGATACTGTCTGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT0.224390
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGCCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGGAACTGTAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.216216
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae"TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTCTGGTAAGTCTGATGTGGAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCAGACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT0.211180
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTTGGTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCTAACTAGAGTATCGGAGAGGTGGGCGGAACTACAAGT0.203593
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTTGGTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCAAACTAGAGTACTGGAGAGGTAGGCGGAACTACAAGT0.203046

Annotations:

common ontology terms
term enrichment score
TermScore
adult organism1.127517
edmonton0.293578
canis latrans0.293578
female organism0.238754
dog0.207792
age 4 years0.205128
canis lupus familiaris0.192771
beagle dog0.186047
LOWER IN adult organism0.167598
equus caballus0.163265
horse0.163265
ria formosa0.146789
open water pond0.146789
cayo santiago0.146789
puerto rico0.146789
indian rhesus macaque0.146789
rectal swab0.141593
portuguese republic0.136752
state of illinois0.135593
austria0.135593
fish farm0.120301
age 90 weeks0.114286
age 10-15 years0.114286
chest0.114286
macaca mulatta0.113475
wolf0.102564
commonwealth of pennsylvania0.096970
pregnancy0.084656
sparus aurata0.079208
seabream0.079208
dicentrarchus labrax0.079208
seabass0.079208
opatija0.079208
anisakis pegreffii0.079208
dolphin parasite0.079208
captive0.077670
skin0.077519
age 3 years0.076190
LOWER IN age 3 years0.076190
croatia0.076190
sus scrofa0.072398
pig0.072398
subgingival dental plaque0.070796
gill0.070796
LOWER IN juvenile organism0.068376
juvenile organism0.068376
wild0.067086
supragingival dental plaque0.066116
colitis0.065574
canada0.064909
chicken0.063492
research facility0.063042
descending colon0.062500
mouth mucosa0.062016
gallus gallus0.061538
age 2-7 years0.060606
ascending colon0.060606
early pregnancy0.060606
late pregnancy0.060606
salmonella gastroenteritis0.060606
salmonellosis0.060606
supragingival plaque0.060150
anatomical space0.059259
antibiotic0.057803
dentition0.057762
jejunum0.055556
french republic0.055172
subgingival plaque0.053691
oral cavity0.053691
male0.051530
canis lupus0.048193
saliva0.048077
feces0.048037
duodenum0.047619
bologna0.042105
LOWER IN age 1-2 years0.041237
age 1-2 years0.041237
uterine tube infundibulum0.041237
LOWER IN age 10-15 years0.041237
age < 1 year0.040404
LOWER IN age &lt; 1 year0.040404
shanxi province0.040404
age 1 year0.039604
LOWER IN age 1 year0.039604
LOWER IN wolf0.039604
LOWER IN subgingival dental plaque0.038835
LOWER IN supragingival dental plaque0.037383
cloaca0.036036
LOWER IN supragingival plaque0.035398
vagina0.034783
LOWER IN subgingival plaque0.033058
LOWER IN colitis0.032520
ileum0.032000
united states of america0.030888
italy0.030075
LOWER IN dentition0.028777
LOWER IN dog0.028777
infant0.027586
LOWER IN infant0.027586
LOWER IN canis lupus0.027586
Fraction of dbbact annotations with this term covered by the query
TermScore
adult organism1.500000
4-year-old human stage1.000000
edmonton1.000000
canis latrans1.000000
descending colon1.000000
LOWER IN descending colon1.000000
bologna1.000000
LOWER IN adult organism0.625000
age 4 years0.500000
age 2-7 years0.500000
LOWER IN age 1-2 years0.500000
sparus aurata0.500000
ria formosa0.500000
open water pond0.500000
seabream0.500000
age 1-2 years0.500000
dicentrarchus labrax0.500000
seabass0.500000
ascending colon0.500000
LOWER IN ascending colon0.500000
early pregnancy0.500000
LOWER IN late pregnancy0.500000
late pregnancy0.500000
LOWER IN early pregnancy0.500000
first pregnancy0.500000
LOWER IN multiple pregnancies0.500000
multiple pregnancies0.500000
LOWER IN first pregnancy0.500000
LOWER IN salmonella gastroenteritis0.500000
LOWER IN salmonellosis0.500000
salmonella gastroenteritis0.500000
salmonellosis0.500000
LOWER IN puppy0.500000
puppy0.500000
LOWER IN age 2-7 years0.500000
age 90 weeks0.500000
uterine tube infundibulum0.500000
LOWER IN age 10-15 years0.500000
cayo santiago0.500000
puerto rico0.500000
indian rhesus macaque0.500000
age 10-15 years0.500000
opatija0.500000
anisakis pegreffii0.500000
dolphin parasite0.500000
chest0.500000
rectal swab0.400000
beagle dog0.333333
age 3 years0.333333
portuguese republic0.333333
LOWER IN age 3 years0.333333
age < 1 year0.333333
LOWER IN age &lt; 1 year0.333333
croatia0.333333
shanxi province0.333333
age 1 year0.250000
LOWER IN age 1 year0.250000
LOWER IN age 8 weeks0.250000
age 8 weeks0.250000
LOWER IN wolf0.250000
wolf0.250000
female organism0.230769
equus caballus0.222222
horse0.222222
subgingival dental plaque0.200000
LOWER IN subgingival dental plaque0.200000
fish farm0.200000
gill0.200000
jejunum0.200000
LOWER IN jejunum0.200000
dog0.173913
LOWER IN juvenile organism0.166667
juvenile organism0.166667
macaca mulatta0.166667
canis lupus familiaris0.153846
state of illinois0.142857
supragingival dental plaque0.142857
LOWER IN supragingival dental plaque0.142857
austria0.142857
commonwealth of pennsylvania0.111111
cloaca0.111111
mouth mucosa0.111111
supragingival plaque0.100000
LOWER IN supragingival plaque0.100000
duodenum0.090909
LOWER IN duodenum0.090909
vagina0.090909
pregnancy0.083333
french republic0.076923
LOWER IN female organism0.076923
subgingival plaque0.071429
LOWER IN subgingival plaque0.071429
oral cavity0.071429
larval stage0.071429
LOWER IN larval stage0.071429
LOWER IN colitis0.066667
colitis0.066667
ileum0.062500
sus scrofa0.062500
pig0.062500
Fraction of annotations for the query sequences containing the term
TermScore
adult organism0.903226
research facility0.430108
feces0.419355
united states of america0.333333
canis lupus familiaris0.258065
dog0.258065
female organism0.247312
male0.172043
canada0.172043
wild0.172043
edmonton0.172043
canis latrans0.172043
coyote0.172043
state of illinois0.129032
beagle dog0.129032
age 4 years0.129032
anatomical space0.129032
equus caballus0.129032
horse0.129032
austria0.129032
captive0.129032
skin0.107527
LOWER IN adult organism0.096774
dentition0.086022
rectal swab0.086022
fish farm0.086022
portuguese republic0.086022
ria formosa0.086022
open water pond0.086022
pregnancy0.086022
sus scrofa0.086022
commonwealth of pennsylvania0.086022
pig0.086022
china0.086022
macaca mulatta0.086022
cayo santiago0.086022
puerto rico0.086022
indian rhesus macaque0.086022
colitis0.064516
gallus gallus0.064516
chicken0.064516
age 90 weeks0.064516
age 10-15 years0.064516
canis lupus0.064516
wolf0.064516
chest0.064516
saliva0.053763
antibiotic0.053763
subgingival plaque0.043011
subgingival dental plaque0.043011
supragingival plaque0.043011
supragingival dental plaque0.043011
french republic0.043011
age 3 years0.043011
LOWER IN juvenile organism0.043011
gill0.043011
sparus aurata0.043011
seabream0.043011
juvenile organism0.043011
LOWER IN age 3 years0.043011
dicentrarchus labrax0.043011
seabass0.043011
control0.043011
oral cavity0.043011
mouth mucosa0.043011
croatia0.043011
opatija0.043011
anisakis pegreffii0.043011
dolphin parasite0.043011
age 2-7 years0.032258
ascending colon0.032258
descending colon0.032258
duodenum0.032258
jejunum0.032258
early pregnancy0.032258
late pregnancy0.032258
antibiotics induced colitis0.032258
salmonella gastroenteritis0.032258
salmonellosis0.032258
adult0.032258
LOWER IN supragingival plaque0.021505
LOWER IN supragingival dental plaque0.021505
LOWER IN subgingival plaque0.021505
LOWER IN subgingival dental plaque0.021505
LOWER IN saliva0.021505
LOWER IN dentition0.021505
LOWER IN age 1-2 years0.021505
age 1-2 years0.021505
age 1 year0.021505
LOWER IN age 1 year0.021505
caecum0.021505
ileum0.021505
LOWER IN colitis0.021505
LOWER IN control0.021505
cloaca0.021505
uterine tube infundibulum0.021505
vagina0.021505
infant0.021505
age < 1 year0.021505
LOWER IN age 10-15 years0.021505
Exp. ID User ID Description Date Region Flag Sequences
902amnondominant feces, control, united states of america, equus caballus, horse, adult organism2022-05-02v4No1 / 3
908amnondominant feces, research facility, equus caballus, horse, adult organism, china, shanxi province, guanzhong horse2022-05-19v4No1 / 4
795amnoncommon research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 6
670amnondominant adult, adult organism, croatia, opatija, anisakis pegreffii, dolphin parasite2020-09-26v4No1 / 6
879amnon high in canis lupus familiaris dog compared to canis lupus wolf in research facility skin austria captive chest adult organism 2022-03-12v4No1 / 7
879amnon high in canis lupus wolf compared to canis lupus familiaris dog in research facility skin austria captive chest adult organism 2022-03-12v4No1 / 8
898amnondominant jejunum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 11
898amnon high in duodenum jejunum compared to feces ascending colon descending colon in male canada wild adult organism edmonton canis latrans coyote 2022-04-19v4No1 / 11
670amnon high in larval stage compared to adult adult organism in croatia opatija anisakis pegreffii dolphin parasite 2020-09-26v4No1 / 11
879amnondominant research facility, skin, canis lupus familiaris, austria, dog, captive, chest, adult organism2022-03-12v4No1 / 11
898amnoncommon duodenum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 12
898amnondominant duodenum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 12
879amnondominant research facility, skin, austria, captive, chest, adult organism, canis lupus, wolf2022-03-12v4No1 / 12
902amnondominant feces, united states of america, antibiotic, salmonella gastroenteritis, equus caballus, horse, adult organism, salmonellosis2022-05-02v4No1 / 13
795amnoncommon research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 13
770amnondominant feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 14
898amnoncommon jejunum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 15
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 16
902amnondominant feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 16
898amnondominant male, canada, wild, anatomical space, ascending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 17
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 17
898amnondominant feces, male, canada, wild, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 18
898amnondominant male, canada, wild, anatomical space, descending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 18
898amnondominant ileum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 18
795amnondominant research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 18
770amnondominant oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 18
898amnondominant caecum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 19
795amnoncommon research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 19
826amnondominant united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, subgingival plaque, dog, female organism, adult organism, subgingival dental plaque, age 4 years2021-08-22v4No1 / 20
766amnondominant n in feces of dog females within 24h after parturition (dominant feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 20
879amnondominant feces, research facility, austria, captive, adult organism, canis lupus, wolf2022-03-12v4No1 / 20
881amnondominant feces, canis lupus familiaris, italy, dog, adult organism, bologna2022-03-12v3No1 / 20
879amnondominant feces, research facility, canis lupus familiaris, austria, dog, captive, adult organism2022-03-12v4No1 / 21
795amnondominant research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 22
670amnon high in adult adult organism compared to larval stage in croatia opatija anisakis pegreffii dolphin parasite 2020-09-26v4No1 / 22
795amnondominant research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 23
826amnondominant united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, dog, supragingival plaque, female organism, adult organism, supragingival dental plaque, age 4 years2021-08-22v4No1 / 24
898amnoncommon ileum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 24
670amnoncommon adult, adult organism, croatia, opatija, anisakis pegreffii, dolphin parasite2020-09-26v4No1 / 24
826amnondominant united states of america, research facility, saliva, canis lupus familiaris, state of illinois, beagle dog, dog, female organism, adult organism, age 4 years2021-08-22v4No1 / 26
782amnon high in adult organism age 3 years compared to juvenile organism age 1-2 years in fish farm skin portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 27
766amnon high in age 8 weeks puppy compared to female organism adult organism age 2-7 years in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 27
782amnon high in juvenile organism age 1-2 years compared to adult organism age 3 years in fish farm skin portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 41
881amnoncommon feces, canis lupus familiaris, italy, dog, adult organism, bologna2022-03-12v3No1 / 41
782amnon high in juvenile organism age 1-2 years compared to adult organism age 3 years in fish farm gill portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 43
898amnoncommon male, canada, wild, anatomical space, descending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 44
879amnon high in canis lupus familiaris dog compared to canis lupus wolf in feces research facility austria captive adult organism 2022-03-12v4No1 / 45
898amnoncommon male, canada, wild, anatomical space, ascending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 47
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 49
898amnoncommon feces, male, canada, wild, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 50
766amnoncommon in feces of dog females within 24h after parturition (common feces, canis lupus familiaris, french republic, dog, female organism, adult organism, rectal swab, age 2-7 years)2021-04-12v4No1 / 55
898amnoncommon caecum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 55
782amnon high in adult organism age 3 years compared to juvenile organism age 1-2 years in fish farm gill portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 66
782amnon high in juvenile organism age 1 year compared to adult organism age 3 years in fish farm skin portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 67
879amnon high in canis lupus wolf compared to canis lupus familiaris dog in feces research facility austria captive adult organism 2022-03-12v4No1 / 67
902amnoncommon feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 68
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
879amnoncommon feces, research facility, canis lupus familiaris, austria, dog, captive, adult organism2022-03-12v4No1 / 72
879amnoncommon feces, research facility, austria, captive, adult organism, canis lupus, wolf2022-03-12v4No1 / 73
898amnon high in feces ascending colon descending colon compared to duodenum jejunum in male canada wild adult organism edmonton canis latrans coyote 2022-04-19v4No1 / 78
826amnon high in supragingival plaque supragingival dental plaque compared to subgingival plaque subgingival dental plaque in united states of america research facility dentition canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 82
816amnon high in early pregnancy compared to late pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 83
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 84
782amnon high in juvenile organism age 1 year compared to adult organism age 3 years in fish farm gill portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 87
826amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 95
766amnon high in female organism adult organism age 2-7 years compared to age 8 weeks puppy in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 101
826amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 102
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
782amnon high in adult organism age 3 years compared to juvenile organism age 1 year in fish farm gill portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 147
826amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 150
826amnon high in subgingival plaque subgingival dental plaque compared to supragingival plaque supragingival dental plaque in united states of america research facility dentition canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 154
902amnoncommon feces, united states of america, antibiotic, salmonella gastroenteritis, equus caballus, horse, adult organism, salmonellosis2022-05-02v4No1 / 158
892amnon high in child 4-year-old human stage compared to adult organism human adult stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 180
782amnon high in adult organism age 3 years compared to juvenile organism age 1 year in fish farm skin portuguese republic dicentrarchus labrax ria formosa open water pond seabass 2021-05-07v4No1 / 183
826amnoncommon united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, dog, supragingival plaque, female organism, adult organism, supragingival dental plaque, age 4 years2021-08-22v4No1 / 195
826amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 211
826amnoncommon united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, subgingival plaque, dog, female organism, adult organism, subgingival dental plaque, age 4 years2021-08-22v4No1 / 215
902amnon high in salmonella gastroenteritis salmonellosis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 226
826amnoncommon united states of america, research facility, saliva, canis lupus familiaris, state of illinois, beagle dog, dog, female organism, adult organism, age 4 years2021-08-22v4No1 / 233
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
879amnoncommon research facility, skin, austria, captive, chest, adult organism, canis lupus, wolf2022-03-12v4No1 / 320
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
902amnoncommon feces, control, united states of america, equus caballus, horse, adult organism2022-05-02v4No1 / 350
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 364
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
879amnoncommon research facility, skin, canis lupus familiaris, austria, dog, captive, chest, adult organism2022-03-12v4No1 / 399
908amnoncommon feces, research facility, equus caballus, horse, adult organism, china, shanxi province, guanzhong horse2022-05-19v4No1 / 567
902amnon high in control compared to salmonella gastroenteritis salmonellosis in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 679
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
902amnon high in control compared to colitis antibiotic colitis antibiotics induced colitis in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 1755

Problems / suggestions? Please email info AT dbbact DOT org