Summary for ontology term: adult organism

Number of annotations with term: 93

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurovumTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGCGCGCAGGCGGCCTTGTAAGTTGGATGTGAAAGCCTACGGCTCAACCGTAGAACTGCATCCAAAACTACTAGGCTAGAGTGTGGGAGAGGAAGATGGAATTAGTTG0.047059
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGTTTACTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTGATACTGGTAGGCTAGAGTATGGTAGAGGGGGGTAGAATTCATAG0.047059
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTAGTTAAGTCGGATGTGAAAGCCCTGGGCTCAACCTGGGAACTGCATTCGATACTGGCCAACTAGAGTACGAGAGAGGGAGGTAGAATTCCACG0.047059
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurovumTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGCGCGCAGGCGGCCATTTAAGTTGGATGTGAAAGCCTACGGCTCAACCGTAGAACTGCATCCAAAACTATTTGGCTAGAGTGTGGGAGAGGAAGATGGAATTAGTTG0.047059
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGGTCAGTCAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTGATACTGCTAAGCTAGAGTATGGTAGAGGCAAGTGGAATTCCAGG0.047059
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__SulfurovumTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGCGCGCAGGCGGCCTTTTAAGTTGGATGTGAAAGCCTATGGCTCAACCATAGAACTGCATCCAAAACTATCAGGCTAGAGTGTGGGAGAGGAAGATGGAATTAGTTG0.047059
d__BacteriaTACGAAGGTCCCGAGCGTTATTCGGAATCACTGGGCGTAAAGAGTACGTAGGCGGTTTGGTAAGTCAGGTGTGAAATCCCGGAGCTCAACTTCGGAACTGCACCCGATACTGCTAGACTGGAGTAATGGAGAGGCAGGTGGAATTCTCGG0.047059
d__Bacteria;p__"Verrucomicrobia"TACGAAGGTCCCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGCGTGGAAAGTCAGGTGTGAAAGCCCGGGGCTCAACCCCGGAATTGCACCCGATACTCCCACGCTAGAGTAATGGAGGGGAGTCTGGAATTTACGG0.047059
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCGGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.035294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGTGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCTTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTATTAAGCCGCCGAAACTGGAAGACTTGAGTGCAGGAGAGGAAAGTGGAATTCTCAGT0.035294

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.400000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTATCCAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTAGTAGGCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.300000
d__Bacteria;p__"Proteobacteria"TACGAAGGGTGCTAGCGTTGTTCGGAATTATTGGGCGTAAAGCGTATGTAGGCGGCTTGGTAAGTCAATTGTGAAATCCCTAGGCTCAACCTAGGAACTGCAATCGAAACTGCCTTGCTTGAGTTCGGTAGGGGATAGTGGAACTCCTAG0.300000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__Vibrionaceae;g__VibrioTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAACCGCATTTGAAACTGGCAGGCTAGAGTACTGTAGAGGGGGGTAGAATTTCAGG0.300000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGATTGTTAAGTCAGATGTGAAATACCCGGGCTCAACCTGGGAATTGCGTTTGATACTGGCAATCTAGAGTATGGTAGAGGGTAGTGGAATTCCTGG0.300000
d__BacteriaTACGTAGGGTGCAAGCGTTAATCGGAATCATTGGGCGTAAAGGGTGCGTAGGCGGATACATAAGCTTGATGTGAAATCCCTGGGCTTAACCTAGGAACTGCATTAAGGACGATGTATCTAGAGTTCGGTAGAGGGGGGTAGAATTCCATG0.300000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTATTAAGCCAGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTTGGAACTGATTCGCTAGAGTACAGTAGAGGGTGGTGGAATTTCCAG0.300000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__CryomorphaceaeTACGGAGGGTGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTATTATAAGTCAGTGGTGAAAGCCTACAGCTTAACTGTAGAACTGCCATTGATACTGTAGTACTTGAGTTCGGTCGAAGTTGGCGGAATATGTAG0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.200000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTCTTAAGTGGGATGTGAAATACCCGGGCTCAACCTGGGTGCTGCATTCCAAACTGGGAATCTAGAGTGCAGGAGGGGAGAGTGGAATTCCTAG0.272000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGTGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCTTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTATTAAGCCGCCGAAACTGGAAGACTTGAGTGCAGGAGAGGAAAGTGGAATTCTCAGT0.251572
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTCTTAAGTGGGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTCCAAACTGGGAATCTAGAGTGCAGGAGGGGAGAGTGGAATTCCTAG0.243478
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACTCTTAAGTCAGTTGTGAAATACGGCGGCTCAACCGTCGGACTGCAGTTGATACTGGGAGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.241611
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae"TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTTGGTAAGTCTGATGTGGAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCAGACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT0.233010
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGTCAGGAGTTAAAGGCTACGGCTCAACCGTAGTAAGCTCCTGATACTGTCTGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT0.225490
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGCCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGGAACTGTAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.217391
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae"TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTCTGGTAAGTCTGATGTGGAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCAGACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT0.212500
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTTGGTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCTAACTAGAGTATCGGAGAGGTGGGCGGAACTACAAGT0.204819
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTTGGTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCAAACTAGAGTACTGGAGAGGTAGGCGGAACTACAAGT0.204082

Annotations:

common ontology terms
term enrichment score
TermScore
adult organism0.879581
coyote0.256000
canis latrans0.256000
edmonton0.256000
female organism0.229617
age 4 years0.205128
dog0.192771
beagle dog0.186047
canis lupus familiaris0.179775
LOWER IN adult organism0.152284
horse0.150943
equus caballus0.150943
open water pond0.146789
ria formosa0.146789
indian rhesus macaque0.146789
cayo santiago0.146789
rectal swab0.141593
portuguese republic0.136752
puerto rico0.128000
state of illinois0.126984
fish farm0.120301
austria0.119403
age 90 weeks0.114286
age 10-15 years0.114286
chest0.108108
macaca mulatta0.107383
commonwealth of pennsylvania0.092486
wolf0.088889
pregnancy0.081218
sparus aurata0.079208
seabream0.079208
dicentrarchus labrax0.079208
seabass0.079208
dolphin parasite0.079208
opatija0.079208
anisakis pegreffii0.079208
age 3 years0.076190
LOWER IN age 3 years0.076190
croatia0.076190
skin0.076046
sus scrofa0.072398
pig0.072398
gill0.070796
captive0.069565
subgingival dental plaque0.068376
LOWER IN juvenile organism0.066116
juvenile organism0.066116
supragingival dental plaque0.064000
wild0.062868
age 2-7 years0.060606
descending colon0.060606
early pregnancy0.060606
late pregnancy0.060606
antibiotics induced colitis0.060606
mouth mucosa0.060150
chicken0.059701
ascending colon0.058824
salmonella gastroenteritis0.058824
supragingival plaque0.058394
gallus gallus0.057971
dentition0.057762
research facility0.057595
salmonellosis0.057143
canada0.055846
antibiotic0.054645
anatomical space0.054422
french republic0.053691
jejunum0.052632
subgingival plaque0.052288
oral cavity0.052288
colitis0.051948
saliva0.047506
duodenum0.045455
canis lupus0.043956
feces0.043947
uterine tube infundibulum0.041237
LOWER IN age 10-15 years0.041237
guanzhong horse0.041237
bologna0.041237
LOWER IN age 1-2 years0.040404
age 1-2 years0.040404
age < 1 year0.040404
LOWER IN age &lt; 1 year0.040404
male0.040151
shanxi province0.039604
age 1 year0.038835
LOWER IN age 1 year0.038835
LOWER IN subgingival dental plaque0.038095
LOWER IN wolf0.037383
LOWER IN supragingival dental plaque0.036697
cloaca0.036036
LOWER IN supragingival plaque0.034783
vagina0.034783
LOWER IN subgingival plaque0.032520
ileum0.031008
united states of america0.029520
italy0.029197
LOWER IN dentition0.028777
LOWER IN colitis0.028777
LOWER IN dog0.027586
Fraction of dbbact annotations with this term covered by the query
TermScore
adult organism0.857143
age 4 years0.500000
age 2-7 years0.500000
sparus aurata0.500000
seabream0.500000
open water pond0.500000
ria formosa0.500000
dicentrarchus labrax0.500000
seabass0.500000
4-year-old human stage0.500000
coyote0.500000
canis latrans0.500000
edmonton0.500000
descending colon0.500000
LOWER IN descending colon0.500000
LOWER IN late pregnancy0.500000
early pregnancy0.500000
LOWER IN early pregnancy0.500000
late pregnancy0.500000
LOWER IN multiple pregnancies0.500000
first pregnancy0.500000
LOWER IN first pregnancy0.500000
multiple pregnancies0.500000
LOWER IN antibiotics induced colitis0.500000
antibiotics induced colitis0.500000
LOWER IN puppy0.500000
LOWER IN age 2-7 years0.500000
puppy0.500000
age 90 weeks0.500000
uterine tube infundibulum0.500000
LOWER IN age 10-15 years0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
age 10-15 years0.500000
dolphin parasite0.500000
opatija0.500000
anisakis pegreffii0.500000
guanzhong horse0.500000
bologna0.500000
rectal swab0.400000
LOWER IN adult organism0.357143
beagle dog0.333333
LOWER IN age 1-2 years0.333333
age 3 years0.333333
portuguese republic0.333333
LOWER IN age 3 years0.333333
age 1-2 years0.333333
ascending colon0.333333
LOWER IN ascending colon0.333333
LOWER IN salmonella gastroenteritis0.333333
salmonella gastroenteritis0.333333
age < 1 year0.333333
LOWER IN age &lt; 1 year0.333333
croatia0.333333
chest0.333333
LOWER IN salmonellosis0.250000
salmonellosis0.250000
LOWER IN age 8 weeks0.250000
age 8 weeks0.250000
puerto rico0.250000
shanxi province0.250000
female organism0.214286
gill0.200000
fish farm0.200000
age 1 year0.200000
LOWER IN age 1 year0.200000
horse0.181818
equus caballus0.181818
subgingival dental plaque0.166667
LOWER IN subgingival dental plaque0.166667
dog0.153846
LOWER IN juvenile organism0.142857
juvenile organism0.142857
jejunum0.142857
LOWER IN jejunum0.142857
macaca mulatta0.142857
LOWER IN wolf0.142857
wolf0.142857
canis lupus familiaris0.137931
state of illinois0.125000
supragingival dental plaque0.125000
LOWER IN supragingival dental plaque0.125000
cloaca0.111111
austria0.111111
commonwealth of pennsylvania0.100000
mouth mucosa0.100000
supragingival plaque0.090909
LOWER IN supragingival plaque0.090909
vagina0.090909
duodenum0.076923
LOWER IN duodenum0.076923
pregnancy0.076923
french republic0.071429
LOWER IN female organism0.071429
larval stage0.071429
LOWER IN larval stage0.071429
subgingival plaque0.066667
LOWER IN subgingival plaque0.066667
oral cavity0.066667
sus scrofa0.062500
Fraction of annotations for the query sequences containing the term
TermScore
adult organism0.903226
research facility0.430108
feces0.419355
united states of america0.333333
dog0.258065
canis lupus familiaris0.258065
female organism0.247312
wild0.172043
coyote0.172043
canis latrans0.172043
male0.172043
edmonton0.172043
canada0.172043
state of illinois0.129032
age 4 years0.129032
beagle dog0.129032
anatomical space0.129032
horse0.129032
equus caballus0.129032
captive0.129032
austria0.129032
skin0.107527
LOWER IN adult organism0.096774
dentition0.086022
rectal swab0.086022
open water pond0.086022
ria formosa0.086022
portuguese republic0.086022
fish farm0.086022
commonwealth of pennsylvania0.086022
pregnancy0.086022
sus scrofa0.086022
pig0.086022
china0.086022
indian rhesus macaque0.086022
macaca mulatta0.086022
cayo santiago0.086022
puerto rico0.086022
colitis0.064516
age 90 weeks0.064516
gallus gallus0.064516
chicken0.064516
age 10-15 years0.064516
canis lupus0.064516
wolf0.064516
chest0.064516
saliva0.053763
antibiotic0.053763
subgingival plaque0.043011
subgingival dental plaque0.043011
supragingival plaque0.043011
supragingival dental plaque0.043011
french republic0.043011
age 3 years0.043011
LOWER IN juvenile organism0.043011
gill0.043011
sparus aurata0.043011
seabream0.043011
LOWER IN age 3 years0.043011
juvenile organism0.043011
dicentrarchus labrax0.043011
seabass0.043011
control0.043011
mouth mucosa0.043011
oral cavity0.043011
dolphin parasite0.043011
croatia0.043011
opatija0.043011
anisakis pegreffii0.043011
age 2-7 years0.032258
ascending colon0.032258
descending colon0.032258
duodenum0.032258
jejunum0.032258
early pregnancy0.032258
late pregnancy0.032258
antibiotics induced colitis0.032258
salmonella gastroenteritis0.032258
salmonellosis0.032258
adult0.032258
LOWER IN supragingival plaque0.021505
LOWER IN supragingival dental plaque0.021505
LOWER IN subgingival plaque0.021505
LOWER IN subgingival dental plaque0.021505
LOWER IN saliva0.021505
LOWER IN dentition0.021505
LOWER IN age 1-2 years0.021505
age 1-2 years0.021505
age 1 year0.021505
LOWER IN age 1 year0.021505
caecum0.021505
ileum0.021505
LOWER IN colitis0.021505
LOWER IN control0.021505
cloaca0.021505
uterine tube infundibulum0.021505
vagina0.021505
LOWER IN age 10-15 years0.021505
age < 1 year0.021505
infant0.021505
Exp. ID User ID Description Date Region Flag Sequences
902amnondominant adult organism, horse, equus caballus, united states of america, control, feces2022-05-02v4No1 / 3
908amnondominant guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 4
795amnoncommon uterine tube infundibulum, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 6
670amnondominant dolphin parasite, croatia, opatija, anisakis pegreffii, adult organism, adult2020-09-26v4No1 / 6
879amnon high in canis lupus familiaris dog compared to canis lupus wolf in chest skin adult organism captive austria research facility 2022-03-12v4No1 / 7
879amnon high in wolf canis lupus compared to dog canis lupus familiaris in adult organism chest captive austria skin research facility 2022-03-12v4No1 / 8
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, jejunum2022-04-19v4No1 / 11
898amnon high in jejunum duodenum compared to descending colon ascending colon feces in coyote canis latrans edmonton adult organism wild canada male 2022-04-19v4No1 / 11
670amnon high in larval stage compared to adult adult organism in dolphin parasite croatia opatija anisakis pegreffii 2020-09-26v4No1 / 11
879amnondominant adult organism, chest, captive, dog, austria, canis lupus familiaris, skin, research facility2022-03-12v4No1 / 11
898amnoncommon duodenum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 12
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, duodenum2022-04-19v4No1 / 12
879amnondominant wolf, canis lupus, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 12
902amnondominant salmonellosis, adult organism, horse, equus caballus, salmonella gastroenteritis, antibiotic, united states of america, feces2022-05-02v4No1 / 13
795amnoncommon vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 13
770amnondominant age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 14
898amnoncommon jejunum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 15
816amnondominant late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 16
902amnondominant antibiotics induced colitis, colitis, adult organism, horse, equus caballus, antibiotic, colitis, united states of america, feces2022-05-02v4No1 / 16
898amnondominant coyote, canis latrans, edmonton, adult organism, ascending colon, anatomical space, wild, canada, male2022-04-19v4No1 / 17
816amnondominant early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 17
898amnondominant coyote, canis latrans, edmonton, adult organism, wild, canada, male, feces2022-04-19v4No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, descending colon, anatomical space, wild, canada, male2022-04-19v4No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, ileum2022-04-19v4No1 / 18
795amnondominant cloaca, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 18
770amnondominant age 10-15 years, adult organism, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male, caecum2022-04-19v4No1 / 19
795amnoncommon cloaca, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 19
826amnondominant age 4 years, subgingival dental plaque, adult organism, female organism, dog, subgingival plaque, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 20
766amnondominant n in feces of dog females within 24h after parturition (dominant french republic, age 2-7 years, adult organism, female organism, rectal swab, feces, canis lupus familiaris, dog)2021-04-12v4No1 / 20
879amnondominant wolf, canis lupus, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 20
881amnondominant bologna, adult organism, dog, italy, canis lupus familiaris, feces2022-03-12v3No1 / 20
879amnondominant adult organism, captive, dog, austria, canis lupus familiaris, research facility, feces2022-03-12v4No1 / 21
795amnondominant uterine tube infundibulum, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 22
670amnon high in adult adult organism compared to larval stage in dolphin parasite croatia opatija anisakis pegreffii 2020-09-26v4No1 / 22
795amnondominant vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 23
826amnondominant age 4 years, supragingival dental plaque, adult organism, female organism, supragingival plaque, dog, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 24
898amnoncommon ileum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 24
670amnoncommon dolphin parasite, croatia, opatija, anisakis pegreffii, adult organism, adult2020-09-26v4No1 / 24
826amnondominant age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, saliva, research facility, united states of america2021-08-22v4No1 / 26
782amnon high in age 3 years adult organism compared to age 1-2 years juvenile organism in skin sparus aurata seabream open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 27
766amnon high in age 8 weeks puppy compared to age 2-7 years female organism adult organism in french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 27
782amnon high in age 1-2 years juvenile organism compared to age 3 years adult organism in skin sparus aurata seabream open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 41
881amnoncommon bologna, adult organism, italy, dog, canis lupus familiaris, feces2022-03-12v3No1 / 41
782amnon high in age 1-2 years juvenile organism compared to age 3 years adult organism in gill sparus aurata seabream open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 43
898amnoncommon descending colon, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 44
879amnon high in dog canis lupus familiaris compared to wolf canis lupus in captive adult organism austria research facility feces 2022-03-12v4No1 / 45
898amnoncommon anatomical space, ascending colon, coyote, canis latrans, edmonton, adult organism, wild, canada, male2022-04-19v4No1 / 47
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in mouth mucosa oral cavity indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 49
898amnoncommon wild, feces, coyote, canis latrans, adult organism, male, edmonton, canada2022-04-19v4No1 / 50
766amnoncommon in feces of dog females within 24h after parturition (common french republic, age 2-7 years, adult organism, female organism, rectal swab, feces, canis lupus familiaris, dog)2021-04-12v4No1 / 55
898amnoncommon caecum, coyote, canis latrans, edmonton, adult organism, anatomical space, wild, canada, male2022-04-19v4No1 / 55
782amnon high in age 3 years adult organism compared to age 1-2 years juvenile organism in gill sparus aurata seabream open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 66
782amnon high in age 1 year juvenile organism compared to age 3 years adult organism in skin dicentrarchus labrax seabass open water pond ria formosa portuguese republic fish farm 2021-05-07v4No1 / 67
879amnon high in canis lupus wolf compared to dog canis lupus familiaris in adult organism captive austria research facility feces 2022-03-12v4No1 / 67
902amnoncommon antibiotics induced colitis, antibiotic, colitis, colitis, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 68
770amnoncommon age 10-15 years, adult organism, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 68
879amnoncommon canis lupus familiaris, dog, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 72
879amnoncommon canis lupus, wolf, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 73
898amnon high in descending colon ascending colon feces compared to jejunum duodenum in coyote canis latrans edmonton adult organism wild canada male 2022-04-19v4No1 / 78
826amnon high in supragingival plaque supragingival dental plaque compared to subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v4No1 / 82
816amnon high in early pregnancy compared to late pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 83
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in puerto rico cayo santiago macaca mulatta indian rhesus macaque oral cavity mouth mucosa 2021-04-19v4No1 / 84
782amnon high in age 1 year juvenile organism compared to age 3 years adult organism in dicentrarchus labrax seabass gill open water pond ria formosa portuguese republic fish farm 2021-05-07v4No1 / 87
826amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 95
766amnon high in age 2-7 years female organism adult organism compared to age 8 weeks puppy in french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 101
826amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 102
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 111
782amnon high in age 3 years adult organism compared to age 1 year juvenile organism in dicentrarchus labrax seabass gill open water pond ria formosa portuguese republic fish farm 2021-05-07v4No1 / 147
826amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 150
826amnon high in subgingival plaque subgingival dental plaque compared to supragingival plaque supragingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v4No1 / 154
902amnoncommon salmonella gastroenteritis, salmonellosis, adult organism, horse, equus caballus, antibiotic, united states of america, feces2022-05-02v4No1 / 158
892amnon high in 4-year-old human stage child compared to human adult stage adult organism in saliva united states of america homo sapiens 2022-04-07v4No1 / 180
782amnon high in age 3 years adult organism compared to age 1 year juvenile organism in skin dicentrarchus labrax seabass open water pond ria formosa portuguese republic fish farm 2021-05-07v4No1 / 183
826amnoncommon supragingival plaque, supragingival dental plaque, age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 195
826amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 211
826amnoncommon dentition, subgingival plaque, subgingival dental plaque, age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, research facility, united states of america2021-08-22v4No1 / 215
902amnon high in salmonella gastroenteritis salmonellosis compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 226
826amnoncommon state of illinois, united states of america, saliva, research facility, age 4 years, adult organism, female organism, beagle dog, dog, canis lupus familiaris2021-08-22v4No1 / 233
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
816amnon high in late pregnancy compared to early pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 312
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
879amnoncommon canis lupus, wolf, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 320
816amnoncommon late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 340
902amnoncommon control, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 350
902amnon high in colitis colitis antibiotics induced colitis antibiotic compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 364
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 374
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
879amnoncommon dog, canis lupus familiaris, adult organism, chest, captive, austria, skin, research facility2022-03-12v4No1 / 399
908amnoncommon guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 567
902amnon high in control compared to salmonellosis salmonella gastroenteritis in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 679
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 780
902amnon high in control compared to antibiotics induced colitis antibiotic colitis colitis in adult organism united states of america feces horse equus caballus 2022-05-02v4No1 / 1755

Problems / suggestions? Please email info AT dbbact DOT org