Summary for ontology term: africa

Number of annotations with term: 377

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGAATGCAAGTCAGATGTGAAATCCAAGGGCTCAACCCTTGAACTGCATTTGAAACTGTATTTCTTGAGTGTCGGAGAGGTTGACGGAATTCCTAG0.007916
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCACTAAGGGTCTGTGGTGAAAGATCGAAGCTTAACTTCGGTAAGCCATGGAAACCGTAGAGCTAGAGTGTGTGAGAGGATCGTGGAATTCCATGT0.007916
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCTTATAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTAGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.007916
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGACTGCAAGTCAGATGTGAAATTTAGGGGCTCAACCCCTGAACTGCATTTGAAACTGTGGTTCTTGAGTGAAGTAGAGGTAAACGGAATTCCTAG0.007916
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGCGTAGGCGGTTTATTAAGTTTAAGATAAAAGCCTGAGGCTCAACCTCAGTTCGTCTTAAAAACTGGTAGACTAGAGTATGGTAGAGGCAAACGGAATTTCTAGT0.007916
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.005277
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__SolobacteriumTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCTGTTAAGTAAGTGGTTAAATTGTTGGGCTCAACCCAATCCAGCCACTTAAACTGGCAGGCTAGAGTATTGGAGAGGCAAGTGGAATTCCATGT0.005277
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.005277
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGCATGACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.005277
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCCGTTTGATAAGCGTGCTGTGAAATATAGTGGCTCAACCTCTATCGTGCAGCGCGAACTGTTGAACTTGAGTGCGTAGTAGGTAGGCGGAATTCGTGG0.005277

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CatenibacteriumTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCCGCAAGGGTCTGTGGTGAAAGACCGAAGCTAAACTTCGGTAAGCCATGGAAACCGGGCGGCTAGAGTGCGGAAGAGGATCGTGGAATTCCATGT0.357143
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGTGGGAAAGTAAGTCAGTCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATTGAAACTACTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.357143
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCTGTTAAGCGTGTTGTGAAATGTCGTGGCTCAACCGGGGCACTGCAGCGCGAACTGGCAGACTTGAGTGCACGGTAGGAAGGCGGAATTCGTCG0.357143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGCATGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAGCCTGCTTTCAAAACTGCGTGTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.357143
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGACTTTAAGTCAGCTGTGAAATTTTCCGGCTCAACCGGGAAACTGCAGTTGATACTGGCGTCCTTGAGTACGGTCGAGGCAGGCGGAATTCGTGG0.357143
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGTAGGCTAAGCGTGCCGTGAAATACCGTCGCTCAACGGCGGCCGTGCGGCGCGAACTGGTCTACTTGAGTACGCGGGACGTTGGCGGAATTCGTGG0.357143
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTTCATCAAGTAGGATGTGAAATCCCCGGGCTCAACCTGGGAACAGCATACTAAACTGGTGGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.357143
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCTGTTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGGCAGACTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.357143
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCAGGTTAAGCGTGTTGTGAAATGTAGGGGCTCAACCTCTGCACTGCAGCGCGAACTGGCTTGCTTGAGTACGCACAACGTGGGCGGAATTCGTGG0.357143
d__BacteriaTACGTAGGTAGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCTGTTAAGTTTATGGTGAAAGCGTGGGGCTCAACCCCATAAAGCCATAGATACTGGCAGGCTAGAGTACTGGAGAGGGTAGTGGAATTCCATGT0.357143

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Orbales;f__Orbaceae;g__OrbusTACGGAGGGTGCGAGCGTTAATCGGAATGACTGGGCGTAAAGGGCATGTAGGCGGATGATTAAGTTAGGTGTGAAAGCCCCGAGCTCAACTTGGGAATTGCACTTAAAACTGGTCGTCTGGAGTATTGTAGAGGAAGGTAGAATTCCACG0.218605
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.183223
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGATTTGTAAGTCAGCGGTGAAATCCTACAGCTTAACTGTAGAACTGCCGTTGATACTGCAAGTCTTGAATAGTATTGAAGTAGCCGGAATGTGTAG0.159806
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTGGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.135593
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Acetobacteraceae;g__AsaiaTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGTTTACACAGTCAGATGTGAAATTCCAGGGCTTAACCTTGGGGCTGCATTTGATACGTGTAGACTAGAGTGTGAGAGAGGGTTGTGGAATTCCCAG0.125581
TTCCAGCTCCAATAGCGTATACTAAAATTGTTGCGGTTAAAAAGCTCGTAGTTGCATTTGTGCGCCGCGCTGTCGGTGCACCGCATCCGCGGTGATACTGACACGTCTGCGGAGCATATCGTCGGTGAGCCGGCGGTAAAACGCCGGTTC0.118812
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.117310
d__BacteriaTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTCAAAACTGCATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.114990
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.114537
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.111397

Annotations:

common ontology terms
term enrichment score
TermScore
butterfly0.280628
south africa0.246486
wild0.240620
monkey0.200371
nigeria0.187500
kenya0.185902
tanzania0.142857
rural community0.139587
child0.139332
costa rica0.133498
feces0.132139
masai mara national park0.121212
homo sapiens0.116130
edo state0.110276
ethiopia0.108285
africa0.088626
chimpanzee0.085071
infant0.081633
gambia0.081425
uganda0.071611
vervet monkey0.071611
cameroon0.070352
heliconius erato0.064516
tropical and subtropical moist broadleaf forest biome0.064516
adult0.062857
pan troglodytes schweinfurthii0.061697
chlorocebus pygerythrus pygerythrus0.061697
ensete ventricosum0.059850
ethiopian banana0.059850
panama0.058824
vagina0.058537
forest ecosystem0.052632
female0.051711
ngamba island0.051680
food (fermented)0.050740
nouabale-ndoki national park0.050378
republic of congo0.050378
1-year-old human stage0.049661
central african republic0.046095
days 30-600.045570
anaerobic fermentation0.045570
pemba island0.045570
digestive system0.044463
late timepoint0.043584
madagascar0.041131
cape buffalo0.041131
syncerus caffer caffer0.041131
mangrove biome0.040712
zambia0.040712
zoological garden0.039312
mangrove0.039120
whole body0.037815
body proper0.037113
oral cavity0.036613
hadza0.036129
pan troglodytes troglodytes0.036129
maryland county0.035806
bangui0.035806
hunter gatherer0.035488
gorilla gorilla0.035176
obsolete_juvenile stage0.035011
2-year-old human stage0.034568
male organism0.033981
biofilm0.033264
rhizosphere0.032680
gauteng province0.031332
skin of penis0.031332
kiwengwa ward0.031332
galago0.031332
otolemur garnettii0.031332
namibia0.031088
antananarivo0.030848
stunted growth0.030848
age 7 months0.030848
guinea0.030848
depth (water) 3m0.030848
nanger granti0.030848
tropical grassland biome0.030848
gazelle0.030848
kebbi state0.030848
LOWER IN control0.030844
control0.030844
10-15-years-old human0.030380
duodenum0.029915
rumen liquid0.029484
rectal swab0.029484
sea water0.027833
sheep0.027088
city0.027088
human adult stage0.026774
leaf0.026718
ovis aries0.026374
impala0.026008
aepyceros melampus0.026008
acinonyx jubatus0.025840
in vitro fertilization clinic0.025840
anambra state0.025840
papio kindae0.025840
LOWER IN zoological garden0.024876
LOWER IN wild0.024420
Fraction of dbbact annotations with this term covered by the query
TermScore
pan troglodytes schweinfurthii1.000000
uganda1.000000
ngamba island1.000000
tanzania1.000000
damara sheep1.000000
gauteng province1.000000
meatmaster sheep1.000000
LOWER IN damara sheep1.000000
LOWER IN meatmaster sheep1.000000
nigeria1.000000
edo state1.000000
LOWER IN 9-month-old human stage1.000000
9-month-old human stage1.000000
15-month-old human stage1.000000
meconium1.000000
gambia1.000000
LOWER IN protein-energy malnutrition1.000000
LOWER IN severe malnutririon1.000000
LOWER IN malnutrition1.000000
severe malnutririon1.000000
protein-energy malnutrition1.000000
malnutrition1.000000
vervet monkey1.000000
chlorocebus pygerythrus pygerythrus1.000000
ear1.000000
skin of penis1.000000
kiwengwa ward1.000000
galago1.000000
otolemur garnettii1.000000
kenya0.750000
chimpanzee0.750000
ethiopia0.750000
madagascar0.666667
butterfly0.666667
south africa0.666667
namibia0.666667
impala0.666667
aepyceros melampus0.666667
cape buffalo0.666667
syncerus caffer caffer0.666667
central african republic0.666667
hadza0.666667
eastern chimpanzee0.666667
cameroon0.666667
LOWER IN pan troglodytes troglodytes0.666667
pan troglodytes troglodytes0.666667
LOWER IN urban community0.666667
urban community0.666667
antananarivo0.500000
LOWER IN bangui0.500000
urbanus teleus0.500000
stunted growth0.500000
mechanitis polymnia0.500000
orange-spotted tiger clearwing butterfly0.500000
pyrisitia nise0.500000
mimosa yellow butterfly0.500000
heliconius cydno0.500000
cydno longwing butterfly0.500000
acinonyx jubatus0.500000
canis mesomelas0.500000
thomson's gazelle0.500000
eudorcas thomsonii0.500000
masai mara national park0.500000
cattle0.500000
kirk's dik-dik0.500000
madoqua kirkii0.500000
equus burchellii quagga0.500000
giraffa tippelskirchi0.500000
tsessebe0.500000
damaliscus lunatus0.500000
warthog0.500000
phacochoerus africanus0.500000
elephant0.500000
LOWER IN cattle0.500000
LOWER IN tsessebe0.500000
LOWER IN damaliscus lunatus0.500000
chlosyne gaudialis0.500000
anartia fatima0.500000
banded peacock butterfly0.500000
phoebis argante0.500000
apricot sulphur butterfly0.500000
arawacus togarna0.500000
adelpha cytherea0.500000
smooth-banded sister butterfly0.500000
marpesia merops0.500000
ensete ventricosum0.500000
ethiopian banana0.500000
days 30-600.500000
anaerobic fermentation0.500000
LOWER IN days 1-150.500000
LOWER IN aerobic fermentation0.500000
days 1-150.500000
aerobic fermentation0.500000
LOWER IN days 30-600.500000
LOWER IN anaerobic fermentation0.500000
ensete ventricosum var. maze0.500000
LOWER IN ensete ventricosum var. ketishe0.500000
ensete ventricosum var. ketishe0.500000
LOWER IN ensete ventricosum var. maze0.500000
LOWER IN ensete ventricosum var. gena0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.535809
homo sapiens0.360743
wild0.217507
butterfly0.177719
south africa0.151194
costa rica0.143236
digestive system0.143236
monkey0.143236
child0.127321
adult0.116711
kenya0.106101
nigeria0.103448
rural community0.082228
africa0.079576
tanzania0.076923
masai mara national park0.068966
infant0.068966
ethiopia0.058355
edo state0.058355
chimpanzee0.045093
female0.045093
gambia0.042440
uganda0.037135
cameroon0.037135
vervet monkey0.037135
heliconius erato0.034483
panama0.034483
tropical and subtropical moist broadleaf forest biome0.034483
forest ecosystem0.034483
pan troglodytes schweinfurthii0.031830
ensete ventricosum0.031830
ethiopian banana0.031830
food (fermented)0.031830
vagina0.031830
chlorocebus pygerythrus pygerythrus0.031830
1-year-old human stage0.029178
rhizosphere0.026525
ngamba island0.026525
LOWER IN control0.026525
control0.026525
nouabale-ndoki national park0.026525
republic of congo0.026525
human adult stage0.026525
days 30-600.023873
anaerobic fermentation0.023873
late timepoint0.023873
central african republic0.023873
pemba island0.023873
whole body0.023873
body proper0.023873
madagascar0.021220
cape buffalo0.021220
syncerus caffer caffer0.021220
oral cavity0.021220
depth (soil) 0-20cm0.021220
mangrove biome0.021220
mangrove0.021220
biofilm0.021220
obsolete_juvenile stage0.021220
zoological garden0.021220
zambia0.021220
duodenum0.018568
maryland county0.018568
leaf0.018568
bangui0.018568
hadza0.018568
hunter gatherer0.018568
sea water0.018568
male organism0.018568
gorilla gorilla0.018568
pan troglodytes troglodytes0.018568
2-year-old human stage0.018568
antananarivo0.015915
stunted growth0.015915
namibia0.015915
age 7 months0.015915
gauteng province0.015915
research facility0.015915
rumen0.015915
rumen liquid0.015915
sheep0.015915
ovis aries0.015915
water0.015915
guinea0.015915
depth (water) 3m0.015915
city0.015915
nanger granti0.015915
tropical grassland biome0.015915
gazelle0.015915
rectal swab0.015915
skin of penis0.015915
kiwengwa ward0.015915
galago0.015915
otolemur garnettii0.015915
10-15-years-old human0.015915
kebbi state0.015915
acinonyx jubatus0.013263
impala0.013263
aepyceros melampus0.013263
male0.013263
Number of experiments associating the term to the sequence
TermScore
feces26.000000
homo sapiens20.000000
south africa10.000000
adult8.000000
wild7.000000
LOWER IN control7.000000
control7.000000
child6.000000
rural community6.000000
monkey5.000000
tanzania5.000000
nigeria5.000000
africa4.000000
vagina4.000000
female4.000000
zoological garden4.000000
LOWER IN wild4.000000
kenya3.000000
chimpanzee3.000000
ethiopia3.000000
infant3.000000
1-year-old human stage3.000000
LOWER IN zoological garden3.000000
madagascar2.000000
butterfly2.000000
rhizosphere2.000000
acinonyx jubatus2.000000
namibia2.000000
impala2.000000
aepyceros melampus2.000000
cape buffalo2.000000
syncerus caffer caffer2.000000
pan troglodytes schweinfurthii2.000000
uganda2.000000
oral cavity2.000000
central african republic2.000000
hadza2.000000
hunter gatherer2.000000
sea water2.000000
eastern chimpanzee2.000000
cameroon2.000000
city2.000000
gambia2.000000
male2.000000
male organism2.000000
gorilla gorilla2.000000
LOWER IN pan troglodytes troglodytes2.000000
pan troglodytes troglodytes2.000000
2-year-old human stage2.000000
vervet monkey2.000000
LOWER IN urban community2.000000
urban community2.000000
duodenum1.000000
antananarivo1.000000
LOWER IN bangui1.000000
costa rica1.000000
digestive system1.000000
urbanus teleus1.000000
stunted growth1.000000
mechanitis polymnia1.000000
orange-spotted tiger clearwing butterfly1.000000
pyrisitia nise1.000000
mimosa yellow butterfly1.000000
heliconius cydno1.000000
cydno longwing butterfly1.000000
canis mesomelas1.000000
thomson's gazelle1.000000
eudorcas thomsonii1.000000
masai mara national park1.000000
cattle1.000000
kirk's dik-dik1.000000
madoqua kirkii1.000000
equus burchellii quagga1.000000
giraffa tippelskirchi1.000000
tsessebe1.000000
damaliscus lunatus1.000000
warthog1.000000
phacochoerus africanus1.000000
elephant1.000000
LOWER IN cattle1.000000
LOWER IN tsessebe1.000000
LOWER IN damaliscus lunatus1.000000
chlosyne gaudialis1.000000
anartia fatima1.000000
banded peacock butterfly1.000000
phoebis argante1.000000
apricot sulphur butterfly1.000000
arawacus togarna1.000000
ngamba island1.000000
adelpha cytherea1.000000
smooth-banded sister butterfly1.000000
marpesia merops1.000000
ensete ventricosum1.000000
ethiopian banana1.000000
days 30-601.000000
anaerobic fermentation1.000000
LOWER IN days 1-151.000000
LOWER IN aerobic fermentation1.000000
late timepoint1.000000
food (fermented)1.000000
days 1-151.000000
aerobic fermentation1.000000
LOWER IN days 30-601.000000
LOWER IN anaerobic fermentation1.000000
ensete ventricosum var. maze1.000000
LOWER IN ensete ventricosum var. ketishe1.000000
ensete ventricosum var. ketishe1.000000
LOWER IN ensete ventricosum var. maze1.000000
LOWER IN ensete ventricosum var. gena1.000000
maryland county1.000000
leaf1.000000
depth (soil) 0-20cm1.000000
mangrove biome1.000000
mangrove1.000000
bangui1.000000
age 7 months1.000000
damara sheep1.000000
gauteng province1.000000
research facility1.000000
rumen1.000000
rumen liquid1.000000
sheep1.000000
ovis aries1.000000
meatmaster sheep1.000000
LOWER IN damara sheep1.000000
LOWER IN meatmaster sheep1.000000
water1.000000
guinea1.000000
depth (water) 3m1.000000
biofilm1.000000
obsolete_juvenile stage1.000000
edo state1.000000
LOWER IN 9-month-old human stage1.000000
9-month-old human stage1.000000
15-month-old human stage1.000000
meconium1.000000
LOWER IN protein-energy malnutrition1.000000
LOWER IN severe malnutririon1.000000
LOWER IN malnutrition1.000000
severe malnutririon1.000000
protein-energy malnutrition1.000000
malnutrition1.000000
nanger granti1.000000
tropical grassland biome1.000000
gazelle1.000000
pemba island1.000000
chlorocebus pygerythrus pygerythrus1.000000
rectal swab1.000000
ear1.000000
skin of penis1.000000
kiwengwa ward1.000000
galago1.000000
otolemur garnettii1.000000
nouabale-ndoki national park1.000000
republic of congo1.000000
in vitro fertilization clinic1.000000
anambra state1.000000
10-15-years-old human1.000000
kebbi state1.000000
heliconius erato1.000000
panama1.000000
whole body1.000000
body proper1.000000
tropical and subtropical moist broadleaf forest biome1.000000
forest ecosystem1.000000
human adult stage1.000000
zambia1.000000
papio kindae1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
37amnonhigh in tomato plant leaves compared to plastic control ( high in solanum lycopersicum compared to control in maryland county leaf )2016-12-09v41 / 1approvedNo
793amnondominant depth (soil) 0-20cm, sonneratia alba, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v31 / 1approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v41 / 1approvedNo
606amnonnegatively correlated with age in human penis skin ( high in young age compared to old age in penis skin adult south africa homo sapiens male organism male )2020-04-15v31 / 1approvedNo
736amnon high in control compared to helminthiasis parasitic helminthiasis infectious disease in tanzania pemba island adult female feces homo sapiens 2021-01-25v31 / 1approvedNo
501amnoncommon costa rica, butterfly, digestive system, aeria eurimedia2019-03-09v41 / 1approvedNo
781amnondominant equus burchellii quagga, zebra, masai mara national park, kenya, wild, feces2021-04-28v41 / 2approvedNo
425amnonhigher in kids with stunted growth compared to non-stunted ( high in stunted growth compared to control in homo sapiens feces africa child )2018-12-08v41 / 2approvedNo
850amnoncommon in vitro fertilization clinic, adult, anambra state, nigeria, female organism, vagina, homo sapiens2021-12-16v41 / 2approvedNo
118amnondominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, shelled egg, forest ecosystem2017-04-11v41 / 2approvedNo
793amnondominant depth (soil) 0-20cm, kenya, rhizosphere, mangrove biome, mangrove, avicennia marina2021-06-08v31 / 3approvedNo
966amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant gambia rural community homo sapiens feces 2022-12-21v31 / 3approvedNo
966amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens rural community gambia infant 2022-12-21v31 / 3approvedNo
966amnon high in severe malnutririon protein-energy malnutrition malnutrition compared to control in feces homo sapiens rural community gambia infant 1-year-old human stage 2022-12-21v31 / 3approvedNo
501amnondominant costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v41 / 3approvedNo
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, shelled egg, forest ecosystem2017-04-11v41 / 3approvedNo
793amnondominant depth (soil) 0-20cm, rhizophora mucronata, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v31 / 4approvedNo
793amnondominant depth (soil) 0-20cm, ceriops tagal, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v31 / 4approvedNo
850amnoncommon sperm, semen, male organism, in vitro fertilization clinic, anambra state, nigeria, adult, homo sapiens2021-12-16v41 / 4approvedNo
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, pupa, forest ecosystem2017-04-11v41 / 4approvedNo
501amnondominant costa rica, butterfly, digestive system, pyrisitia nise, mimosa yellow butterfly2019-03-08v41 / 5approvedNo
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v41 / 5approvedNo
88amnonhigher in younger cape buffalo feces ( high in age young age compared to old age in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v41 / 5approvedNo
501amnondominant costa rica, butterfly, digestive system, pareuptychia ocirrhoe, two-banded satyr butterfly2019-03-08v41 / 5approvedNo
501amnoncommon costa rica, butterfly, digestive system, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v41 / 6approvedNo
501amnoncommon costa rica, butterfly, digestive system, pyrisitia nise, mimosa yellow butterfly2019-03-08v41 / 6approvedNo
501amnondominant costa rica, butterfly, digestive system, phoebis argante, apricot sulphur butterfly2019-03-09v41 / 6approvedNo
929amnondominant damara sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v31 / 6approvedNo
966amnon high in control compared to protein-energy malnutrition severe malnutririon malnutrition in 1-year-old human stage infant gambia rural community homo sapiens feces 2022-12-21v31 / 6approvedNo
501amnondominant costa rica, butterfly, digestive system, caligo illioneus, illioneus giant owl butterfly2019-03-08v41 / 6approvedNo
274amnondominant monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v41 / 6approvedNo
501amnondominant costa rica, butterfly, digestive system, aphrissa boisduvalii2019-03-08v41 / 6approvedNo
501amnoncommon costa rica, butterfly, digestive system, urbanus teleus2019-03-08v41 / 6approvedNo
501amnondominant costa rica, butterfly, digestive system, marpesia merops2019-03-09v41 / 6approvedNo
501amnoncommon costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v41 / 6approvedNo
118amnoncommon in captive raised teneral adult butterfly (common butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, teneral adult, forest ecosystem)2017-04-11v41 / 6approvedNo
118amnondominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, pupa, forest ecosystem2017-04-11v41 / 6approvedNo
781amnondominant cattle, bos taurus, masai mara national park, kenya, wild, feces2021-04-28v41 / 7approvedNo
501amnondominant costa rica, butterfly, digestive system, adelpha cytherea, smooth-banded sister butterfly2019-03-09v41 / 7approvedNo
501amnoncommon costa rica, butterfly, digestive system, marpesia merops2019-03-09v41 / 7approvedNo
960amnoncommon edo state, adult, female, nigeria, vagina, homo sapiens2022-12-20v41 / 7approvedNo
501amnoncommon costa rica, butterfly, digestive system, aphrissa boisduvalii2019-03-08v41 / 7approvedNo
850amnon high in semen sperm male organism compared to vagina female organism in in vitro fertilization clinic anambra state nigeria adult homo sapiens 2021-12-16v41 / 7approvedNo
406amnondominant feces, south africa, antidorcas marsupialis, springbok2018-11-21v41 / 7approvedNo
406amnondominant feces, south africa, aepyceros melampus, impala2018-11-21v41 / 7approvedNo
118amnondominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v41 / 7approvedNo
501amnondominant costa rica, butterfly, digestive system, urbanus teleus2019-03-08v41 / 8approvedNo
415amnondominant rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v41 / 8approvedNo
501amnondominant costa rica, butterfly, digestive system, anartia fatima, banded peacock butterfly2019-03-09v41 / 8approvedNo
37amnonhigh in tomato plant leaves compared to plastic controls ( high in solanum lycopersicum compared to control in maryland county leaf )2016-12-09v41 / 8approvedNo
929amnondominant meatmaster sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v31 / 8approvedNo
594amnondominant adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v41 / 8approvedNo
960amnoncommon 1-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 8approvedNo
960amnoncommon meconium, newborn human stage, infant, feces, edo state, nigeria, homo sapiens2022-12-20v41 / 8approvedNo
88amnondominant syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v41 / 8approvedNo
274amnondominant monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v41 / 8approvedNo
501amnoncommon costa rica, butterfly, digestive system, marpesia petreus, ruddy daggerwing butterfly2019-03-08v41 / 8approvedNo
501amnondominant costa rica, butterfly, digestive system, marpesia petreus, ruddy daggerwing butterfly2019-03-08v41 / 8approvedNo
501amnondominant costa rica, butterfly, digestive system, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v41 / 9approvedNo
781amnondominant eland, tragelaphus oryx, masai mara national park, kenya, wild, feces2021-04-28v41 / 9approvedNo
781amnondominant impala, aepyceros melampus, masai mara national park, kenya, wild, feces2021-04-28v41 / 9approvedNo
501amnoncommon costa rica, butterfly, digestive system, phoebis argante, apricot sulphur butterfly2019-03-09v41 / 9approvedNo
501amnondominant costa rica, butterfly, digestive system, arawacus togarna2019-03-09v41 / 9approvedNo
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in 2-year-old human stage 1-year-old human stage age 1-3 years child tanzania pemba island feces homo sapiens 2021-01-25v31 / 9approvedNo
501amnondominant costa rica, butterfly, digestive system, aeria eurimedia2019-03-09v41 / 9approvedNo
118amnonhigh freq. in captive raised teneral adult butterfly (dominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, teneral adult, forest ecosystem)2017-04-11v41 / 9approvedNo
501amnondominant costa rica, butterfly, digestive system, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v41 / 9approvedNo
501amnondominant costa rica, butterfly, digestive system, cithaerias pireta, blushing phantom butterfly2019-03-08v41 / 9approvedNo
781amnondominant tsessebe, damaliscus lunatus, masai mara national park, kenya, wild, feces2021-04-28v41 / 10approvedNo
501amnoncommon costa rica, butterfly, digestive system, anartia fatima, banded peacock butterfly2019-03-09v41 / 10approvedNo
78amnondominant nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v41 / 10approvedNo
501amnondominant costa rica, butterfly, digestive system, pierella helvina, red-washed satyr butterfly2019-03-08v41 / 10approvedNo
981amnondominant monkey, otolemur garnettii, galago, tanzania, wild, kiwengwa ward, skin of penis2022-12-25v31 / 10approvedNo
501amnondominant costa rica, butterfly, digestive system, caligo brasiliensis, brazilian owl butterfly2019-03-08v41 / 10approvedNo
411amnondominant zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v41 / 10approvedNo
501amnoncommon costa rica, butterfly, digestive system, heliconius cydno, cydno longwing butterfly2019-03-08v41 / 11approvedNo
781amnondominant cape buffalo, syncerus caffer caffer, masai mara national park, kenya, wild, feces2021-04-28v41 / 11approvedNo
501amnoncommon costa rica, butterfly, digestive system, adelpha cytherea, smooth-banded sister butterfly2019-03-09v41 / 11approvedNo
592amnondominant wild, feces, eastern chimpanzee, pan troglodytes schweinfurthii, democratic republic of the congo2020-02-18v11 / 11approvedNo
981amnondominant monkey, chlorocebus pygerythrus pygerythrus, wild, vervet monkey, south africa, oral cavity2022-12-25v31 / 11approvedNo
981amnoncommon ear, external acoustic meatus, south africa, vervet monkey, wild, chlorocebus pygerythrus pygerythrus, monkey2022-12-25v31 / 11approvedNo
501amnondominant costa rica, butterfly, digestive system, heliconius cydno, cydno longwing butterfly2019-03-08v41 / 11approvedNo
501amnondominant costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v41 / 11approvedNo
861amnondominant peri-urban community, human middle aged stage, bushbuckridge local municipality, rural community, south africa, female, homo sapiens, feces2022-01-15v31 / 11approvedNo
501amnondominant costa rica, butterfly, digestive system, dulcedo polita2019-03-08v41 / 11approvedNo
501amnondominant costa rica, butterfly, digestive system, pseudodebis zimri2019-03-08v41 / 11approvedNo
274amnondominant monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v41 / 11approvedNo
592amnondominant wild, feces, chimpanzee, pan troglodytes, africa2020-02-18v11 / 12approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v41 / 12approvedNo
367amnondominant air, namibia, coast2018-09-02v41 / 12approvedNo
981amnondominant monkey, chlorocebus pygerythrus pygerythrus, wild, vervet monkey, south africa, external acoustic meatus, ear2022-12-25v31 / 12approvedNo
501amnoncommon costa rica, butterfly, digestive system, caligo brasiliensis, brazilian owl butterfly2019-03-08v41 / 12approvedNo
501amnoncommon costa rica, butterfly, digestive system, pierella helvina, red-washed satyr butterfly2019-03-08v41 / 12approvedNo
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v41 / 12approvedNo
118amnoncommon in captive reared butterfly (common butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, adult, body proper, whole body, forest ecosystem)2017-04-11v41 / 12approvedNo
781amnondominant thomson's gazelle, eudorcas thomsonii, masai mara national park, kenya, wild, feces2021-04-28v41 / 13approvedNo
35amnondominant tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v41 / 13approvedNo
594amnondominant adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v41 / 13approvedNo
501amnoncommon costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v41 / 13approvedNo
981amnondominant monkey, otolemur garnettii, galago, tanzania, wild, kiwengwa ward, oral cavity2022-12-25v31 / 13approvedNo
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v41 / 13approvedNo
620amnondominant village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v41 / 13approvedNo
501amnondominant costa rica, butterfly, digestive system, taygetis laches2019-03-08v41 / 13approvedNo
861amnondominant urban community, soweto, rural community, south africa, city, female, homo sapiens, feces2022-01-15v31 / 13approvedNo
501amnondominant costa rica, butterfly, digestive system, cissia terrestris2019-03-08v41 / 13approvedNo
781amnondominant giraffe, giraffa tippelskirchi, masai mara national park, kenya, wild, feces2021-04-28v41 / 14approvedNo
501amnondominant costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v41 / 14approvedNo
190amnondominant homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v41 / 14approvedNo
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v41 / 14approvedNo
960amnondominant homo sapiens, nigeria, edo state, feces, infant, newborn human stage, meconium2022-12-20v41 / 14approvedNo
245amnondominant homo sapiens, breast milk, south africa2017-11-21v41 / 14approvedNo
981amnondominant monkey, otolemur garnettii, galago, tanzania, wild, kiwengwa ward, rectal swab2022-12-25v31 / 14approvedNo
501amnoncommon costa rica, butterfly, digestive system, caligo illioneus, illioneus giant owl butterfly2019-03-08v41 / 14approvedNo
501amnoncommon costa rica, butterfly, digestive system, pareuptychia ocirrhoe, two-banded satyr butterfly2019-03-08v41 / 14approvedNo
850amnondominant in vitro fertilization clinic, anambra state, female organism, nigeria, adult, vagina, homo sapiens2021-12-16v41 / 14approvedNo
406amnondominant feces, south africa, ceratotherium simum, white rhinoceros2018-11-21v41 / 14approvedNo
501amnondominant costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v41 / 14approvedNo
118amnoncommon in wild butterfly (common butterfly, heliconius erato, panama, whole body, adult, body proper, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v41 / 14approvedNo
118amnon high in adult compared to pupa shelled egg in butterfly heliconius erato panama tropical and subtropical moist broadleaf forest biome body proper whole body forest ecosystem 2017-04-11v41 / 14approvedNo
501amnoncommon costa rica, butterfly, digestive system, pseudodebis zimri2019-03-08v41 / 14approvedNo
873amnondominant human adult stage, rural community, africa, tanzania, adult, homo sapiens, feces2022-03-03v11 / 14approvedNo
501amnoncommon costa rica, butterfly, digestive system, cissia terrestris2019-03-08v41 / 14approvedNo
781amnondominant kirk's dik-dik, madoqua kirkii, masai mara national park, kenya, wild, feces2021-04-28v41 / 15approvedNo
425amnondominant homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v41 / 15approvedNo
425amnondominant homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v41 / 15approvedNo
960amnondominant homo sapiens, vagina, nigeria, female, adult, edo state2022-12-20v41 / 15approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 1-month-old human stage2022-12-20v41 / 15approvedNo
729amnondominant cameroon, wild, feces, monkey, gorilla gorilla2021-01-05v31 / 15approvedNo
501amnoncommon costa rica, butterfly, digestive system, taygetis laches2019-03-08v41 / 15approvedNo
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in tanzania pemba island adult female feces homo sapiens 2021-01-25v31 / 15approvedNo
981amnondominant monkey, wild, pan troglodytes schweinfurthii, chimpanzee, uganda, ngamba island, ear, external acoustic meatus2022-12-25v31 / 15approvedNo
850amnondominant in vitro fertilization clinic, anambra state, sperm, semen, male organism, nigeria, adult, homo sapiens2021-12-16v41 / 15approvedNo
406amnondominant feces, south africa, acinonyx jubatus, cheetah2018-11-21v41 / 15approvedNo
406amnondominant feces, south africa, acinonyx jubatus, cheetah2018-11-21v41 / 15approvedNo
873amnondominant human adult stage, botswana, rural community, africa, adult, homo sapiens, feces2022-03-03v11 / 15approvedNo
501amnoncommon costa rica, butterfly, digestive system, cithaerias pireta, blushing phantom butterfly2019-03-08v41 / 15approvedNo
15amnondominant namibia, feces, canis mesomelas2016-11-08v41 / 16approvedNo
781amnondominant elephant, loxodonta africana, masai mara national park, kenya, wild, feces2021-04-28v41 / 16approvedNo
981amnondominant monkey, wild, pan troglodytes schweinfurthii, chimpanzee, uganda, ngamba island, oral cavity2022-12-25v31 / 16approvedNo
213amnondominant homo sapiens, south africa, vagina2017-10-22v41 / 16approvedNo
592amnondominant feces, democratic republic of the congo, wild, pan paniscus, bonobo2020-02-18v11 / 16approvedNo
606amnonpositively correlated with age in human penis skin ( high in old age compared to young age in penis skin adult south africa homo sapiens male organism male )2020-04-15v31 / 16approvedNo
981amnondominant monkey, wild, pan troglodytes schweinfurthii, chimpanzee, uganda, ngamba island, vagina2022-12-25v31 / 16approvedNo
118amnonhigh freq. in wild butterfly (dominant butterfly, heliconius erato, panama, whole body, adult, body proper, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v41 / 16approvedNo
872amnondominant age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v11 / 16approvedNo
872amnondominant 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v11 / 16approvedNo
411amnondominant zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v41 / 16approvedNo
37amnondominant maryland county, leaf, solanum lycopersicum2016-12-09v41 / 17approvedNo
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v41 / 17approvedNo
960amnondominant homo sapiens, nigeria, edo state, feces, female, adult2022-12-20v41 / 17approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, 15-month-old human stage, oral cavity2022-12-20v41 / 17approvedNo
501amnoncommon costa rica, butterfly, digestive system, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v41 / 17approvedNo
606amnondominant penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v31 / 17approvedNo
729amnondominant cameroon, wild, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v31 / 17approvedNo
839amnondominant meerkat, suricata suricatta, kalahari desert, morning, south africa, feces2021-11-08v41 / 17approvedNo
501amnoncommon costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v41 / 17approvedNo
406amnondominant feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v41 / 17approvedNo
501amnoncommon costa rica, butterfly, digestive system, dulcedo polita2019-03-08v41 / 17approvedNo
781amnondominant warthog, phacochoerus africanus, masai mara national park, kenya, wild, feces2021-04-28v41 / 18approvedNo
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in homo sapiens feces africa child )2018-12-08v41 / 18approvedNo
331amnondominant feces, monkey, theropithecus gelada, ethiopia2018-05-13v41 / 18approvedNo
222amnondominant water, sea water, guinea, depth (water) 3m2017-10-26v41 / 18approvedNo
966amnoncommon infant, 1-year-old human stage, gambia, rural community, homo sapiens, feces2022-12-21v31 / 18approvedNo
981amnondominant monkey, wild, pan troglodytes schweinfurthii, chimpanzee, uganda, ngamba island, skin of penis2022-12-25v31 / 18approvedNo
37amnonhigh freq. in plastic leaf plants (in field next to tomato plants) (dominant maryland county, leaf)2016-12-09v41 / 19approvedNo
245amnoncommon homo sapiens, breast milk, south africa2017-11-21v41 / 19approvedNo
736amnondominant tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v31 / 19approvedNo
736amnondominant 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v31 / 19approvedNo
981amnondominant monkey, chlorocebus pygerythrus pygerythrus, wild, vervet monkey, south africa, rectal swab2022-12-25v31 / 19approvedNo
118amnonhigh freq. in captive reared butterfly (dominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, adult, body proper, whole body, forest ecosystem)2017-04-11v41 / 19approvedNo
539amnondominant ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v41 / 20approvedNo
190amnonlower in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp sengeli compared to camp hukamako in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v41 / 20approvedNo
445amnondominant coral, anthozoa, red sea, ocean, microbial mat, black band disease, disease2019-01-08v41 / 20approvedNo
222amnonhigh freq. on inner biofilm on metal plate in ocean water (dominant biofilm, water, sea water, guinea, depth (water) 3m, biofilm, biofilm material, metal)2017-10-26v41 / 20approvedNo
594amnondominant adult, cameroon, homo sapiens, saliva2020-03-12v41 / 20approvedNo
981amnoncommon external acoustic meatus, ear, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v31 / 20approvedNo
15amnondominant acinonyx jubatus, namibia, feces2016-11-08v41 / 21approvedNo
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v41 / 21approvedNo
425amnondominant homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v41 / 22approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 9-month-old human stage2022-12-20v41 / 22approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 15-month-old human stage2022-12-20v41 / 22approvedNo
736amnon high in 2-year-old human stage 1-year-old human stage age 1-3 years child compared to female adult in tanzania pemba island feces homo sapiens 2021-01-25v31 / 22approvedNo
981amnondominant monkey, chlorocebus pygerythrus pygerythrus, wild, vervet monkey, south africa, nasal cavity2022-12-25v31 / 22approvedNo
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v41 / 22approvedNo
539amnondominant ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v41 / 23approvedNo
425amnondominant homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v41 / 23approvedNo
832amnondominant homo sapiens, feces, adult, ibadan, nigeria2021-09-11v41 / 23approvedNo
981amnondominant monkey, vagina, chlorocebus pygerythrus pygerythrus, wild, vervet monkey, south africa2022-12-25v31 / 23approvedNo
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v41 / 23approvedNo
222amnonhig hfreq. on outer biofilm on metal plate in ocean water (dominant biofilm, water, sea water, guinea, depth (water) 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v41 / 24approvedNo
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v41 / 24approvedNo
960amnoncommon 9-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 24approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 18-month-old human stage2022-12-20v41 / 24approvedNo
620amnondominant feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v41 / 24approvedNo
872amnondominant age 6-12 months, under-1-year-old human stage, gambia, child, infant, homo sapiens, feces2022-02-26v11 / 24approvedNo
35amnoncommon tanzania, dense settlement biome, hospital, breast milk, homo sapiens2016-12-06v41 / 25approvedNo
425amnondominant homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v41 / 25approvedNo
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v41 / 25approvedNo
981amnondominant monkey, chlorocebus pygerythrus pygerythrus, wild, vervet monkey, south africa, skin of penis2022-12-25v31 / 25approvedNo
981amnondominant monkey, wild, pan troglodytes schweinfurthii, chimpanzee, uganda, ngamba island, rectal swab2022-12-25v31 / 25approvedNo
966amnondominant feces, homo sapiens, rural community, gambia, 1-year-old human stage, infant2022-12-21v31 / 26approvedNo
981amnoncommon nasal cavity, south africa, vervet monkey, wild, chlorocebus pygerythrus pygerythrus, monkey2022-12-25v31 / 26approvedNo
406amnondominant feces, south africa, lycaon pictus, african wild dog2018-11-21v41 / 26approvedNo
981amnoncommon south africa, vervet monkey, wild, chlorocebus pygerythrus pygerythrus, vagina, monkey2022-12-25v31 / 28approvedNo
981amnoncommon skin of penis, kiwengwa ward, wild, tanzania, galago, otolemur garnettii, monkey2022-12-25v31 / 28approvedNo
620amnondominant chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v41 / 28approvedNo
960amnoncommon 15-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 30approvedNo
37amnoncommon maryland county, leaf, solanum lycopersicum2016-12-09v41 / 33approvedNo
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens africa child duodenum 2018-12-08v41 / 33approvedNo
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v41 / 33approvedNo
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v41 / 33approvedNo
981amnoncommon skin of penis, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v31 / 34approvedNo
509amnon high in urinary schistosomiasis schistosomiasis compared to control in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v41 / 34approvedNo
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, early timepoint, aerobic fermentation, days 1-15, food (fermented)2019-07-31v41 / 35approvedNo
190amnonhigher in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp hukamako compared to camp sengeli in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v41 / 35approvedNo
258amnonhigher lungs of hiv pneumonia patients treated with ceftriaxone ( high in ceftriaxone compared to no ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v41 / 35approvedNo
509amnon high in control compared to urinary schistosomiasis schistosomiasis in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v41 / 35approvedNo
367amnoncommon air, namibia, coast2018-09-02v41 / 36approvedNo
960amnoncommon oral cavity, 15-month-old human stage, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 36approvedNo
960amnon high in 1-month-old human stage compared to 9-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 37approvedNo
873amnon high in hunter gatherer hadza compared to burunge sandawe maasai in tanzania rural community africa human adult stage commonwealth of pennsylvania adult homo sapiens feces 2022-03-03v11 / 37approvedNo
213amnonhigher in patients with bacterial vaginosis compared to healthy controls ( high in bacterial vaginosis compared to control in homo sapiens vagina south africa )2017-10-31v41 / 38approvedNo
981amnoncommon oral cavity, kiwengwa ward, wild, tanzania, galago, otolemur garnettii, monkey2022-12-25v31 / 39approvedNo
872amnoncommon age 6-12 months, under-1-year-old human stage, infant, gambia, child, homo sapiens, feces2022-02-26v11 / 39approvedNo
872amnoncommon age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v11 / 41approvedNo
406amnoncommon feces, south africa, acinonyx jubatus, cheetah2018-11-21v41 / 43approvedNo
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v41 / 44approvedNo
606amnoncommon penis, skin, adult, south africa, homo sapiens, male organism, male2020-04-15v31 / 44approvedNo
981amnoncommon vagina, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v31 / 46approvedNo
873amnon high in burunge sandawe maasai compared to hunter gatherer hadza in human adult stage rural community commonwealth of pennsylvania africa tanzania adult homo sapiens feces 2022-03-03v11 / 46approvedNo
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. gena in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v41 / 47approvedNo
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v41 / 47approvedNo
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v41 / 49approvedNo
736amnoncommon 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v31 / 49approvedNo
981amnoncommon rectal swab, south africa, vervet monkey, wild, chlorocebus pygerythrus pygerythrus, monkey2022-12-25v31 / 49approvedNo
960amnoncommon 18-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 50approvedNo
981amnoncommon oral cavity, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v31 / 50approvedNo
981amnoncommon oral cavity, south africa, vervet monkey, wild, chlorocebus pygerythrus pygerythrus, monkey2022-12-25v31 / 52approvedNo
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v41 / 55approvedNo
981amnoncommon skin of penis, south africa, vervet monkey, wild, chlorocebus pygerythrus pygerythrus, monkey2022-12-25v31 / 56approvedNo
872amnon high in infant age 6-12 months under-1-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 63approvedNo
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v41 / 64approvedNo
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. maze in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v41 / 65approvedNo
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v41 / 66approvedNo
872amnoncommon 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v11 / 68approvedNo
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v41 / 70approvedNo
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v41 / 73approvedNo
861amnoncommon urban community, city, soweto, rural community, south africa, female, homo sapiens, feces2022-01-15v31 / 73approvedNo
873amnon high in tanzania botswana rural community compared to urban community commonwealth of pennsylvania united states of america in human adult stage adult homo sapiens feces 2022-03-03v11 / 73approvedNo
539amnon high in ensete ventricosum var. ketishe compared to ensete ventricosum var. maze in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v41 / 74approvedNo
960amnon high in 9-month-old human stage compared to 18-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 74approvedNo
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v41 / 74approvedNo
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v41 / 79approvedNo
736amnon high in adult female compared to 2-year-old human stage 1-year-old human stage age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v31 / 79approvedNo
406amnonlower in captive white rhinoceros compared to wild ( high in wild south africa compared to captive french republic in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v41 / 80approvedNo
873amnoncommon botswana, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v11 / 81approvedNo
539amnon high in ensete ventricosum var. maze compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v41 / 84approvedNo
804amnon high in iga negative fraction compared to iga positive fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v41 / 85approvedNo
981amnoncommon rectal swab, kiwengwa ward, wild, tanzania, galago, otolemur garnettii, monkey2022-12-25v31 / 89approvedNo
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v31 / 95approvedNo
839amnoncommon morning, south africa, kalahari desert, feces, meerkat, suricata suricatta2021-11-08v41 / 97approvedNo
804amnon high in iga positive fraction compared to iga negative fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v41 / 100approvedNo
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v41 / 103approvedNo
213amnoncommon homo sapiens, south africa, vagina2017-10-22v41 / 103approvedNo
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v41 / 107approvedNo
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v41 / 107approvedNo
960amnoncommon adult, female, feces, edo state, nigeria, homo sapiens2022-12-20v41 / 109approvedNo
539amnon high in early timepoint days 1-15 aerobic fermentation compared to late timepoint days 30-60 anaerobic fermentation in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v41 / 110approvedNo
539amnon high in ensete ventricosum var. ketishe compared to ensete ventricosum var. gena in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v41 / 110approvedNo
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v41 / 111approvedNo
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v41 / 113approvedNo
861amnoncommon peri-urban community, rural community, bushbuckridge local municipality, human middle aged stage, south africa, female, homo sapiens, feces2022-01-15v31 / 113approvedNo
222amnoncommon water, sea water, guinea, depth (water) 3m2017-10-26v41 / 115approvedNo
592amnoncommon wild, feces, eastern chimpanzee, pan troglodytes schweinfurthii, democratic republic of the congo2020-02-18v11 / 116approvedNo
501amnonlower in nectar feeding butterflies compared to fruit feeding ( high in fruit feeding compared to nectar feeding in costa rica butterfly digestive system )2019-03-09v41 / 116approvedNo
445amnoncommon ocean, microbial mat, red sea, coral, anthozoa, black band disease, disease2019-01-08v41 / 119approvedNo
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v41 / 123approvedNo
539amnon high in ensete ventricosum var. gena compared to ensete ventricosum var. ketishe in ethiopia ensete ventricosum ethiopian banana late timepoint days 30-60 anaerobic fermentation food (fermented) 2019-07-31v41 / 123approvedNo
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v41 / 125approvedNo
873amnoncommon tanzania, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v11 / 125approvedNo
592amnoncommon wild, feces, chimpanzee, pan troglodytes, africa2020-02-18v11 / 130approvedNo
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v41 / 136approvedNo
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v41 / 146approvedNo
15amnoncommon namibia, feces, canis mesomelas2016-11-08v41 / 147approvedNo
222amnoncommon on outer biofilm on metal plate in ocean water (common biofilm, water, sea water, guinea, depth (water) 3m, biofilm, biofilm material, metal, outer biofilm)2017-10-26v41 / 147approvedNo
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v41 / 147approvedNo
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v41 / 147approvedNo
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v41 / 151approvedNo
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v41 / 154approvedNo
981amnoncommon rectal swab, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v31 / 157approvedNo
539amnoncommon ethiopia, ensete ventricosum, ethiopian banana, late timepoint, days 30-60, anaerobic fermentation, food (fermented)2019-07-31v41 / 161approvedNo
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v41 / 169approvedNo
594amnon high in ngoantet rural community compared to city yaounde in homo sapiens feces cameroon adult 2020-03-12v41 / 172approvedNo
222amnoncommon on inner biofilm on metal plate in ocean water (common biofilm, water, sea water, guinea, depth (water) 3m, biofilm, biofilm material, metal)2017-10-26v41 / 177approvedNo
960amnon high in 18-month-old human stage infant compared to female adult in homo sapiens nigeria edo state feces 2022-12-20v41 / 178approvedNo
861amnon high in soweto city urban community compared to bushbuckridge local municipality peri-urban community rural community in human middle aged stage south africa female homo sapiens feces 2022-01-15v31 / 185approvedNo
872amnon high in 1-year-old human stage compared to infant age 6-12 months under-1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 188approvedNo
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v41 / 194approvedNo
620amnoncommon feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v41 / 196approvedNo
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v41 / 197approvedNo
592amnoncommon feces, democratic republic of the congo, wild, pan paniscus, bonobo2020-02-18v11 / 199approvedNo
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v41 / 200approvedNo
88amnondifferent between herds in cape buffalo feces ( high in herd croc bridge herd compared to lower sabie herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v41 / 208approvedNo
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v41 / 224approvedNo
873amnon high in botswana compared to tanzania in africa rural community human adult stage adult homo sapiens feces 2022-03-03v11 / 226approvedNo
873amnon high in urban community commonwealth of pennsylvania united states of america compared to tanzania botswana africa rural community in human adult stage adult feces homo sapiens 2022-03-03v11 / 227approvedNo
929amnon high in meatmaster sheep compared to damara sheep in age 7 months gauteng province sheep rumen liquid south africa ovis aries rumen research facility 2022-08-16v31 / 231approvedNo
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v41 / 232approvedNo
872amnon high in 1-year-old human stage compared to 2-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 233approvedNo
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v41 / 234approvedNo
620amnoncommon chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v41 / 238approvedNo
960amnon high in 9-month-old human stage compared to 1-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v41 / 244approvedNo
781amnoncommon kirk's dik-dik, madoqua kirkii, masai mara national park, kenya, wild, feces2021-04-28v41 / 248approvedNo
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v41 / 248approvedNo
699amnoncommon united states of america, state of north carolina, state of south carolina, florida, atlantic ocean, saline water, sea water2028-04-01v41 / 254approvedNo
78amnonhigher in younger gazelles ( high in age young age compared to old age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v41 / 268approvedNo
78amnonhigher in older gazelles ( high in age old age compared to young age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v41 / 273approvedNo
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to wild south africa in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v41 / 277approvedNo
729amnon high in central chimpanzee pan troglodytes troglodytes cameroon wild compared to eastern chimpanzee pan troglodytes verus europe captive zoological garden in feces monkey 2021-01-05v31 / 288approvedNo
861amnon high in peri-urban community rural community bushbuckridge local municipality compared to city urban community soweto in human middle aged stage female south africa feces homo sapiens 2022-01-15v31 / 289approvedNo
37amnoncommon in plastic leaf plants (in field next to tomato plants) (common maryland county, leaf)2016-12-09v41 / 298approvedNo
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v41 / 298approvedNo
406amnoncommon feces, south africa, ceratotherium simum, white rhinoceros2018-11-21v41 / 300approvedNo
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v41 / 301approvedNo
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v41 / 311approvedNo
729amnoncommon cameroon, wild, feces, monkey, gorilla gorilla2021-01-05v31 / 321approvedNo
873amnon high in tanzania compared to botswana in human adult stage rural community africa adult homo sapiens feces 2022-03-03v11 / 333approvedNo
729amnoncommon wild, cameroon, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v31 / 336approvedNo
729amnon high in europe captive zoological garden eastern chimpanzee pan troglodytes verus compared to cameroon pan troglodytes troglodytes central chimpanzee in feces monkey 2021-01-05v31 / 337approvedNo
190amnon high in wet season compared to dry season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v41 / 341approvedNo
781amnon high in cape buffalo syncerus caffer caffer compared to cattle bos taurus in masai mara national park kenya wild feces 2021-04-28v41 / 349approvedNo
620amnon high in gorilla gorilla compared to pan troglodytes troglodytes chimpanzee in nouabale-ndoki national park republic of congo wild feces 2020-05-06v41 / 351approvedNo
620amnon high in nouabale-ndoki national park wild republic of congo pan troglodytes troglodytes compared to united states of america zoological garden pan troglodytes in chimpanzee feces 2020-05-06v41 / 351approvedNo
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v41 / 364approvedNo
620amnon high in nouabale-ndoki national park wild republic of congo compared to zoological garden united states of america in gorilla gorilla gorilla feces 2020-05-06v41 / 368approvedNo
729amnon high in wild cameroon compared to captive zoological garden europe in gorilla gorilla monkey feces 2021-01-05v31 / 383approvedNo
781amnoncommon giraffe, giraffa tippelskirchi, masai mara national park, kenya, wild, feces2021-04-28v41 / 400approvedNo
960amnon high in 18-month-old human stage compared to 9-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v41 / 407approvedNo
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v41 / 416approvedNo
781amnoncommon elephant, loxodonta africana, masai mara national park, kenya, wild, feces2021-04-28v41 / 419approvedNo
781amnoncommon thomson's gazelle, eudorcas thomsonii, masai mara national park, kenya, wild, feces2021-04-28v41 / 425approvedNo
929amnoncommon meatmaster sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v31 / 432approvedNo
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v41 / 440approvedNo
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v41 / 446approvedNo
781amnon high in impala aepyceros melampus compared to tsessebe damaliscus lunatus in masai mara national park kenya wild feces 2021-04-28v41 / 460approvedNo
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in nouabale-ndoki national park republic of congo wild feces 2020-05-06v41 / 478approvedNo
274amnoncommon monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v41 / 489approvedNo
781amnoncommon impala, aepyceros melampus, masai mara national park, kenya, wild, feces2021-04-28v41 / 510approvedNo
539amnon high in days 30-60 anaerobic fermentation late timepoint compared to days 1-15 aerobic fermentation early timepoint in ethiopia ensete ventricosum ethiopian banana food (fermented) 2019-07-31v41 / 510approvedNo
781amnoncommon cape buffalo, syncerus caffer caffer, masai mara national park, kenya, wild, feces2021-04-28v41 / 557approvedNo
781amnoncommon warthog, phacochoerus africanus, masai mara national park, kenya, wild, feces2021-04-28v41 / 564approvedNo
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v41 / 564approvedNo
781amnon high in tsessebe damaliscus lunatus compared to impala aepyceros melampus in masai mara national park kenya wild feces 2021-04-28v41 / 599approvedNo
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v41 / 600approvedNo
781amnoncommon tsessebe, damaliscus lunatus, masai mara national park, kenya, wild, feces2021-04-28v41 / 622approvedNo
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v41 / 622approvedNo
781amnon high in cattle bos taurus compared to cape buffalo syncerus caffer caffer in masai mara national park kenya wild feces 2021-04-28v41 / 642approvedNo
406amnoncommon feces, south africa, aepyceros melampus, impala2018-11-21v41 / 643approvedNo
929amnon high in damara sheep compared to meatmaster sheep in age 7 months gauteng province sheep rumen liquid south africa ovis aries rumen research facility 2022-08-16v31 / 648approvedNo
781amnoncommon equus burchellii quagga, zebra, masai mara national park, kenya, wild, feces2021-04-28v41 / 653approvedNo
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v31 / 656approvedNo
781amnoncommon cattle, bos taurus, masai mara national park, kenya, wild, feces2021-04-28v41 / 662approvedNo
793amnoncommon depth (soil) 0-20cm, ceriops tagal, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v31 / 662approvedNo
781amnoncommon eland, tragelaphus oryx, masai mara national park, kenya, wild, feces2021-04-28v41 / 666approvedNo
406amnoncommon feces, south africa, antidorcas marsupialis, springbok2018-11-21v41 / 678approvedNo
872amnon high in 2-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 704approvedNo
929amnoncommon age 7 months, damara sheep, gauteng province, south africa, research facility, rumen, rumen liquid, sheep, ovis aries2022-08-16v31 / 706approvedNo
793amnoncommon depth (soil) 0-20cm, sonneratia alba, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v31 / 733approvedNo
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v41 / 811approvedNo
331amnon high in wet season compared to dry season in feces monkey theropithecus gelada ethiopia 2018-05-13v41 / 818approvedNo
88amnoncommon syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v41 / 891approvedNo
793amnoncommon depth (soil) 0-20cm, rhizophora mucronata, kenya, rhizosphere, mangrove biome, mangrove2021-06-08v31 / 900approvedNo
37amnonlower in tomato plant leaves compared to plastic control ( high in control compared to solanum lycopersicum in maryland county leaf )2016-12-09v41 / 950approvedNo
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v41 / 964approvedNo
793amnoncommon depth (soil) 0-20cm, kenya, rhizosphere, mangrove biome, mangrove, avicennia marina2021-06-08v31 / 1001approvedNo
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v41 / 1019approvedNo
960amnon high in female adult compared to 18-month-old human stage infant in feces edo state nigeria homo sapiens 2022-12-20v41 / 1392approvedNo

Problems / suggestions? Please email info AT dbbact DOT org