Summary for ontology term: age

Number of annotations with term: 49

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.069231
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.061538
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.061538
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.061538
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.061538
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__SubdoligranulumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGATTGGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGTCAGTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.061538
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.053846
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.053846
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGCTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.053846
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.053846

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.105263
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.052632
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.052632
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGAGTGCGCAGGCGGTTTTGCAAGACCGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTGGTGACTGCAAGGCTAGAGTGTGTCAGAGGGAGGTGGAATTCCGCA0.052632
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.052632
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.052632
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACCCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.052632
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGGAGATTAAGTGTGTTGTGAAATGTAGACGCTCAACGTCTGAATTGCAGCGCATACTGGTTTCCTTGAGTACGCACAACGTTGGCGGAATTCGTCG0.052632
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__StomatobaculumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGTTGCGCAAGTCTGAAGTGAAATCCCGAGGCTTAACCACGGGACTGCTTTGGAAACTGTGCGACTTGAGTATCGGAGGGGCAGGCGGAATTCCTAG0.052632
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCCTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTAAGCCGCCGAAACTGGAGGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.052632

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__MoraxellaTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTATTTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATCTGATACTGGATAACTAGAGTAGGTGAGAGGGGAGTAGAATTCCAGG0.071429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGCTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.069652
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCACGTCGTCTGTGAAATTCCACAGCTTAACTGTGGGCGTGCAGGCGATACGGGCTGACTTGAGTACTGTAGGGGTAACTGGAATTCCTGG0.066986
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__DolosigranulumTACGTAGGTGACAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTCTGTTTAGTCTAATGTGAAAGCCCACGGCTTAACCGTGGAACGGCATTGGAAACTGACAGACTTGAATGTAGAAGAGGAAAATGGAATTCCAAG0.066986
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAACTCCTG0.063291
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.058252
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__MoraxellaTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGTAGGTGGTTTATTAAGTCAGATGTGAAATCCCTGGGCTTAACCTAGGAACTGCATCTGATACTGATAAACTAGAGTAGGTGAGAGGAAAGTAGAATTCCAGG0.057554
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCGTGGCTGGAGTGTCGGAGAGGCAGGCGGAATTCCTAG0.057471
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTATGTAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTATGTAACTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.057143
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATAGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGTACTGCTTTGGAAACTGTTAAGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.055944

Annotations:

common ontology terms
term enrichment score
TermScore
age0.913436
infant0.352467
1-month-old human stage0.222222
young age0.206897
LOWER IN old age0.206897
kingdom of the netherlands0.191304
old age0.172414
LOWER IN young age0.172414
LOWER IN age0.171429
kingdom of denmark0.164384
1-year-old human stage0.156250
nasopharynx0.138365
LOWER IN 1-month-old human stage0.131148
nasal cavity0.129412
3-month-old human stage0.126984
LOWER IN 1-year-old human stage0.125000
LOWER IN under-1-year-old human stage0.117647
south korea0.109589
chicken0.098765
LOWER IN newborn human stage0.098361
gallus gallus0.096386
rumen0.089888
under-1-year-old human stage0.088235
feces0.082718
LOWER IN age > 3 months0.076923
older age0.076923
LOWER IN younger age0.076923
age <= 24 hours0.075472
age 1 week0.075472
hypopharynx0.075472
holstein-friesian bull0.075472
c3h/hej0.075472
tropical grassland biome0.075472
nanger granti0.075472
gazelle0.075472
mouse0.073620
LOWER IN infant stage0.073171
LOWER IN age &lt; 3 months0.072727
wistar rat0.072727
age < 1 year0.072727
newborn human stage0.070175
ireland0.070175
lamb0.070175
kenya0.070175
homo sapiens0.069606
male0.069565
mus musculus0.068571
rumen liquid0.067797
12-month-old human stage0.063492
india0.063492
qinghai province0.063492
finland0.063492
czech republic0.061538
research facility0.058309
sheep0.057971
obsolete_juvenile stage0.057971
ovis aries0.054795
oral cavity0.051948
rattus0.048193
bos taurus0.048193
rat0.047059
c57bl/60.047059
dentition0.042105
australia0.042105
united kingdom0.042105
mouth0.041237
age <=24 hours0.039216
LOWER IN age &gt;= 7 days0.039216
age 24 hours0.039216
LOWER IN age 2 hours0.039216
LOWER IN age &gt;=7 days0.039216
LOWER IN age one week0.039216
LOWER IN age 24 weeks0.039216
age 24 weeks0.039216
35 weeks0.039216
LOWER IN 25 weeks0.039216
age 25 weeks0.039216
660 days0.039216
LOWER IN 605 days0.039216
605 days0.039216
LOWER IN 660 days0.039216
LOWER IN age 28 days0.039216
age 28 days0.039216
LOWER IN pre-weaning0.039216
aging0.039216
LOWER IN aging0.039216
age > 3 months0.038462
LOWER IN age 35 weeks0.038462
age < 3 months0.038462
younger age0.038462
LOWER IN older age0.038462
age 21 days0.038462
post-weaning0.038462
LOWER IN age 21 days0.038462
syncerus caffer caffer0.038462
cape buffalo0.038462
LOWER IN fifth decade human stage0.037736
fifth decade human stage0.037736
age 3 weeks0.037736
LOWER IN age 3 weeks0.037736
Fraction of dbbact annotations with this term covered by the query
TermScore
age0.952381
LOWER IN age &gt; 3 months0.666667
older age0.666667
LOWER IN younger age0.666667
young age0.666667
LOWER IN old age0.666667
old age0.555556
LOWER IN young age0.555556
age <=24 hours0.500000
LOWER IN age &gt;= 7 days0.500000
age 24 hours0.500000
LOWER IN age 2 hours0.500000
LOWER IN age &gt;=7 days0.500000
1-month-old human stage0.500000
age <= 24 hours0.500000
age 1 week0.500000
LOWER IN age one week0.500000
LOWER IN age 24 weeks0.500000
age 24 weeks0.500000
hypopharynx0.500000
35 weeks0.500000
LOWER IN 25 weeks0.500000
age 25 weeks0.500000
660 days0.500000
LOWER IN 605 days0.500000
holstein-friesian bull0.500000
605 days0.500000
LOWER IN 660 days0.500000
LOWER IN age 28 days0.500000
age 28 days0.500000
LOWER IN pre-weaning0.500000
aging0.500000
c3h/hej0.500000
LOWER IN aging0.500000
tropical grassland biome0.500000
nanger granti0.500000
gazelle0.500000
LOWER IN age &lt; 3 months0.333333
age > 3 months0.333333
LOWER IN 1-month-old human stage0.333333
1-year-old human stage0.333333
wistar rat0.333333
LOWER IN age 35 weeks0.333333
age < 3 months0.333333
age < 1 year0.333333
younger age0.333333
LOWER IN older age0.333333
age 21 days0.333333
post-weaning0.333333
LOWER IN age 21 days0.333333
syncerus caffer caffer0.333333
cape buffalo0.333333
3-month-old human stage0.285714
LOWER IN age0.285714
infant0.269231
LOWER IN 1-year-old human stage0.266667
newborn human stage0.250000
LOWER IN newborn human stage0.250000
LOWER IN fifth decade human stage0.250000
fifth decade human stage0.250000
kingdom of denmark0.250000
age 3 weeks0.250000
LOWER IN age 3 weeks0.250000
LOWER IN age 1 week0.250000
ireland0.250000
lamb0.250000
hispanic or latin american0.250000
LOWER IN age 1-3 years0.250000
age 1-3 years0.250000
kenya0.250000
LOWER IN under-1-year-old human stage0.210526
rumen liquid0.200000
kingdom of the netherlands0.166667
south korea0.166667
LOWER IN 2-year-old human stage0.166667
2-year-old human stage0.166667
under-1-year-old human stage0.157895
LOWER IN fourth decade human stage0.142857
fourth decade human stage0.142857
12-month-old human stage0.142857
india0.142857
LOWER IN 3-month-old human stage0.142857
qinghai province0.142857
breast milk0.142857
finland0.142857
late time points0.125000
LOWER IN early time points0.125000
czech republic0.125000
chicken0.125000
gallus gallus0.117647
early timepoints0.111111
nasopharynx0.100000
human late adulthood stage0.100000
LOWER IN human late adulthood stage0.100000
LOWER IN late timepoints0.100000
rumen0.100000
sheep0.100000
obsolete_juvenile stage0.100000
nasal cavity0.090909
LOWER IN infant stage0.090909
Fraction of annotations for the query sequences containing the term
TermScore
age0.877551
homo sapiens0.612245
feces0.571429
infant0.510204
nasal cavity0.224490
nasopharynx0.224490
kingdom of the netherlands0.224490
research facility0.204082
united states of america0.183673
1-month-old human stage0.142857
kingdom of denmark0.122449
LOWER IN age0.122449
mus musculus0.122449
mouse0.122449
young age0.122449
LOWER IN old age0.122449
1-year-old human stage0.102041
old age0.102041
LOWER IN young age0.102041
3-month-old human stage0.081633
south korea0.081633
LOWER IN 1-month-old human stage0.081633
LOWER IN 1-year-old human stage0.081633
LOWER IN under-1-year-old human stage0.081633
rumen0.081633
male0.081633
gallus gallus0.081633
chicken0.081633
LOWER IN newborn human stage0.061224
LOWER IN infant stage0.061224
under-1-year-old human stage0.061224
newborn human stage0.040816
LOWER IN age &gt; 3 months0.040816
LOWER IN age &lt; 3 months0.040816
age <= 24 hours0.040816
12-month-old human stage0.040816
age 1 week0.040816
female0.040816
india0.040816
hypopharynx0.040816
rattus0.040816
czech republic0.040816
rat0.040816
wistar rat0.040816
bos taurus0.040816
ireland0.040816
holstein-friesian bull0.040816
older age0.040816
LOWER IN younger age0.040816
ovis aries0.040816
qinghai province0.040816
rumen liquid0.040816
age < 1 year0.040816
sheep0.040816
lamb0.040816
china0.040816
c57bl/60.040816
finland0.040816
caecum0.040816
oral cavity0.040816
dentition0.040816
australia0.040816
obsolete_juvenile stage0.040816
mouth0.040816
c3h/hej0.040816
united kingdom0.040816
tropical grassland biome0.040816
kenya0.040816
nanger granti0.040816
gazelle0.040816
age <=24 hours0.020408
LOWER IN age &gt;= 7 days0.020408
age 24 hours0.020408
LOWER IN age 2 hours0.020408
LOWER IN age &gt;=7 days0.020408
age > 3 months0.020408
infant stage0.020408
human late adulthood stage0.020408
LOWER IN fourth decade human stage0.020408
LOWER IN fifth decade human stage0.020408
fourth decade human stage0.020408
fifth decade human stage0.020408
LOWER IN human late adulthood stage0.020408
LOWER IN age one week0.020408
age 3 weeks0.020408
LOWER IN age 24 weeks0.020408
age 24 weeks0.020408
LOWER IN age 3 weeks0.020408
LOWER IN age 1 week0.020408
LOWER IN 3-month-old human stage0.020408
late time points0.020408
35 weeks0.020408
LOWER IN early time points0.020408
LOWER IN 25 weeks0.020408
early timepoints0.020408
age 25 weeks0.020408
LOWER IN late timepoints0.020408
LOWER IN age 35 weeks0.020408
age < 3 months0.020408
660 days0.020408
Exp. ID User ID Description Date Region Flag Sequences
131amnonpositively correlated with age (30-80 years) ( high in age human late adulthood stage compared to fourth decade human stage fifth decade human stage in feces homo sapiens south korea )2017-04-16v4No1 / 1
227amnonpeaks at age 1 month in baby nasopharynx ( high in age 1-month-old human stage compared to newborn human stage infant stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 2
227amnonpeaks at age 3 months in baby nasopharynx ( high in age 3-month-old human stage compared to age > 3 months age < 3 months infant stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 2
127amnonhigh in young (0-3 days) compared to old (28 day) chickens ( high in age young age compared to old age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 3
88amnonhigher in younger cape buffalo feces ( high in age young age compared to old age in feces south africa syncerus caffer caffer cape buffalo )2017-03-08v4No1 / 5
227amnonpeaks at 24hrs compared to 2hrs or later timepoints in baby nasopharynx ( high in age age 24 hours newborn human stage compared to age 2 hours age >=7 days newborn human stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 6
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 9
227amnoncommon in baby nasopharynx age 6 months to 1 year (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 12-month-old human stage)2017-10-30v4No1 / 10
227amnonhigh freq. in baby nasopharynx age 6 months to 1 year (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 12-month-old human stage)2017-10-30v4No1 / 10
307amnondecreases with aging (4 week period) ( high in young age compared to age aging old age in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 10
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 11
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 12
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 14
227amnonhigher in age > 3 months in baby nasopharynx ( high in age age > 3 months infant stage compared to age < 3 months in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 15
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 17
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 18
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 20
187amnonnegatively correlated with age 25-35 weeks ( high in early timepoints age 25 weeks compared to age late timepoints age 35 weeks in feces research facility rattus czech republic rat wistar rat )2017-08-23v4No1 / 23
203amnonpositively correlated with age in child dental plaque ( high in age older age compared to younger age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 28
458amnonnegatively correlated with age ( high in age 3 weeks compared to age age 24 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months infant stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 31
187amnonpositively correlated with age 25-35 weeks ( high in age late time points 35 weeks compared to early time points 25 weeks in feces research facility rattus czech republic rat wistar rat )2017-08-23v4No1 / 33
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in breast milk age age 21 days compared to mouse chow age 28 days in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 36
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
131amnonnegatively correlated with age (30-80 years) ( high in age fourth decade human stage fifth decade human stage compared to human late adulthood stage in feces homo sapiens south korea )2017-04-16v4No1 / 39
379amnonnegatively correlated with age 8-35 days in chickens ( high in young age compared to age old age in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 47
45amnonhigher in younf babies compared to 2 year olds in india ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 56
657amnonpostively correlated with age ( high in age older age compared to younger age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 65
83amnonhigher in earlier timepoint (yonger age) in cow rumen normal diet ( high in age 605 days compared to 660 days in rumen bos taurus ireland holstein-friesian bull )2017-03-05v4No1 / 80
203amnonnegatively correlated with age in child dental plaque ( high in young age compared to age old age in homo sapiens oral cavity dentition australia obsolete_juvenile stage mouth )2017-10-01v4No1 / 80
227amnonhiger in first 24hrs compared to later timepoints in baby nasopharynx ( high in age age <=24 hours newborn human stage compared to age >= 7 days newborn human stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 85
127amnonhigh in old (14-28 days) compared to young (0-3 day) chickens ( high in age old age compared to young age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 98
458amnonpositively correlated with age ( high in age age 24 weeks compared to age 3 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 99
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 173
83amnonhigher in later timepoint (older age) in cow rumen normal diet ( high in age 660 days compared to 605 days in rumen bos taurus ireland holstein-friesian bull )2017-03-05v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
78amnonhigher in younger gazelles ( high in age young age compared to old age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 268
379amnonpositively correlated with age 8-35 days in chickens ( high in age old age compared to young age in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 271
78amnonhigher in older gazelles ( high in age old age compared to young age in feces tropical grassland biome kenya nanger granti gazelle )2017-03-01v4No1 / 273
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in feces research facility mus musculus c57bl/6 male mouse south korea )2017-10-24v4No1 / 299
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567

Problems / suggestions? Please email info AT dbbact DOT org