Summary for ontology term: age < 1 year

Number of annotations with term: 12

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTATCCAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTAGTAGGCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.181818
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.181818
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGACAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGCCCGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.181818
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGATCAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGATCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.181818
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.181818
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.181818
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.181818
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.181818

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.666667
d__BacteriaTACGTAGGTAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTAACAAGTTGGTAGTGAAATTCCGAAGCTTAACTTCGGCGCTACTACCAAGACTGTTGAACTTGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGTGGGTTAAGCGTGCCGTGAAATTCCGTCGCTCAACGGCGGACGTGCGGCGCGAACTGGTCCACTTGAGTACGCGGGACGTTGGCGGAATTCGTGG0.333333
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTGTTAAGTTTAAGATTAAAGCCTGGGGCTCAACTCCAGTTCGTCTTAAAAACTGGCAGACTAGAGTACGGTAGAGGCAAACGGAATTTCTAGT0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__StomatobaculumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGTTGCGCAAGTCTGAAGTGAAATCCCGAGGCTTAACCACGGGACTGCTTTGGAAACTGTGCGACTTGAGTATCGGAGGGGCAGGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCCTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTAAGCCGCCGAAACTGGAGGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTTGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGGTGGCAGGCGATACGGGCATAACTAGAGTGCTGTAGGGGAGACTGGAATTCCTG0.333333
d__BacteriaTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGAGTAGGCGGGCTGACAAGTCAGATGTGAAATGTTCAGGCTTAACCTGAGAACTGCATTTGAAACTGCCAGTCTTGAGTGTCGGAGGGGTAATCGGAATTCCCGG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.476190
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGTTAAGCGTGCTGTGAAATTTAGAGGCTCAACCTCTACCGTGCAGCGCGAACTGACAGACTTGAGTGCGTTGAAGGTAGGCGGAATTCGTGG0.375000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGCATGGTAAGCGTGTTGTGAAATGCGGGTGCTCAACATCCGGACTGCAGCGCGAACTGCCGTGCTTGAGTGCATTGAAGGAAGGCGGAATTCGTGG0.352941
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTCAGACTGGGTAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.344828
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTAATTAAGTCTGATGTGAAAATGCGGGGCTCAACCCCGTATTGCGTTGGAAACTGGTTAACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.315789
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CapnocytophagaTACGGAGGATGCGAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGGGTAATAAGTCAGAGGTGAAAGCGCTCAGCTCAACTGAGCAACTGCCTTTGAAACTGTTATTCTTGAATGATTGTGAAGTAGTTGGAATGTGTAG0.285714
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCTATCAAGTCAGGGGTGAAAACCTGCGGCTCAACCGCAGGCCTGCCTTTGAAACTGAGGGGCTGGAGTACCGGAGAGGTGGACGGAACTGCACG0.285714
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae"TACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTAATTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGGTTAACTAGAGTACTGGAGGGGTAAGCGGAACTACAAGT0.285714
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGATTTTTAAGTGAGATGTGAAAGCCCTGGGCTTAACCTGGGAACTGCATTTCAGACTGGGAATCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.285714
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTTCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATCGTTAAGTCAGCGGTTAAAGGGTGTGGCTCAACCATGCATTGCCGTTGAAACTGGTGATCTTGAGTGCAGACAGGGATGCCGGAATTCGTGGT0.285714

Annotations:

common ontology terms
term enrichment score
TermScore
age < 1 year0.740741
cayo santiago0.571429
puerto rico0.571429
indian rhesus macaque0.571429
lamb0.285714
macaca mulatta0.266667
rumen liquid0.250000
rectal swab0.250000
age 10-15 years0.250000
LOWER IN age 10-15 years0.250000
LOWER IN age &lt; 1 year0.222222
qinghai province0.200000
mouth mucosa0.166667
sheep0.153846
adult organism0.142857
LOWER IN adult organism0.142857
older age0.133333
LOWER IN younger age0.133333
ovis aries0.133333
younger age0.133333
LOWER IN older age0.133333
oral cavity0.117647
rumen0.086957
infant0.071429
LOWER IN infant0.062500
age0.060606
LOWER IN age0.060606
research facility0.013333
china0.011429
feces0.006309
Fraction of dbbact annotations with this term covered by the query
TermScore
age < 1 year0.666667
cayo santiago0.500000
puerto rico0.500000
indian rhesus macaque0.500000
age 10-15 years0.500000
LOWER IN age 10-15 years0.500000
older age0.333333
LOWER IN younger age0.333333
younger age0.333333
LOWER IN older age0.333333
LOWER IN age &lt; 1 year0.333333
lamb0.250000
rumen liquid0.200000
rectal swab0.200000
macaca mulatta0.166667
qinghai province0.142857
adult organism0.125000
LOWER IN adult organism0.125000
mouth mucosa0.111111
sheep0.100000
ovis aries0.083333
oral cavity0.071429
rumen0.050000
age0.047619
LOWER IN age0.047619
infant0.038462
LOWER IN infant0.038462
research facility0.006803
china0.005814
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
age < 1 year0.833333
macaca mulatta0.666667
cayo santiago0.666667
puerto rico0.666667
indian rhesus macaque0.666667
infant0.500000
research facility0.333333
rumen0.333333
ovis aries0.333333
qinghai province0.333333
rumen liquid0.333333
sheep0.333333
lamb0.333333
china0.333333
feces0.333333
rectal swab0.333333
oral cavity0.333333
mouth mucosa0.333333
age 10-15 years0.166667
adult organism0.166667
LOWER IN infant0.166667
LOWER IN age &lt; 1 year0.166667
LOWER IN age 10-15 years0.166667
LOWER IN adult organism0.166667
age0.083333
older age0.083333
LOWER IN younger age0.083333
younger age0.083333
LOWER IN age0.083333
LOWER IN older age0.083333
Exp. ID User ID Description Date Region Flag Sequences
657amnondominant research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 12
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 14
770amnondominant feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 15
770amnondominant oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 25
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 49
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
657amnonpostively correlated with age ( high in age older age compared to younger age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 65
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 84
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517

Problems / suggestions? Please email info AT dbbact DOT org