Summary for ontology term: age 13-14

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGGCGGTTTATTAGGTCTATGGTTTAATTCCGAAGCTTAACTTCGGTTCGCCATAGAAACCGATTTACTTGAGTATGGTAGAGGCAAGTGGAATTTCTAGT0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__AllisonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCGTGCAAGTCCATCTTAAAAGCGTGGGGCTTAACCCCATGAGGGGATGGAAACTGCATGGCTGGAGTGTCGGAGGGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAATCAAGTTGGATGTGAAATGTCGGGGCTTAACCCCGGAACTGCATCCAAAACTGATATTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCGAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__AcetanaerobacteriumTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAATGCAAGTTGAATGTTTAAACTATCGGCTCAACTGATAATCGCGTTCAAAACTGCATTTCTTGAGTGGAGTAGAGGCAGGCGGAATTCCTAGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGGGGTAAGTGGAATTCCTAG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__ParaprevotellaTACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCTTTTAAGTCAGCGGTCAAATGCCACGGCTCAACCGTGGCCAGCCGTTGAAACTGCAAGCCTTGAGTCTGCACAGGGCACATGGAATTCGTGGT0.250000
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAAGTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Eubacteriaceae;g__EubacteriumTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGCACCTTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCTTGCGAACTGGGGTGCTTGAGTGCAGGAGGGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAGCGCAAGTTAAATGTTTAAACTATCGGCTCAACTGATAGTCGCGTTTAAAACTGCGTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__MorganellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTGATTGAGTCAGATGTGAAATCCCCGGGCTTAACCCGGGAATTGCATCTGATACTGGTCAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCATG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATAGGCAAGTCTGGAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGCAGATCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTTAGCAAGTCTGAAGTGAAAGCCCAGGGCTCAACCCCGGTACTGCTTTGGAAACTGTTAGACTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGATTTGCAAGTTGGAAGTGAAACCCATGGGCTCAACCCATGGACTGCTTTCAAAACTGCAGATCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.285714
d__BacteriaTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGTCGGCAAGTTGGAGGTGAAAGCTGTGGGCTCAACTCACAAACTGCCTTCAAAACTGCCGGTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGG0.272727
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCGCGCCAAGCGGGACCTCTAACCCCGGGGCTCAACCCCGGGCCGGGTCCCGGACTGGCGCGCTCGAGTGCGGTAGAGGCGAGTGGAATTCCCGGT0.250000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGAACAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGTTCAGCTAGAGAACAGAAGAGGGCGGCGGAACTCCATGT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGGCTCGTAAGTCAGTTGTGAAAGTTCGCGGCTCAACCGCGGAATTGCAGTTGATACTGCGGGCCTTGAGTGCAGCAGAGGTGGGCGGAATTCGTGG0.250000
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__CloacibacillusTACGTAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGCAGGCTGGCCGTTAAGTCTGTCGTCAAAGGCGGAGGCTCAACCTCCGTTCTACGATAGATACTGGCGGCCTAGAGTATGTGAGAGGGAAGTGGAATTCCCGG0.222222
d__Archaea;p__"Euryarchaeota";c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__MethanobrevibacterTACCGGCAGCTCTAGTGGTAGCAGTTTTTATTGGGCCTAAAGCGTCCGTAGCCGGTTTAATAAGTCTCTGGTGAAATCCTGCAGCTTAACTGTGGGAATTGCTGGAGATACTATTAGACTTGAGATCGGGAGAGGTTAGAGGTACTCCCA0.222222

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
age 13-140.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
age 8-120.500000
LOWER IN age 3-60.500000
14-year-old human stage0.333333
LOWER IN 14-year-old human stage0.333333
13-year-old human stage0.250000
LOWER IN 13-year-old human stage0.250000
LOWER IN 6-12 year-old child stage0.200000
6-12 year-old child stage0.200000
jiangsu province0.090909
2-5 year-old child stage0.090909
LOWER IN 2-5 year-old child stage0.090909
china0.005814
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
china1.000000
age 13-140.750000
13-year-old human stage0.750000
14-year-old human stage0.750000
jiangsu province0.500000
age 3-60.250000
2-5 year-old child stage0.250000
LOWER IN age 8-120.250000
LOWER IN age 13-140.250000
LOWER IN 6-12 year-old child stage0.250000
LOWER IN 13-year-old human stage0.250000
LOWER IN 14-year-old human stage0.250000
age 8-120.250000
6-12 year-old child stage0.250000
LOWER IN age 3-60.250000
LOWER IN 2-5 year-old child stage0.250000

Problems / suggestions? Please email info AT dbbact DOT org