Summary for ontology term: age 3-5 weeks

Number of annotations with term: 8

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTGAGGAATATTGGTCAATGGGCGGGAGCCTGAACCAGCCAAGCCGCGTGGAGGAAGAAGGTACAGAGTATCGTAAACTCCTTTTGTCAGGGGATAAAAAGCGGGATGTATCCCGTCTTGCAGGTACCTGAAGAAAAAGCATCGGCTAACT0.571429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGCGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTACGGATTGTAAACCTCTTTTGCCGGGGAGCAAGCCGCTGCACGAGTGCGGCGGCTGAGAGTACCCGGAGAAAAAGCATCGGCTAAC0.571429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGCCGAGAGGCTGAACCAGCCAAGTCGCGTGAGGGATGACGGCCCTACGGGTTGTAAACCTCTTTTGTCAGGGAGCAAATAGAGCCACGTGTGGCTCGTCGAGAGTACCTGAAGAAAAAGCATCGGCTAACT0.571429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGCGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTACGGATTGTAAACCTCTTTTGTCGGGGAGCAACAAGGCCACGTGTGGCCGAAAGTGAGAGTACCCGAAGAAAAAGCATCGGCTAAC0.571429
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTAGGGAATATTGCTCAATGGGGGAAACCCTGAAGCAGCAACGCCGCGTGGAGGATGAAGGTTTTCGGATTGTAAACTCCTTTTCTAAGAGAAGATAATGACGGTATCTTAGGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.571429
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGCGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGCCCTATGGGTTGTAAACCTCTTTTGTCGGGGAGCAAAGGCATCACGTGTGATGCTCCGAGAGTACCCGAAGAAAAAGCATCGGCTAACTC0.461538
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TGAGGAATATTGGTCAATGGGCGGGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTACGGATTGTAAACCTCTTTTGCCGGGGAGCAAAGAGCGGGACGTGTCCCGCGCCGAGAGTACCCGGAGAAAAAGCATCGGCTAACT0.461538
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGGCTGAGGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTATGGATTGTAAACCTCTTTTGCCGGGGAGCAACGACGCCACGTGTGGCGGAAGTGAGAGTACCCGGAGAAAAAGCATCGGCTAACT0.461538
d__Bacteria;p__"Bacteroidetes"TGAGGAATATTGGTCAATGGCCGGGAGGCTGAACCAGCCAAGCCGCGTGAGGGAAGAAGGCCCTACGGGTCGTAAACCTCTTTTGTCAGGGAACAAAAACCGGTACGTGTACCGGGTTGAGTGTACCTGAAGAAAAAGCATCGGCTAACT0.461538
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGCGAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACGGTCCTATGGATTGTAAACCTCTTTTGTCGGGGAGCAATGACGGTCACGAGTGACTGTTGTGAGAGTACCCGAAGAAAAAGCATCGGCTAAC0.461538

Annotations:

common ontology terms
term enrichment score
TermScore
age 3-5 weeks0.800000
algonquin provincial park0.600000
peromyscus maniculatus0.600000
deer mice0.600000
trachemys scripta elegans0.333333
red-eared slider turtle0.333333
turtle farm0.333333
province of ontario0.315789
hainan autonomous prefecture0.250000
captive0.096774
LOWER IN captive0.076923
canada0.075949
wild0.075000
intestine0.068966
LOWER IN wild0.062500
farm0.050000
research facility0.013363
LOWER IN research facility0.012903
china0.011364
feces0.006342
Fraction of dbbact annotations with this term covered by the query
TermScore
age 3-5 weeks0.666667
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
algonquin provincial park0.500000
peromyscus maniculatus0.500000
deer mice0.500000
hainan autonomous prefecture0.250000
province of ontario0.200000
captive0.055556
LOWER IN captive0.055556
LOWER IN wild0.041667
wild0.041667
intestine0.040000
canada0.040000
farm0.027778
research facility0.006803
LOWER IN research facility0.006803
china0.005814
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
age 3-5 weeks1.000000
feces0.750000
canada0.750000
province of ontario0.750000
algonquin provincial park0.750000
peromyscus maniculatus0.750000
deer mice0.750000
research facility0.375000
captive0.375000
wild0.375000
farm0.250000
intestine0.250000
china0.250000
hainan autonomous prefecture0.250000
trachemys scripta elegans0.250000
red-eared slider turtle0.250000
turtle farm0.250000
LOWER IN wild0.125000
LOWER IN research facility0.125000
LOWER IN captive0.125000
Exp. ID User ID Description Date Region Flag Sequences
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 10
590amnondominant farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 11
537amnonhigh freq. in feces of captive grown deer mice feces (dominant feces, research facility, canada, province of ontario, algonquin provincial park, captive, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 19
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 96
537amnoncommon in feces of captive grown deer mice feces (common feces, research facility, canada, province of ontario, algonquin provincial park, captive, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 121
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 163
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358

Problems / suggestions? Please email info AT dbbact DOT org