Summary for ontology term: age 35 days

Number of annotations with term: 14

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTTGGGGACGATTATGACGGTACCCAACAAGAAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGTA0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTTAGGGACGAATCAAGACGGTACCTAACAAGAAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGT0.608696
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTTGGGGACGAATCATGACGGTACCTAACAAGAAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGT0.608696
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAAGGAAGAAGTATCTCGGTATGTAAACTTCTATCAGCAGGGAAGAAAGTGACGGTACCTGACTAAGAAGCCCCGGCTAATTACGTGCCAGCAGCCGCGGTA0.480000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTAGGGAATTTTCGTCAATGGGGGGAACCCTGAACGAGCAATGCCGCGTGAGCGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTAAGAGAAAAACGAGTGCCATAGGGAATGATGGCGCAGTGATGGTATCTTACCAGAAAGCCACGGC0.476190
d__BacteriaTGGGGGATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGGGAAGACGGCCTTCGGGTTGTAAACCTCTGTTCTAAGTGACGAAGAAGTGACGGTAGCTTAGGAGAAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGG0.476190
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGGATATTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGAAGGACGAAGGTTTTCGGATTGTAAACTTCTTTTGTCAGGGACGAAGAAATGACGGTACCTGACGAATAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGG0.476190
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATCTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAGAATGACGGTACCTGACTAAGAAGCTCCGGCTAAATACGTGCCAGCAGCCGCGG0.476190
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTAGGGAATTTTCGTCAATGGGGGGAACCCTGAACGAGCAATGCCGCGTGAGCGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTAAGAGAAAAACGGTCATCATAGGGAATGATGATGAAGTGATGGTATCTTACCAGAAAGCCACGGC0.476190
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCAACGCCGCGTGAAGGAAGAAGGTTTTCGGATCGTAAACTTCTATCAATAGGGACGAAACAAATGACGGTACCTAAATAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG0.476190

Annotations:

common ontology terms
term enrichment score
TermScore
age 35 days0.800000
cobb broiler chicken0.631579
lethbridge0.222222
chicken0.222222
gallus gallus0.210526
cloaca0.160000
broiler chicken0.142857
LOWER IN cloaca0.125000
ileum0.102564
caecum0.098361
LOWER IN ileum0.086957
canada0.062500
male0.058537
LOWER IN caecum0.046512
research facility0.026846
Fraction of dbbact annotations with this term covered by the query
TermScore
age 35 days0.666667
cobb broiler chicken0.500000
lethbridge0.500000
broiler chicken0.142857
chicken0.125000
gallus gallus0.117647
cloaca0.111111
LOWER IN cloaca0.111111
ileum0.062500
LOWER IN ileum0.062500
caecum0.055556
canada0.040000
male0.030303
LOWER IN caecum0.027778
research facility0.013605
Fraction of annotations for the query sequences containing the term
TermScore
research facility1.000000
gallus gallus1.000000
chicken1.000000
age 35 days1.000000
male0.857143
cobb broiler chicken0.857143
caecum0.428571
ileum0.285714
cloaca0.285714
LOWER IN caecum0.142857
LOWER IN ileum0.142857
LOWER IN cloaca0.142857
canada0.142857
broiler chicken0.142857
lethbridge0.142857
Exp. ID User ID Description Date Region Flag Sequences
744amnondominant research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 9
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
744amnondominant research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
756amnondominant research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 24
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
744amnon high in ileum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 47
744amnon high in cloaca compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 70
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
744amnon high in caecum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 187
744amnon high in cloaca compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 265
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
756amnoncommon research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 321

Problems / suggestions? Please email info AT dbbact DOT org