Summary for ontology term: age 6-14 years

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATAAAGGAATAAAGTCGGGTATGTATACCCGTTTGCATGTACTTTATGAATAAGGATCGGCTAACT0.153846
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGCGTTGAGGTTAATAACCTCAGCGATTGACGTTACCCGCAGAAGAAGCACCGGC0.153846
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATACGGGAATAAAGTTAGGCACGTGTGCCTTTTTGTATGTACCGTATGAATAAGGATCGGCTAACT0.133333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGAAGGATGAAGGCTCTATGGGTCGTAAACTTCTTTTATATGGGAATAAAGTTTTCCACGTGTGGAATTTTGTATGTACCATATGAATAAGGATCGGCTAACT0.126582
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGATGGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATATTAGAATAAAGTGCAGTATGTATACTGTTTTGTATGTATAATATGAATAAGGATCGGCTAACT0.125000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTGAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCATGCCGCGTGCAGGAAGACGGCTCTATGAGTTGTAAACTGCTTTTGTACTAGGGTAAACTCAGATACGTGTATCTGACTGAAAGTATAGTACGAATAAGGATCGGCTAACT0.125000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATACGGGAATAAAGTTAGCCACGTGTGGCTTTTTGTATGTACCGTATGAATAAGGATCGGCTAACT0.114286
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCATTTTGTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGATGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTAAGGGAAGAGGAAGGACTGTACCTTACAAGAAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGT0.111111
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGATTTCGGTCTGTAAAGCTCTGTTGTTTATGACGAACGTGCAGTGTGTGAACAATGCATTGCAATGACGGTAGTAAACGAGGAAGCCACGG0.109589

Annotations:

common ontology terms
term enrichment score
TermScore
hangzhou city prefecture0.666667
age 6-14 years0.666667
type 1 diabetes mellitus0.500000
type i diabetes mellitus0.333333
LOWER IN type 1 diabetes mellitus0.250000
LOWER IN type i diabetes mellitus0.200000
child0.054054
china0.011561
control0.010695
LOWER IN control0.010471
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
hangzhou city prefecture0.500000
age 6-14 years0.500000
type 1 diabetes mellitus0.500000
LOWER IN type 1 diabetes mellitus0.500000
type i diabetes mellitus0.250000
LOWER IN type i diabetes mellitus0.250000
child0.027778
china0.005814
control0.005405
LOWER IN control0.005405
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
child1.000000
china1.000000
hangzhou city prefecture1.000000
age 6-14 years1.000000
control0.500000
type i diabetes mellitus0.500000
type 1 diabetes mellitus0.500000
LOWER IN control0.166667
LOWER IN type i diabetes mellitus0.166667
LOWER IN type 1 diabetes mellitus0.166667

Problems / suggestions? Please email info AT dbbact DOT org