Summary for ontology term: age 8 months

Number of annotations with term: 8

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATGCAAGTCTGAAGTGAAAGGACGGGGCTTAACCCTGTGACTGCTTTGGAAACTGTGTAGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTTTTCTAGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGTTGAGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGACTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__SubdoligranulumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAATCTATGGGCTTAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.285714
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGCATGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAGCCTGCTTTCAAAACTGCGTGTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.285714

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGCCCGTCTGGTCGGGAGTCAAAGCCCGGGGCTCAACCCCGGCCCGCTCCCGATACCGGCGGGCTTGAGTCGCGCAGGGGAGGCCGGAATTCCGAGT0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTCATGCAAGCAGGATGTGAAACCCCCGGGCTTAACCTGGGAACTGCATTCTGAACTACATGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGCAGGCGGCGCGCCAAGCGGGACCTCTAACCCCGGGGCTCAACCCCGGGCCGGGTCCCGAACTGGCGCGCTCGGGTGCGGTAGAGGAGAGCGGAATTCCCGGT0.666667
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGTCGGGGGTGAAAACACGGGGCCCAACCCCGTGCCTGCCCCCGAAACCGCCGGGCTCGAGTCCCGCAGGGGATGGCGGAACTCCCGG0.666667
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCGAATTAAGTCAGCGGTGAAAGACCGGGGCTCAACCCTGGAAGTGCCGTTGATACTGATTGGCTAGAATACCCTTGCCGTGGGAGGAATGAGTGG0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTTCATCAAGTAGGATGTGAAATCCCCGGGCTCAACCTGGGAACAGCATACTAAACTGGTGGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.666667
d__BacteriaTACGGAGGATCCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGCAGGCGGGCCCTCAAGCCCGCGGTGAAATGCGGGGGCTCAACCCCCGGACTGCCGCGGGAACTGGGGGCCTTGAGTCGCGGCGAGGGCTGCGGAACGCGGGG0.666667
d__BacteriaTACGGAGGGTGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTTCGTAGGCGGCATGTAAAGTCAGGTGTTAAAGGCTGAGGCTCAACCTCAGTATGGCACTTGATACTTGCAAGCTAGAATGCGGTAGAGGTAAAGGGAATTCCTGG0.666667
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGAATTATTGGGTTTAAAGGGTGCGTAGGCTGTTTGTTAAGTCAGGGGTGAAATACCGCAGCTCAACTGTGGAATTGCCTTTGATACTAGCAGGCTTGAATACTGTTGCCGTGGGAGGAATGAGTAG0.666667
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGAAGTGCAAGTCAGCGGTGAAATCCCCGCGCTCAACGCGGGAGTTGCCGTTGATACTGTACATCTGGAATGCTCTTGCCGTGGGAGGAATGAGTAG0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGTTAAGCGTGTTGTGAAATGTCGCGGCTCAACCGGGGCATTGCAGCGCGAACTGGCAGACTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.545455
d__BacteriaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGCAGGCTAAGCGTGTCGTGAAATCCAGTCGCTCAACGGCTGGCGTGCGGCGCGAACTGGCTTGCTTGAGTACGCGGTACGTTGGCGGAATTCGTGG0.545455
d__BacteriaTACGTAGGTCACGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGAGCAGGCGGCTCGCTAAGTCCGAGGTGAAAGCGTGGGGCTCAACCCCATATAGCCTTGGAAACTGGTGGGCTAGAGTGCGCGAGAGGTCAACGGAACTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGTATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGTAAGCTAAGCGTGCCGTGAAATACCGTCGCTCAACGGCGGCCGTGCGGCGCGAACTGGTTTACTTGAGTACGCGGGACGTTGGCGGAATTTGTGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGTGGGTTAAGCGTGCCGTGAAAATCCGTCGCTCAACGGCGGACTTGCGGCGCGGACTGGTCCACTTGAGTACGCGGAACGTTGGCGGAATTCGTGG0.461538
d__BacteriaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTTTGCAAGCTTGGTGTGAAATACATAGGCTCAACCTATGAACTGCATTGAGAACTACAAGACTTGAGTTACTGAGGTGGAACTGGAATTCCAGG0.461538
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCTCGTAGGTAGTATATCAAGTCAAGGGTGAAATCCCCGCGCTCAACGTGGGAACTGCCTTTGAAACTGATACACTTGAGTGTGTGAGAGGATAGTGGAATTCCAGG0.461538
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCTCGTAGGTAGTATATCAAGTCAAGGGTGAAATCCCCGCGCTCAACGTGGGAACTGCCTTTGAAACTGTTACACTTGAGTGTGTGAGAGGATAGTGGAATTCCAGG0.428571
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTCTTTCAAGTCTGATGTGAAAATCCGGGGCTCAACCCCGGAACTGCATTGGAAACTGTCAGACTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.428571

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
age 6 months0.500000
LOWER IN age 8 months0.500000
rhesus macaque0.500000
age 8 months0.500000
LOWER IN age 6 months0.500000
macaca mulatta0.166667
LOWER IN state of oregon0.166667
state of oregon0.166667
3-month-old human stage0.142857
LOWER IN 3-month-old human stage0.142857
monkey0.071429
captive0.055556
state of california0.038462
LOWER IN state of california0.038462
LOWER IN female0.015873
female0.015873
research facility0.006803
LOWER IN adult0.005780
adult0.005780
united states of america0.004049
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america1.000000
research facility1.000000
macaca mulatta1.000000
monkey1.000000
captive1.000000
rhesus macaque1.000000
age 8 months0.750000
LOWER IN age 8 months0.250000
age 6 months0.125000
3-month-old human stage0.125000
LOWER IN age 6 months0.125000
LOWER IN 3-month-old human stage0.125000
state of california0.125000
LOWER IN state of oregon0.125000
state of oregon0.125000
LOWER IN state of california0.125000
LOWER IN female0.125000
LOWER IN adult0.125000
female0.125000
adult0.125000

Problems / suggestions? Please email info AT dbbact DOT org