Summary for ontology term: age 8 weeks

Number of annotations with term: 34

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__AnaerobiospirillumTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGTAGGCGGATAGTCAAGTAAGGTGTGAAAGCCCCGGGCTCAACCTGGGAACTGCACTTTAAACTAACTATCTAGAGTATTGCAGAGGGAAATGGAATTCCAGG0.060606
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGTGGTCAAGTCAGATGTGAAATCCTGTAGCTTAACTACAGAACTGCATTTGAAACTGACCATCTAGAGTATGGGAGAGGTAGGTGGAATTCTTGG0.060606
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__AnaerobiospirillumTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGTAGGCGGATTGGCAAGCAGGATGTGAAATACCCGGGGCTCAACCTGGGTTGGTCATTCTGAACTGCCTGTCTAGAGTAGTGCAGAGGGAGATGGAATTTTCA0.060606
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCAGGGGGTCAAATGGCGGGGCTCAACCCCGTCCCGCCCCCTGAACCGCCGGGCTCGGGTCCGGTAGGGGAGGGTGGAACACCCGGTG0.060606
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__AnaerobiospirillumTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGTAGGCGGATTGGCAAGCAGGATGTGAAATACCCGGGGCTCAACCTGGGTTGGTCATTCTGAACTGCCTGTCTAGAGTAGTGCAGAGGGAGATGGAATTTCAG0.060606
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__SutterellaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCTGTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAATTGCATTTGTGACTGCAGGACTAGAGTTCATCAGAGGGGGTGGAATTCCAAGT0.060606
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAGT0.060606
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.060606
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGCAGCAAGTCTGATGTGAAAGGCAGGGGCTCAACCCCTGGACTGCATTGGAAACTGTTGATCTTGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.060606
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGGT0.060606

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGCTAAATAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGTATAGCTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTTTATAAGTCAGTGGTGAAAAGCTGTGGCTCAACCATAGTCTTGCCGTTGAAACTGTGGAGCTTGAGTGCGGATGAGGTAGGCGGAACGCGTAG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTTCATAAGTCAGTGGTGAAAAGCTGTGGCTCAACCATAGTCTTGCCGTTGAAACTGTGGAGCTTGAGTGCGGATGAGGTAGGCGGAACGCGTAG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCGAATTAAGTCAGTGGTGAAAAGCTGCAGCTCAACTGTAGTCTTGCCGTTGAAACTGGTTTGCTTGAGAGGAGACGAGGTATGCGGAATGTGTGG0.666667
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTTGGTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGTCAAACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__PsychrobacterTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGTAGGTGGCTTGATAAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATCTGATACTGTTGGGCTAGAGTAGGTGAGAGGGAGGTAGAATTTCAGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGAGAAACTTGAGTGCAGGAGAGGAGAGTAGAATTCCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__HelcococcusTACGTATGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTATGTAGGCGGTTAATTAAGTCTGAATTTAAAGGCTGTGGCTCAACCACGGTTCGGTTTAGAAACTGGTTAACTTGAGTAGATGAGGGGAAAGTGGAATTCCATGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGTTTGCAAGTTGGAAGTGAAAACCATGGGCTCAACCTATGGACTGCTTTCAAAACTGCAGATCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGATTAACCCAAACTAATTATCTTCGGCGTAAAACGTGTCAACTATAAATAAATAAATAGAATTAAAATCCAACTTATATGTGAAAATTCATTGTTAGGACCTAAACTCAATAACGAAAGTAATTCTAGTCATTTATAATACACGACC0.454545
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCTCGGGACTGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.425532
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__LactobacillaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAACTCCATG0.380952
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCCAAGTCAGCGGTAAAAAAGCGGTGCTCAACGCCGTCGAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.357895
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGAAAGTCTGAAGTGAAAGCCCGCGGCTCAACCGCGGAATGGCTTTGGAAACTTTTTTGCTGGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.352941
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCATGGTAAGCCAGAAGTGAAAACCCAGGGCTCAACTCTGTGGATTGCTTTTGGAACTATCAAGCTAGAGTGCTGGAGGGGTAAGCGGAATTCCTC0.341463
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCGTGCCAAGTCAGGAGTGAAAACCCAGGGCCCAACCCTGGGACTGCTCTTGAAACTGACAGGCTTGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.340426
d__BacteriaTACGTAGGAGGCGAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTGACAAGTTGGTAGCGTAACTCCGAGGCTCAACCTCGGCACTACTACCAAAACTGTCGGACTTGAGTGCAGGAGGGGCAATTGGAATTCCTAG0.333333
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGAGTGTAGGCGGCTTAATAAGTTAGATGTGAAATCCCGCGGCTCAACCGCGGAACTGCATCTAAAACTGTTGAGCTGGAGTGCAGGAGAGGTGAGTGGAATTCCTAG0.328358
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTGGCAAGTTAGTAGCGTAACTCCGGAGCTCAACTTCGGAACTACTACTAAAACTGTCGGACTTGAGTGCAGGAGGGGCAACTGGAATTCCTAG0.323529

Annotations:

common ontology terms
term enrichment score
TermScore
age 8 weeks0.834783
taconic farms0.302326
colon0.275862
terminal ileum0.242424
jackson laboratories0.232143
puppy0.227273
right colon0.216216
rectal swab0.187500
LOWER IN taconic farms0.130435
LOWER IN jackson laboratories0.115385
french republic0.107143
free range chicken0.105263
c57bl/60.103586
LOWER IN colon0.100000
ileum0.098765
LOWER IN age 8 weeks0.095238
LOWER IN terminal ileum0.095238
LOWER IN right colon0.090909
canada0.076023
dog0.069767
canis lupus familiaris0.063158
chicken0.060606
LOWER IN ileum0.060606
gallus gallus0.058824
age 2 days0.055556
LOWER IN age 2 days0.055556
age 2-7 years0.055556
LOWER IN puppy0.055556
LOWER IN age 2-7 years0.055556
kingdom of spain0.052632
adult organism0.047619
LOWER IN adult organism0.047619
female organism0.042553
LOWER IN female organism0.042553
farm0.037736
caecum0.037736
mouse0.034301
mus musculus0.031100
research facility0.013485
feces0.012569
LOWER IN feces0.006202
Fraction of dbbact annotations with this term covered by the query
TermScore
age 8 weeks0.750000
puppy0.500000
age 2 days0.500000
LOWER IN age 2 days0.500000
age 2-7 years0.500000
LOWER IN puppy0.500000
LOWER IN age 2-7 years0.500000
free range chicken0.500000
LOWER IN colon0.333333
colon0.333333
LOWER IN age 8 weeks0.250000
taconic farms0.250000
terminal ileum0.250000
LOWER IN terminal ileum0.250000
LOWER IN taconic farms0.250000
rectal swab0.200000
LOWER IN right colon0.200000
right colon0.200000
LOWER IN jackson laboratories0.166667
jackson laboratories0.166667
adult organism0.125000
LOWER IN adult organism0.125000
french republic0.076923
female organism0.076923
LOWER IN female organism0.076923
chicken0.062500
ileum0.062500
LOWER IN ileum0.062500
gallus gallus0.058824
c57bl/60.055556
kingdom of spain0.047619
dog0.043478
canada0.040000
canis lupus familiaris0.038462
farm0.027778
caecum0.027778
mouse0.017544
mus musculus0.015873
research facility0.006803
feces0.006369
LOWER IN feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
age 8 weeks0.941176
research facility0.764706
mus musculus0.764706
c57bl/60.764706
canada0.764706
mouse0.764706
feces0.470588
taconic farms0.382353
jackson laboratories0.382353
colon0.235294
right colon0.235294
ileum0.235294
terminal ileum0.235294
canis lupus familiaris0.176471
french republic0.176471
dog0.176471
rectal swab0.176471
puppy0.147059
LOWER IN feces0.117647
LOWER IN jackson laboratories0.088235
LOWER IN taconic farms0.088235
LOWER IN age 8 weeks0.058824
LOWER IN colon0.058824
LOWER IN right colon0.058824
farm0.058824
caecum0.058824
gallus gallus0.058824
kingdom of spain0.058824
chicken0.058824
free range chicken0.058824
LOWER IN ileum0.058824
LOWER IN terminal ileum0.058824
age 2 days0.029412
LOWER IN age 2 days0.029412
female organism0.029412
adult organism0.029412
age 2-7 years0.029412
LOWER IN puppy0.029412
LOWER IN female organism0.029412
LOWER IN adult organism0.029412
LOWER IN age 2-7 years0.029412
Exp. ID User ID Description Date Region Flag Sequences
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 11
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 12
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 17
495amnondominant farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 18
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 18
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 18
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 22
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 22
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 23
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 25
766amnondominant feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 26
766amnon high in age 8 weeks puppy compared to female organism adult organism age 2-7 years in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 27
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 27
766amnoncommon feces, canis lupus familiaris, french republic, dog, age 8 weeks, rectal swab, puppy2021-04-12v4No1 / 28
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 41
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 51
766amnon high in age 2 days compared to age 8 weeks in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 86
766amnon high in female organism adult organism age 2-7 years compared to age 8 weeks puppy in feces canis lupus familiaris french republic dog rectal swab 2021-04-12v4No1 / 101
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 108
538amnon high in jackson laboratories compared to taconic farms in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 110
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 119
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 120
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 130
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 132
766amnon high in age 8 weeks compared to age 2 days in feces canis lupus familiaris french republic dog rectal swab puppy 2021-04-12v4No1 / 133
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 140
538amnon high in jackson laboratories compared to taconic farms in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 154
538amnon high in jackson laboratories compared to taconic farms in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 172
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 182
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 186
495amnoncommon farm, caecum, gallus gallus, kingdom of spain, chicken, free range chicken, age 8 weeks2019-03-03v4No1 / 189

Problems / suggestions? Please email info AT dbbact DOT org