Summary for ontology term: agricultural field

Number of annotations with term: 157

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACAGAGGAGCCAAGCGTTGTCCGGATTGACTGGGCGTAAAGCGCACGCAGGCGGATGTGCGCGTGGGGTGTGAAATCTGGCCGCTTAACGGCCAGGCGCCATCCCATACGGCACGTCTGGAGCAATGCAGAGGTCGGTGGAATTGCCGG0.019355
d__BacteriaTACGTAGGGTCCGAGCGTTGTCCGGAGTTACTGGGCGTAAAGCGCGCGCAGGCGGCTCGTTAAGACCGGCGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCGTTGGTGACTGGCGGGCTTGAAGCCAGCAGGGGCAGGTGGAATTCCCGG0.019355
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACAGAGGTGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGTGGCCTTTTGAGTCAGACGTGAAATCCCCCGGCTTAACCTGGGAACTGCGTCTGATACTGGAAGGCTCGAGTTCGGGAGAGGGATGTGGAATTCCAGG0.019355
d__Bacteria;p__candidate division WPS-1;g__WPS-1_genera_incertae_sedisGACAGAGGTGCCGAGCGTTAGGCGGAATCACTGGGCTTAAAGCGTGTGTAGGCGGACCGTTAAGTACCTTGTGAAATCCCACGGCTCAACCGTGGAACGGCTGGGTATACTGGCGGTCTTGAGCCACCTAGGGGCGAGCGGAACAAGCGG0.019355
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__SphingomonadalesTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCCATTTAAGTCAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTGAGACTGGATGGCTAGAATCTTGGAGAGGCGAGTGGAATTCCGAG0.019355
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTTACGTCGGATGTGAAAACCCGAGGCTTAACCTCGGGCCTGCATTCGATACGGGCAGACTCGAGTGTGGTAGGGGAGACTGGAACTCCTGG0.019355
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTCTTAAGTCAGGGGTGAAATCCCGGAGCTCAACTCCGGAACTGCCTTTGATACTGAGAATCTCGAGTCCGGGAGAGGTGAGTGGAACTCCGAG0.019355
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.019355
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Microbacteriaceae;g__MicrobacteriumTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAATCCCGAGGCTCAACCTCGGGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.019355
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGCGTAGGCGGCTAATTAAGTCAAATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTAGCTAGAGTGTGGGAGAGGATGGTAGAATTCCAGG0.019355

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaGACGTAGGGGGCGAGCGTTGTCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGTAAGTCGGGTGTGAAATCCTGGGGCTCAACCCCAGGACTGCACTCGATACTGCCAGGCTAGAGGTAGGTAGGGGAGATCGGAATTCCTGG0.750000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.750000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.750000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__EnhydrobacterTACAGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGTGTAGGTGGCTCATTAAGTCACATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATGTGATACTGGTGGTGCTAGAATATGTGAGAGGGAAGTAGAATTCCAG0.750000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.750000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__MicrococcusTACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGTCGTGAAAGTCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.750000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Intrasporangiaceae;g__JanibacterTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAATCCGGGGCTCAACCCCGGACTTGCAGTGGGTACGGGCAGACTAGAGTGTGGTAGGGGAGACTGGAATTCCTGG0.750000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTTTGTGTAAGCCCGCAGCTTAACTGCGGGACTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG0.750000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCATAACTTGAGTACTGTAGGGGTAACTGGAATTCCTG0.750000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGAAACTGGCAAGCTAGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.750000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGGGTGATGAAGGCCCTAGGGTTGTAAAGCCCTTTCGGCGGGGAAGATAATGACGGTACCCGCAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.339506
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGGGAAGAACAAGTACGAGAGTAACTGCTCGTACCTTGACGGTACCTAACCAGAAAGCCACGGC0.326241
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCTCTTTTACCCGGGATGATAATGACAGTACCGGGAGAATAAGCCCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.306407
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillaceae 1;g__BacillusTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGCTTTCGGGTCGTAAAACTCTGTTGTTAGGGAAGAACAAGTGCTAGTTGAATAAGCTGGCACCTTGACGGTACCTAACCAGAAAGCCACGG0.304965
d__BacteriaTGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGTGGGATGACGGCCTTCGGGTTGTAAACCACTGTCGGGAGGGACGAATGCGCCGCAAGGCGAGTGACGGTACCTCCAAAGGAAGCACCGGCTAACTCCGTGC0.290909
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGTAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAGAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.287823
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTGGGGAATCTTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTCAGGAGGGACGAAGCCACTCGGGTTAATAGCCCAGAGGGTGACGGTACCTCCAGAAGAAGCCCCGGCT0.282609
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__RhodospirillaceaeTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATGCCGCGTGAGTGATGAAGGCCTTCGGGTTGTAAAGCTCTTTTGCCAGGGACGATGATGACGGTACCTGGAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.282443
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGTAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAGAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.280936
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__BradyrhizobiaceaeTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTGTGCGGGAAGATAATGACGGTACCGCAAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.278552

Annotations:

common ontology terms
term enrichment score
TermScore
agricultural field0.751043
zea mays0.411985
united states0.276498
nicollet soil series0.276498
des moines0.276498
alabama0.262911
ultisol0.262911
iowa0.242915
auburn0.232365
maize field0.208410
luancheng county0.197309
loam soil0.195652
kingdom of denmark0.189781
upland soil0.169312
late weichselian glaciation0.169312
clayey till0.169312
lund0.169312
shaanxi province0.169312
fertilized soil0.164794
triticum aestivum0.162257
soil0.161483
loess plateau0.156098
glycine max0.134680
foot slope 0.132597
depth (soil) 0-15cm0.126801
silt loam0.126482
kaiyang county0.122905
guizhou province0.122905
ames0.112994
kanawha0.112994
subsurface drainage0.112994
kelley0.112994
depth (soil) 15-30cm0.105572
depth (soil) 60-90cm0.102857
after 6 years0.102857
wheat0.096618
ph 70.096618
bulk soil0.095491
neve yaar0.092486
preston flats0.092486
luvisol0.092486
grand river watershed0.092486
rare charitable research reserve0.092486
depth (soil) 0-10cm0.090090
cambridge0.081218
province of ontario0.078049
irrigated0.075676
lower saxony0.071006
sandy soil0.071006
depth (soil) 30-60cm0.068571
ph 50.064171
biochar0.058537
unamended soil0.058140
israel0.054608
ph 7.90.049080
depth 50-70cm0.048485
depth 0-40cm0.048485
high biochar0.048485
ph 7.40.048485
depth 75cm0.048485
depth 175cm0.048485
depth 350cm0.048485
depth 800cm0.048485
depth (soil) 25-50cm0.047337
ph 7.70.047337
rhizosphere0.046377
canada0.040302
depth 70-100cm0.036810
depth 50-90cm0.036810
depth 40-100cm0.036810
depth 100-300cm0.036810
robinia pseudoacacia0.036810
reforestation0.036810
LOWER IN reforestation0.036810
LOWER IN robinia pseudoacacia0.036810
depth 0-15cm0.036810
depth 15-30cm0.036810
LOWER IN depth (soil) 60-90cm0.036810
LOWER IN depth 75cm0.036810
depth (soil) 10-25cm0.036145
LOWER IN depth (soil) 0-15cm0.036145
depth (water) 10cm0.035503
germany0.034384
LOWER IN zea mays0.032086
LOWER IN agricultural field0.031088
china0.030831
LOWER IN depth 50-70cm0.024845
depth 30-50cm0.024845
depth 90-100cm0.024845
plough layer 0.024845
sandy till 0.024845
depth 70-120cm0.024845
depth 200-260cm0.024845
depth 300-350cm0.024845
clay soil0.024845
loam0.024845
loamy sand soil0.024845
depth 450-480cm0.024845
depth 550-600cm0.024845
LOWER IN depth 200-350cm0.024845
Fraction of dbbact annotations with this term covered by the query
TermScore
maize field0.750000
agricultural field0.666667
depth (soil) 0-15cm0.666667
depth (soil) 15-30cm0.666667
loam soil0.666667
ph 7.90.666667
depth 70-100cm0.500000
alabama0.500000
upland soil0.500000
ultisol0.500000
LOWER IN depth 50-70cm0.500000
depth 50-70cm0.500000
LOWER IN depth 70-100cm0.500000
foot slope 0.500000
depth 30-50cm0.500000
depth 50-90cm0.500000
depth 90-100cm0.500000
LOWER IN depth 50-90cm0.500000
plough layer 0.500000
late weichselian glaciation0.500000
clayey till0.500000
lund0.500000
sandy till 0.500000
depth 70-120cm0.500000
depth 200-260cm0.500000
depth 300-350cm0.500000
neve yaar0.500000
clay soil0.500000
loam0.500000
loamy sand soil0.500000
depth 450-480cm0.500000
depth 550-600cm0.500000
LOWER IN depth 200-350cm0.500000
depth 20-120cm0.500000
LOWER IN depth 20-120cm0.500000
depth 200-350cm0.500000
LOWER IN depth 450-600cm0.500000
depth 450-600cm0.500000
depth 0-40cm0.500000
zea mays0.500000
shaanxi province0.500000
depth 40-100cm0.500000
depth 100-300cm0.500000
LOWER IN depth 40-100cm0.500000
LOWER IN depth 0-40cm0.500000
LOWER IN depth 100-300cm0.500000
robinia pseudoacacia0.500000
reforestation0.500000
10 years0.500000
LOWER IN 10 years0.500000
LOWER IN reforestation0.500000
LOWER IN robinia pseudoacacia0.500000
20 years0.500000
LOWER IN 20 years0.500000
LOWER IN 30 years0.500000
30 years0.500000
high biochar0.500000
low biochar0.500000
straw0.500000
soil unamended with straw0.500000
LOWER IN soil amended with straw0.500000
soil amended with straw0.500000
LOWER IN soil unamended with straw0.500000
depth 0-15cm0.500000
preston flats0.500000
luvisol0.500000
grand river watershed0.500000
rare charitable research reserve0.500000
depth 15-30cm0.500000
depth 30-45cm0.500000
LOWER IN depth 15-30cm0.500000
LOWER IN depth 0-15cm0.500000
united states0.500000
nicollet soil series0.500000
ames0.500000
des moines0.500000
ph 7.40.500000
depth (soil) 60-90cm0.500000
LOWER IN depth (soil) 60-90cm0.500000
kanawha0.500000
ph 7.10.500000
ph 8.10.500000
ph 8.30.500000
subsurface drainage0.500000
ph 6.20.500000
kelley0.500000
depth 75cm0.500000
depth 175cm0.500000
depth 350cm0.500000
depth 800cm0.500000
depth 1000cm0.500000
LOWER IN depth 75cm0.500000
LOWER IN depth 175cm0.500000
LOWER IN depth 350cm0.500000
LOWER IN depth 800cm0.500000
LOWER IN depth 1000cm0.500000
lower saxony0.500000
sandy soil0.500000
kaiyang county0.500000
guizhou province0.500000
Fraction of annotations for the query sequences containing the term
TermScore
agricultural field0.859873
soil0.859873
zea mays0.350318
china0.312102
united states0.191083
nicollet soil series0.191083
des moines0.191083
iowa0.191083
alabama0.178344
auburn0.178344
ultisol0.178344
kingdom of denmark0.165605
triticum aestivum0.146497
luancheng county0.140127
fertilized soil0.140127
glycine max0.127389
maize field0.121019
loam soil0.114650
upland soil0.101911
late weichselian glaciation0.101911
clayey till0.101911
lund0.101911
silt loam0.101911
loess plateau0.101911
shaanxi province0.101911
foot slope 0.076433
depth (soil) 0-15cm0.070064
kaiyang county0.070064
guizhou province0.070064
depth (soil) 0-10cm0.063694
wheat0.063694
ph 70.063694
ames0.063694
kanawha0.063694
subsurface drainage0.063694
kelley0.063694
depth (soil) 15-30cm0.057325
depth (soil) 60-90cm0.057325
bulk soil0.057325
after 6 years0.057325
neve yaar0.050955
israel0.050955
preston flats0.050955
luvisol0.050955
grand river watershed0.050955
canada0.050955
province of ontario0.050955
cambridge0.050955
rare charitable research reserve0.050955
rhizosphere0.050955
irrigated0.044586
depth (soil) 30-60cm0.038217
ph 50.038217
lower saxony0.038217
sandy soil0.038217
germany0.038217
biochar0.038217
unamended soil0.031847
depth (soil) 25-50cm0.025478
depth 50-70cm0.025478
depth 0-40cm0.025478
high biochar0.025478
ph 7.40.025478
ph 7.70.025478
ph 7.90.025478
depth 75cm0.025478
depth 175cm0.025478
depth 350cm0.025478
depth 800cm0.025478
depth 70-100cm0.019108
depth (soil) 10-25cm0.019108
depth 50-90cm0.019108
depth 40-100cm0.019108
depth 100-300cm0.019108
LOWER IN agricultural field0.019108
LOWER IN zea mays0.019108
robinia pseudoacacia0.019108
reforestation0.019108
LOWER IN reforestation0.019108
LOWER IN robinia pseudoacacia0.019108
depth 0-15cm0.019108
depth 15-30cm0.019108
LOWER IN depth (soil) 0-15cm0.019108
LOWER IN depth (soil) 60-90cm0.019108
depth (water) 10cm0.019108
LOWER IN depth 75cm0.019108
LOWER IN depth (soil) 25-50cm0.012739
LOWER IN depth 50-70cm0.012739
depth 30-50cm0.012739
depth 90-100cm0.012739
depth (soil) 20-30cm0.012739
plough layer 0.012739
sandy till 0.012739
depth 70-120cm0.012739
depth 200-260cm0.012739
depth 300-350cm0.012739
clay soil0.012739
loam0.012739
loamy sand soil0.012739
depth 450-480cm0.012739
Exp. ID User ID Description Date Region Flag Sequences
768sheryoDom inant in maize fields in Brittany, France (dominant zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1
827sheryoDominant in soil at 25cm depth in clayey till loam soil, Lund Denmark (dominant depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 3
837sheryoDominant in agricultural field at depths 0-40cm, shaanxi, China (dominant depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 3
801sheryoDominant in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (dominant united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 3
801sheryoDominant at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (dominant subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 3
631sheryodominant in maize field unamended bulk soil (dominant bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 3
631sheryodominant in maize field biochar amended bulk soil, after 6 years of biochar amended (dominant ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 3
827sheryoDominant in soil at 95cm depth in clayey till loam soil, Lund Denmark (dominant sandy till , depth 70-120cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 4
801sheryoDominant at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (dominant ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 4
801sheryoDominant at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (dominant depth (soil) 60-90cm, ph 7.9, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 4
631sheryoDominant in maize field biochar amended rhizosphere soil (dominant ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 4
823sheryoDominant at 0-15cm depth in foot slope ultisol soil in auburn, alabama (dominant foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 5
801sheryoDominant at depth 0-15cm in corn agriculture fields, Iowa USA (dominant kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 5
801sheryoDominant at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (dominant ph 6.7, depth (soil) 30-60cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 5
837sheryoDominant in agricultural field at depths 100-300cm, shaanxi, China (dominant depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 6
842sheryoDominant in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (dominant depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (dominant depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 6
801sheryoDominant at depth 15-30cm in corn agriculture fields, Iowa USA (dominant kanawha, depth (soil) 15-30cm, nicollet soil series, ph 7.7, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 6
801sheryoDominant at depth 60-90cm in corn agriculture fields, Iowa USA (dominant depth (soil) 60-90cm, ph 8.3, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 6
631sheryodominant in maize field unamended rhizosphere soil (dominant unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 6
823sheryoDominant at 15-30cm depth in foot slope ultisol soil in auburn, alabama (dominant depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 7
827sheryoDominant in soil at 325cm depth in clayey till loam soil, Lund Denmark (dominant depth 300-350cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 7
837sheryoDominant in agricultural field at depths 40-100cm, shaanxi, China (dominant depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 8
610sheryoDominant in agricultural field soil (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, triticum aestivum)2020-04-21v3No1 / 8
801sheryoDominant in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (dominant ph 7.7, depth (soil) 60-90cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 8
855sheryoDopminant in soil depth of 10cm in fertilized soil in china (dominant luancheng county, china, agricultural field, depth (water) 10cm, fertilized soil, soil)2021-12-27v3No1 / 8
761sheryoDominant in bulk sandy soil maize field in Germany (dominant ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 8
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, low biochar)2020-04-21v3No1 / 9
801sheryoDominant in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (dominant ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 9
801sheryoDominant in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (dominant depth (soil) 30-60cm, ph 7.4, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 9
801sheryoDominant at depth 30-60cm in corn agriculture fields, Iowa USA (dominant ph 8.1, depth (soil) 30-60cm, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 9
823sheryoDominant at 0-10cm depth in ultisol soil in auburn, alabama (dominant depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 9
823sheryoDominant at 30-50cm depth in foot slope ultisol soil in auburn, alabama (dominant depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 10
662amnondominant loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 10
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, straw)2020-04-21v3No1 / 10
662amnondominant clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 11
823sheryoDominant at 10-25cm depth in ultisol soil in auburn, alabama (dominant depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 11
827sheryoDominant in soil at 575cm depth in clayey till loam soil, Lund Denmark (dominant depth 550-600cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 12
842sheryoDominant in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (dominant depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 12
855sheryoDominant in soil depth of 75cm in fertilized soil in china (dominant depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 12
827sheryoDominant in soil at 465cm depth in clayey till loam soil, Lund Denmark (dominant depth 450-480cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 13
761sheryoDominant in maize rhizosphere sandy soil maize field in Germany (dominant zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 13
662amnondominant loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 14
827sheryoDominant in soil at 230cm depth in clayey till loam soil, Lund Denmark (dominant depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 15
823sheryoDominant at 50-90cm depth in foot slope ultisol soil in auburn, alabama (dominant depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 17
823sheryoDominant at 90-100cm depth in foot slope ultisol soil in auburn, alabama (dominant depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 18
823sheryoDopminant at 25-50cm depth in ultisol soil in auburn, alabama (dominant depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 18
855sheryoDominant in soil depth of 350cm in fertilized soil in china (dominant depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 19
855sheryoDominant in soil depth of 800cm in fertilized soil in china (dominant depth 800cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 19
855sheryoDominant in soil depth of 1000cm in fertilized soil in china (dominant depth 1000cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 19
855sheryoDominant in soil depth of 175cm in fertilized soil in china (dominant depth 175cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 20
823sheryoDominant at 50-70cm depth in ultisol soil in auburn, alabama (dominant depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 20
610sheryoHigher in agricultural field soil unamended with straw ( high in soil unamended with straw compared to soil amended with straw in triticum aestivum ph 7 wheat kingdom of denmark agricultural field soil )2020-04-21v3No1 / 22
823sheryoDominant at 70-100cm depth in ultisol soil in auburn, alabama (dominant depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 23
610sheryoHigher in agricultural field soil amended with straw ( high in soil amended with straw compared to soil unamended with straw in triticum aestivum ph 7 wheat kingdom of denmark agricultural field soil )2020-04-21v3No1 / 34
823sheryoHigher in 70-100cm depth compared to 50-70cm depth in ultisol soil in auburn, alabama ( high in depth 70-100cm compared to depth 50-70cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-08v3No1 / 39
837sheryoHigher in agricultural field at depths 40-100cm compared to 0-40cm, shaanxi, China ( high in depth 40-100cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 42
837sheryoHigher in agricultural field at depths 100-300cm compared to 0-40cm, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 81
855sheryoHigher in soil depth of 75cm compared to soil depth of 350cm in fertilized soil in china ( high in depth 175cm compared to depth 350cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 91
837sheryoHigher in agricultural field at depths0-40cm compared to 40-100cm, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 95
855sheryoHigher in soil depth of 1000cm compared to soil depth of 800cm in fertilized soil in china ( high in depth (water) 1000m compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 103
631sheryoHigher in maize field biochar amended rhizosphere soil compared to unamended rhizosphere soil ( high in biochar compared to unamended soil in rhizosphere china guizhou province kaiyang county soil maize field after 6 years )2020-06-02v3No1 / 108
855sheryoHigher in soil depth of 800cm compared to soil depth of 350cm in fertilized soil in china ( high in depth 800cm compared to depth 350cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 111
823sheryoHigher in 50-70cm depth compared to 70-100cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth 70-100cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-08v3No1 / 127
855sheryoCommon in soil depth of 1000cm in fertilized soil in china (common depth 1000cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 127
855sheryoHigher in soil depth of 800cm compared to soil depth of 1000cm in fertilized soil in china ( high in depth 800cm compared to depth 1000cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 128
827sheryoHigher in soil depth of 275cm compared to soil depth of 60cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 20-120cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 129
823sheryoHigher in 50-70cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 135
827sheryoHigher in soil depth of 465cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 450-600cm compared to depth 200-350cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 137
855sheryoCommon in soil depth of 800cm in fertilized soil in china (common depth 800cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 142
662amnon high in irrigated compared to dry in neve yaar depth (soil) 0-10cm soil agricultural field israel 2020-09-21v3No1 / 146
823sheryoHigher in 25-50cm depth compared to 50-70cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth 50-70cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 161
855sheryoCommon in soil depth of 175cm in fertilized soil in china (common depth 175cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 173
631sheryoHigher in maize field biochar amended bulk soil, after 6 years of biochar amended, compared to unamended soil ( high in biochar compared to unamended soil in china guizhou province kaiyang county soil maize field bulk soil after 6 years )2020-06-02v3No1 / 188
827sheryoHigher in soil depth of 275cm compared to soil depth of 465cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 450-600cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 197
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 200
631sheryoHigher in maize field unamended bulk soil, after 6 years of biochar amended, compared to biochar amended soil ( high in unamended soil compared to biochar in china guizhou province kaiyang county soil maize field bulk soil after 6 years )2020-06-02v3No1 / 201
855sheryoHigher in soil depth of 350cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 350cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 217
855sheryoCommon in soil depth of 350cm in fertilized soil in china (common depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 242
823sheryoHigher in 25-50cm depth compared to 10-25cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 283
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 294
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in lund kingdom of denmark agricultural field clayey till late weichselian glaciation loam soil )2021-09-13v3No1 / 295
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common depth 550-600cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 318
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 321
855sheryoHigher in soil depth of 175cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 175cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 334
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 369
801sheryoHigher at depth 60-90cm compared to depth0-15cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 386
662amnoncommon clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 402
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 418
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 431
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 459
662amnoncommon loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 489
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 501
823sheryoHigher at 50-90cm depth compared to 15-30cm depth in foot slope ultisol soil in auburn, alabama ( high in depth 50-90cm compared to depth (soil) 15-30cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 539
842sheryoHigher in soil depth 15-30cm compared soil depth of 0-15cm to in a zea mays agricultural field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 598
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common kanawha, depth (soil) 15-30cm, nicollet soil series, ph 7.7, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 598
662amnoncommon loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 609
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 620
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common depth 200-260cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 644
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common ph 7.7, depth (soil) 60-90cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 650
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 7.9, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 667
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common ph 8.1, depth (soil) 30-60cm, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 703
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 753
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common ph 6.7, depth (soil) 30-60cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 760
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 8.3, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 764
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
662amnon high in dry compared to irrigated in neve yaar depth (soil) 0-10cm soil agricultural field israel 2020-09-21v3No1 / 782
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common depth 450-480cm, lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil)2021-09-13v3No1 / 786
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common depth (soil) 30-60cm, ph 7.4, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common lund, kingdom of denmark, agricultural field, clayey till, late weichselian glaciation, loam soil, depth 300-350cm)2021-08-24v3No1 / 866
855sheryoCommon in soil depth of 75cm in fertilized soil in china (common depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 873
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 905
842sheryoHigher in soil depth of 0-15cm compared to soil depth 15-30cm in a zea mays agricultural field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 924
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 1102
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common depth (soil) 20-30cm, plough layer , loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1111
855sheryoHigher in soil depth of 75cm compared to soil depth of 10cm in fertilized soil in china ( high in depth 75cm compared to depth (water) 10cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1112
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common sandy till , depth 70-120cm, loam soil, late weichselian glaciation, clayey till, agricultural field, kingdom of denmark, lund)2021-08-24v3No1 / 1142
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
855sheryoHigher in soil depth of 75cm compared to soil depth of 175cm in fertilized soil in china ( high in depth 75cm compared to depth 175cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1522
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661

Problems / suggestions? Please email info AT dbbact DOT org