Summary for ontology term: amerindian

Number of annotations with term: 22

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTCAATTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.150000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__MoraxellaTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTATTTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATCTGATACTGGATAACTAGAGTAGGTGAGAGGGGAGTAGAATTCCAGG0.150000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.150000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.150000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGAGTGCGCAGGCGGTTTTGCAAGACCGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTGGTGACTGCAAGGCTAGAGTGTGTCAGAGGGAGGTGGAACTCCGCA0.100000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.100000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.100000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGAACAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGTTCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.100000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CatenibacteriumTACGTAGGTGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGAGGGAGCAGGCGGCCGCAAGGGTCTGTGGTGAAAGACCGAAGCTAAACTTCGGTGAGCCATGGAAACCGGGCGGCTAGAGTGCGGAAGAGGATCGTGGAATTCCATGT0.100000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCTGATAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGTGAGACTTGAGTGCGCGGGAAGTAGGCGGAATTCGTCG0.100000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGCATGACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGAGGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__StreptobacillusTACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCTTAAAGGGCATCTAGGCGGTTTTTCAAGTCAGGGGTGAAAACTTATGGCTCAACCATAAGCTTGCCTTTGAAACTGAAAAACTAGAGTACTGGAAAGGTGGGTGGAACTACACG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCAGTCTTGAGTACAGTTGAGGTAGGCGGAATTCGTGG0.500000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCTTACAAGTCAGGGGTGAAAACCTGCGGCTCAACCGCAGGCCTGCCTTTGAAACTGTTAGGCTGGAGTACCGGAGAGGTGGACGGAACTGCACG0.500000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCTGACAAGTCAGGGGTGAAAACCTGCGGCTCAACCGCAGGCCTGCCTTTGAAACTGACAGGCTGGAGTACCGGAGAGGTGGACGGAACTGCACG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__OribacteriumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTTGTTCTAGAGTGTTGGAGAGGTAAGTGGAATTCCTGG0.250000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGCGTAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTATGTAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCCAG0.307692
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGAGTGCGCAGGCGGTTTTGCAAGACCGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTGGTGACTGCAAGGCTAGAGTGTGTCAGAGGGAGGTGGAACTCCGCA0.260870
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.258065
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTTGTCGCGTCTGCCGTGAAAAATCCGGGCTTAACCCGGATCGTGCGGTGGGTACGGGCTGGCTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.250000
d__Archaea;p__"Euryarchaeota";c__Halobacteria;o__Halobacteriales;f__HalobacteriaceaeTACCGGCAGCACGAGTGATAGCCACTATTATTGGGCCTAAAGCGTCCGTAGCCGGCCGAACAGGTCCATCGGGAAATCCACCCGCTCAACGGGTGGACGTCCGGTGGAAACCAGTCGGCTTGGGGCCGGAAGACCAGAGGGGTACGTCCG0.250000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGCGCACGTAGGTGGTTCGACAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGATGTGCATTTGAAACTGTTGGACTCGAGTACTGTAGAGGGAGGTAGAATTCCAGG0.245614
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__StreptobacillusTACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCTTAAAGGGCATCTAGGCGGTTTTTCAAGTCAGGGGTGAAAACTTATGGCTCAACTATAAGCTTGCCTTTGAAACTGAAAGACTAGAGTACTGGAAAGGTGGGTGGAACTACACG0.235294
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__KocuriaTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGCCCGGGGCTTAACCCCGGGTGTGCAGTGGGTACGGGCAGACTTGAGTGCAGTAGGGGAGACTGGAACTCCTGG0.232558
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGGTGCAAGCGTTATCCGGACTTATTGGGTTTAAAGGGTCCGTAGGCGGGTTATTAAGTCAGTGGTGAAATCTCATAGCTCAACTATGAAACTGCCATTGATACTGATAGTCTTGAGTATATTTGAAGTAGCTGGAATAAGTAG0.210526
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTCGCCGATTAAGTCAGCGGTGAAATCCAGTGGCTCAACCATTGGACTGCCGTTGAAACTGGCCGGCTTGAGTATGATTGAGGCAGGCGGAATGCGTGG0.195122

Annotations:

common ontology terms
term enrichment score
TermScore
venezuela0.752475
amerindian0.752475
hunter gatherer0.633333
LOWER IN venezuela0.193548
LOWER IN amerindian0.193548
LOWER IN hunter gatherer0.176471
arm0.142857
skin0.099174
LOWER IN obsolete_juvenile stage0.095238
obsolete_juvenile stage0.095238
saliva0.077670
LOWER IN city0.073171
city0.073171
LOWER IN infant0.054054
infant0.054054
homo sapiens0.014652
feces0.012520
adult0.010870
LOWER IN adult0.010870
LOWER IN united states of america0.007864
united states of america0.007864
Fraction of dbbact annotations with this term covered by the query
TermScore
venezuela0.666667
amerindian0.666667
hunter gatherer0.500000
LOWER IN venezuela0.333333
LOWER IN amerindian0.333333
arm0.333333
LOWER IN hunter gatherer0.250000
LOWER IN obsolete_juvenile stage0.100000
obsolete_juvenile stage0.100000
skin0.060606
LOWER IN city0.050000
city0.050000
saliva0.043478
LOWER IN infant0.038462
infant0.038462
homo sapiens0.007380
feces0.006369
adult0.005780
LOWER IN adult0.005780
LOWER IN united states of america0.004049
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
venezuela0.863636
amerindian0.863636
hunter gatherer0.863636
feces0.363636
saliva0.363636
skin0.272727
LOWER IN united states of america0.136364
LOWER IN city0.136364
united states of america0.136364
city0.136364
LOWER IN venezuela0.136364
LOWER IN amerindian0.136364
LOWER IN hunter gatherer0.136364
adult0.090909
LOWER IN infant0.090909
LOWER IN obsolete_juvenile stage0.090909
infant0.090909
obsolete_juvenile stage0.090909
LOWER IN adult0.090909
arm0.090909
Exp. ID User ID Description Date Region Flag Sequences
371amnondominant feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 11
75amnondominant homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
371amnondominant homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 14
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 15
371amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 15
75amnondominant feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 15
371amnonnegatively correlated with age in amerindian saliva ( high in infant obsolete_juvenile stage compared to adult in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 16
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to infant obsolete_juvenile stage in homo sapiens saliva venezuela amerindian hunter gatherer )2018-09-06v4No1 / 17
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
371amnonhigher in saliva of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens saliva )2018-09-06v4No1 / 24
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela amerindian hunter gatherer )2018-09-06v4No1 / 27
371amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 43
371amnonlower in saliva of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens saliva )2018-09-06v4No1 / 60
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
75amnoncommon homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 129
75amnoncommon homo sapiens, arm, skin, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
371amnoncommon homo sapiens, skin, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens skin )2018-09-06v4No1 / 195
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
75amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854

Problems / suggestions? Please email info AT dbbact DOT org