Summary for ontology term: animal body or body part

Number of annotations with term: 2877

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.004248
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.004248
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.003540
d__BacteriaGACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAAGTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG0.003540
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.003186
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.002832
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.002832
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.002832
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.002832
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.002832

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.164948
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__MicrococcusTACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGTCGTGAAAGTCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.123711
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.113402
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.113402
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.103093
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.103093
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.103093
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTTGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGGTGGCAGGCGATACGGGCATAACTAGAGTGCTGTAGGGGAGACTGGAATTCCTG0.103093
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGCGTAGGTGGCCAATTAAGTCAAATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTGGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.103093
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTCTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.103093

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.323212
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.277680
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.263585
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.250759
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.250376
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.247069
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.234679
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.233150
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.228923
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.228659

Annotations:

common ontology terms
term enrichment score
TermScore
feces0.836615
homo sapiens0.605296
united states of america0.402931
adult0.390060
research facility0.296552
china0.197662
mus musculus0.195370
mouse0.180344
saliva0.157455
child0.148567
control0.148060
infant0.108533
female0.103768
LOWER IN control0.095544
intestine0.084411
wild0.077047
italy0.075155
canis lupus familiaris0.071051
c57bl/60.066144
male0.065407
dog0.063323
zoological garden0.062559
farm0.060206
stomach0.059901
captive0.059593
germany0.056865
monkey0.048241
kingdom of spain0.047314
human adult stage0.046525
supragingival plaque0.046345
supragingival dental plaque0.045128
rat0.045121
city0.040819
sweden0.040758
mucus0.040057
australia0.039869
rural community0.038792
canada0.038020
state of california0.036986
c57bl/6j0.036112
japan0.034305
adult organism0.033843
dentition0.033422
rattus norvegicus0.031107
obesity0.030089
bird0.029877
ant0.028571
equus caballus0.027954
female organism0.027712
macaca mulatta0.027276
sprague dawley0.027265
south korea0.027146
costa rica0.027054
israel0.027009
state of new york0.026527
horse0.025879
digestive system0.025624
rumen0.025450
ruminal fluid0.025395
sus scrofa0.024481
commonwealth of pennsylvania0.023915
obsolete_juvenile stage0.023847
united kingdom0.023833
french republic0.023529
brazil0.022620
pig0.022482
subgingival plaque0.022390
bos taurus0.022177
coral0.022071
subgingival dental plaque0.022001
tongue0.021966
mouse chow0.021880
kenya0.021761
high fat diet0.021275
amsterdam0.020587
formula fed0.020569
cow0.020387
jackson laboratories0.019926
ocean0.019877
kingdom of the netherlands0.019761
larval stage0.019697
2-year-old human stage0.019277
crohn's disease0.019227
balb/c0.019215
hispanic or latin american0.019215
pregnancy0.019195
state of georgia0.019166
antibiotic0.019160
panama0.019002
diet0.018995
oral cavity0.018913
LOWER IN feces0.018761
homosexual0.018561
msm0.018561
1-year-old human stage0.018458
south africa0.018131
thailand0.017886
guangzhou city prefecture0.017872
rectal swab0.017872
breast fed0.017859
Fraction of dbbact annotations with this term covered by the query
TermScore
supragingival dental plaque1.375000
supragingival plaque1.181818
saliva1.042553
feces1.011594
tropical moist broadleaf forest biome1.000000
gaster1.000000
2-year-old human stage1.000000
state of oklahoma1.000000
6-month-old human stage1.000000
LOWER IN dental caries1.000000
dental caries1.000000
ruminal fluid1.000000
third trimester1.000000
7-year-old human stage1.000000
8-year-old human stage1.000000
subgingival dental plaque1.000000
18-month-old human stage1.000000
4-year-old human stage1.000000
LOWER IN 4-year-old human stage1.000000
9-month-old human stage1.000000
8-month-old human stage1.000000
7-month-old human stage1.000000
14-month-old human stage1.000000
13-month-old human stage1.000000
11-month-old human stage1.000000
10-month-old human stage1.000000
21-month-old human stage1.000000
20-month-old human stage1.000000
19-month-old human stage1.000000
no dental caries1.000000
interproximal dental plaque1.000000
lingual dental plaque1.000000
vestibular dental plaque1.000000
LOWER IN interproximal dental plaque1.000000
LOWER IN lingual dental plaque1.000000
orenburg1.000000
licosa island1.000000
podarcis siculus1.000000
lizard1.000000
punta licosa1.000000
LOWER IN punta licosa1.000000
LOWER IN licosa island1.000000
riwoqe county1.000000
LOWER IN chitin-based cuticle1.000000
LOWER IN cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
sao paulo state1.000000
odontomachus hastatus1.000000
cuticle1.000000
chitin-based cuticle1.000000
LOWER IN odontomachus chelifer1.000000
LOWER IN odontomachus hastatus1.000000
odontomachus chelifer1.000000
LOWER IN reserva biológica de mogi-guaçu1.000000
LOWER IN parque estadual serra do mar-núcleo picinguaba1.000000
LOWER IN atlantic rainforest1.000000
reserva biológica de mogi-guaçu1.000000
age 4-7 years1.000000
intestine0.961538
stomach0.941176
high bmi0.928571
obesity0.923077
rural community0.923077
c57bl/6j0.909091
lung0.900000
child0.897436
diarrhea0.888889
LOWER IN low bmi0.888889
low bmi0.888889
tongue0.875000
LOWER IN 2-year-old human stage0.875000
mucus0.857143
jackson laboratories0.857143
LOWER IN metronidazole0.857143
thailand0.857143
c57bl/60.850000
infant0.833333
LOWER IN high fiber0.833333
clostridium difficile intestinal infectious disease0.833333
high fat diet0.833333
homosexual0.833333
msm0.833333
gorilla gorilla0.833333
homo sapiens0.830450
adult0.827957
mus musculus0.820896
captive0.809524
urine0.800000
hiv infection0.800000
sputum0.800000
amsterdam0.800000
hunter gatherer0.800000
zebra fish0.800000
LOWER IN mouse chow0.800000
ampicillin0.800000
guangzhou city prefecture0.800000
LOWER IN heterosexual0.800000
LOWER IN msw0.800000
heterosexual0.800000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.713243
homo sapiens0.476190
united states of america0.315954
adult0.255127
research facility0.197080
china0.130692
mus musculus0.110879
mouse0.101842
saliva0.085158
control0.083768
child0.080987
infant0.058047
female0.055961
LOWER IN control0.051790
intestine0.044143
wild0.040667
italy0.039625
canis lupus familiaris0.037192
male0.034411
c57bl/60.034411
dog0.033021
zoological garden0.032673
farm0.031978
germany0.031630
stomach0.030935
captive0.030935
monkey0.025026
kingdom of spain0.024678
human adult stage0.024678
supragingival plaque0.023636
rat0.023288
supragingival dental plaque0.022941
sweden0.021550
city0.021203
australia0.021203
mucus0.020507
canada0.020160
rural community0.019812
state of california0.019465
c57bl/6j0.018422
japan0.017727
dentition0.017379
adult organism0.017379
rattus norvegicus0.015989
obesity0.015294
bird0.015294
digestive system0.015294
ant0.014599
equus caballus0.014251
female organism0.014251
south korea0.013903
israel0.013903
sprague dawley0.013903
costa rica0.013903
macaca mulatta0.013903
state of new york0.013556
horse0.013208
rumen0.013208
ruminal fluid0.012861
united kingdom0.012513
sus scrofa0.012513
obsolete_juvenile stage0.012165
french republic0.012165
commonwealth of pennsylvania0.012165
brazil0.011818
coral0.011818
ocean0.011818
subgingival plaque0.011470
pig0.011470
bos taurus0.011470
tongue0.011123
kenya0.011123
mouse chow0.011123
subgingival dental plaque0.011123
LOWER IN feces0.010775
high fat diet0.010775
amsterdam0.010428
cow0.010428
formula fed0.010428
larval stage0.010080
jackson laboratories0.010080
kingdom of the netherlands0.010080
pregnancy0.009732
diet0.009732
balb/c0.009732
antibiotic0.009732
crohn's disease0.009732
panama0.009732
2-year-old human stage0.009732
oral cavity0.009732
state of georgia0.009732
hispanic or latin american0.009732
1-year-old human stage0.009385
south africa0.009385
homosexual0.009385
msm0.009385
mouth0.009037
czech republic0.009037
guangzhou city prefecture0.009037
fungus growing ant0.009037
Exp. ID User ID Description Date Region Flag Sequences
14amnonhighest in feces compared to colon ( high in feces compared to colon in mus musculus united states of america gastrointestinal system )2016-11-08v4No1 / 1
23amnonhuman DNA (other homo sapiens, feces, united states of america)2016-11-29v4No1 / 1
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 1
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 1
80amnonHigher in fruit season compared to leaf season ( high in season fruit season compared to leaf season in feces central america alouatta pigra howler monkey state of florida )2017-03-03v4No1 / 1
112amnonStrongly higher in zebrafish treated with BPA or estradiol ( high in bisphenol a estradiol compared to control in danio rerio zebra fish intestine research facility china )2017-04-09v4No1 / 1
114amnondominant rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 1
114amnon high in control compared to polychlorinated biphenyl 126 pcb contaminated water in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america tadpole 2017-04-10v4No1 / 1
117amnonhigher in sox10 mutant fish with high neutrophil count ( high in high neutrophils neutrophil hirschsprung disease compared to low neutrophils control in zebra fish danio rerio research facility larval stage united states of america intestine )2017-04-10v4No1 / 1
117amnonlower in sox10 mutant fish with high neutrophil count ( high in low neutrophils control compared to hirschsprung disease high neutrophils neutrophil in zebra fish danio rerio research facility larval stage united states of america intestine )2017-04-10v4No1 / 1
121amnoncausitive agent for acute diarrhea (other pathogen, homo sapiens, feces, bangladesh, diarrhea)2017-04-13v4No1 / 1
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in mus musculus mouse caecum feces c57bl/6j )2017-04-14v4No1 / 1
124amnonassociated with glucose tolerance (other mus musculus, mouse, caecum, feces, c57bl/6j, glucose tolerance)2017-04-14v4No1 / 1
131amnonpositively correlated with age (30-80 years) ( high in human late adulthood stage age compared to fifth decade human stage fourth decade human stage in homo sapiens feces south korea )2017-04-16v4No1 / 1
144amnon high in ancylostoma compared to control in canis lupus familiaris dog australia feces 2017-04-19v4No1 / 1
158amnon high in pair of nares compared to saliva mouth in cat felis catus united states of america 2017-07-06v4No1 / 1
207amnonhigher in people hospitalized with diarrhea compared to healthy controls ( high in diarrhea compared to control in pathogen homo sapiens israel feces )2017-10-05v4No1 / 1
325amnonhigher in mice supplemented with inulin in diet compared to normal diet ( high in diet inulin compared to mouse chow in humanized mouse feces united states of america research facility )2018-04-29v4No1 / 1
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 1
384amnon high in asthma compared to control in equus caballus horse canada farm oral cavity saliva hay barn mouth 2018-10-23v4No1 / 1
406amnoncommon feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 1
408amnon high in stomach compared to larval stage in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 1
413amnon high in control compared to hypoxia induced hypoxia and hypercapnia in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 1
434amnon high in control diet compared to fructose diet fructose in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v4No1 / 1
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue)2019-01-10v4No1 / 1
467amnonhigher in arabinoxylan and resistant starch diet compared to normal diet ( high in plant fiber cell high fiber high arabinoxylan and resistant starch diet compared to control diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 1
558amnon high in duodenum compared to gizzard in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 1
569amnonHelicobacter pylori pathogen (other homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori, pathogen, helicobacter pylori infectious disease)2019-12-16v3No1 / 1
578amnon high in hiv infection compared to control in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v3No1 / 1
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 12-month-old human stage 3-month-old human stage 2-year-old human stage in homo sapiens sweden saliva child )2020-03-18v3No1 / 1
650amnonother asian, feces, seaweed degrading, bacteroides plebeius2020-09-12v4No1 / 1
664amnoncausitive bacteria for ehrlichiosis (other blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog, ehrlichiosis, ehrlichia canis, pathogen)2020-09-22v4No1 / 1
664amnondog blood mycoplasma (other mycoplasma haemocanis, blood, pathogen, semi domestic dog, bangkok, thailand, canis lupus familiaris, dog)2020-09-22v4No1 / 1
664amnonanaplasmosis causing pathogen (other anaplasma platys, anaplasmosis, pathogen, blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog)2020-09-22v4No1 / 1
666amnondominant rattus rattus, rat, italy, feces2020-09-25v3No1 / 1
680amnon high in bifidobacterium longum probiotic probiotic compared to control in obesity adult novosibirsk russia feces homo sapiens 2028-03-04v3No1 / 1
689amnon high in non c. diff diarrhea compared to clostridium difficile infection clostridium difficile colitis in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v4No1 / 1
702amnon high in control compared to clostridium difficile infection in canis lupus familiaris dog state of north carolina united states of america feces 2028-04-02v4No1 / 1
736amnon high in control compared to helminthiasis parasitic helminthiasis infectious disease in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 1
919amnon high in breast fed compared to formula fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 1
41amnonlower in water stress compared to control in tcr-b deficient mice ( high in control compared to stress in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 2
114amnon high in polychlorinated biphenyl 126 pcb contaminated water compared to control in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america tadpole 2017-04-10v4No1 / 2
123amnon high in olanzapine compared to control in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 2
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 2
234amnoncandidate contaminant (high in blank) (contamination)2017-11-07v4No1 / 2
239amnon high in control compared to colorectal adenocarcinoma colorectal cancer carcinoma in homo sapiens feces united states of america 2017-11-08v4No1 / 2
344amnon high in control compared to hiv infection in homo sapiens feces united states of america state of colorado denver homosexual gay msm 2018-05-31v4No1 / 2
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v4No1 / 2
379amnonhigher in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 2
408amnoncommon ant, costa rica, united states of america, stomach, camponotus2018-11-22v4No1 / 2
408amnon high in larval stage compared to stomach in ant costa rica united states of america camponotus 2018-11-22v4No1 / 2
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex nigropilosus 2018-11-22v4No1 / 2
425amnonhigher in kids with stunted growth compared to non-stunted ( high in stunted growth compared to control in homo sapiens feces africa child )2018-12-08v4No1 / 2
488amnonhigher in feces of dogs with lymphoma compared to healthy controls ( high in lymphoma compared to control in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 2
455amnonColonizes gut as well as saliva (other homo sapiens, saliva, feces)2019-11-25v4No1 / 2
574amnon high in control compared to primary progressive multiple sclerosis in feces homo sapiens russia adult 2020-01-05v3No1 / 2
592amnondominant united states of america, feces, commonwealth of pennsylvania, wild, sheep, ovis aries2020-02-18v1No1 / 2
664amnoncandidate contaminant in low biomass blood samples (contamination)2020-09-23v4No1 / 2
694amnon high in control compared to polycystic ovary syndrome in china shanghai district obesity adult female feces homo sapiens 2028-03-17v3No1 / 2
702amnondominant equus caballus, horse, state of north carolina, united states of america, feces2028-04-02v4No1 / 2
781amnondominant equus burchellii quagga, zebra, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 2
849amnon high in multiple sclerosis multiple sclerosis compared to control in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 2
869amnon high in before roux-en-y gastric bypass surgery compared to after roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 2
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage amsterdam kingdom of the netherlands male adult vancomycin antibiotic homo sapiens feces 2022-02-19v3No1 / 2
877amnon high in low breath methane content compared to high breath methane content in human early adulthood stage adult homo sapiens feces austria 2022-03-08v4No1 / 2
16amnon high in diarrhea compared to control in felis catus state of california feces 2016-11-08v4No1 / 3
41amnonhigher in water stress compared to control in tcr-b deficient mouse ( high in stress compared to control in mus musculus research facility feces tcr-alpha knockout japan )2016-12-10v4No1 / 3
46amnonsmj: higher in female mice feces treated with antibiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 3
66amnon high in male compared to female in homo sapiens saliva adult amsterdam 2017-02-18v4No1 / 3
66amnon high in female compared to male in homo sapiens saliva amsterdam adult 2017-02-18v4No1 / 3
80amnonHigher in leaf season compared to fruit season ( high in season leaf compared to botanical fruit food product in feces central america alouatta pigra howler monkey state of florida )2017-03-03v4No1 / 3
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine )2017-04-24v4No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 3
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 3
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta cephalotes2018-11-14v4No1 / 3
399amnon high in crohn's disease compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 3
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 3
478amnondominant farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 3
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to resistant starch type 4 diet starch diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 3
529amnonlower in CRC patients that underwent low anterior resection ( high in control compared to low anterior resection in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 3
561amnondominant bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 3
593amnon high in osteoarthritis compared to rheumatoid arthritis in homo sapiens feces adult south korea 2020-03-08v3No1 / 3
598amnonhigher in kids that eat sweets ( high in diet containing sweets compared to diet without sweets in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 3
607amnon high in parkinson's disease rem sleep behavior disorder compared to control in germany homo sapiens feces 2020-04-19v4No1 / 3
689amnon high in clostridium difficile infection clostridium difficile colitis compared to non c. diff diarrhea in diarrhea hospital adult tucson united states of america feces homo sapiens 2028-03-11v4No1 / 3
725amnon high in control compared to periodontitis acute pericementitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 3
797amnon high in bifidobacterium supplement compared to control diet in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v3No1 / 3
803amnon high in control compared to type 2 diabetes mellitus in human late adulthood stage commonwealth of massachusetts caribbean latino adult united states of america feces homo sapiens 2021-06-18v4No1 / 3
833amnon high in athlete high exercise compared to normal exercise in homo sapiens feces age 60-65 years slovak republic adult 2021-09-11v1No1 / 3
902amnondominant adult organism, horse, equus caballus, united states of america, control, feces2022-05-02v4No1 / 3
919amnon high in formula fed compared to breast fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 3
925amnon high in lingual dental plaque compared to interproximal dental plaque in adolescent stage supragingival dental plaque supragingival plaque kingdom of spain homo sapiens 2022-07-28v3No1 / 3
32amnon high in infant compared to adult in homo sapiens saliva bolivia 2016-12-05v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 4
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in liolaemus ruibali stomach research facility argentina )2017-02-25v4No1 / 4
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in mus musculus mouse feces united states of america state of texas balb/c )2017-10-06v4No1 / 4
210amnonhigher in american diet compared to bangladeshi diet in mice with bangladeshi human FMT ( high in american diet diet compared to bangladesh diet in mouse mus musculus humanized mouse feces research facility )2017-10-21v4No1 / 4
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
211amnonanti-correlated with BMI growth rate ( high in low growth compared to high growth body mass index in mus musculus mouse research facility united states of america feces high fat diet )2017-10-25v4No1 / 4
320amnonlower in CD patients with remission ( high in crohn's disease compared to remission in homo sapiens feces adult )2018-04-19v4No1 / 4
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile intestinal infectious disease clostridium difficile colitis compared to control in humanized mouse feces united states of america research facility )2018-04-29v4No1 / 4
397amnoncommon panama, digestive system, intestine, fungus growing ant, trachymyrmex cornetzi2018-11-14v4No1 / 4
397amnoncommon panama, digestive system, intestine, fungus growing ant, sericomyrmex amabilis2018-11-14v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v4No1 / 4
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 4
570amnon high in visceral leishmaniasis compared to control in homo sapiens feces india bihar state 2019-12-16v3No1 / 4
593amnon high in rheumatoid arthritis compared to osteoarthritis in homo sapiens feces adult south korea 2020-03-08v3No1 / 4
597amnon high in gout compared to control in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
597amnon high in control compared to gout in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
607amnon high in control compared to rem sleep behavior disorder parkinson's disease in germany homo sapiens feces 2020-04-19v4No1 / 4
617amnon high in spring june compared to october autumn in lowland pasture lowland farm farm italy cow milk (raw) cow milk (fluid) milk 2020-05-03v3No1 / 4
655amnon high in before hsct compared to hematopoietic stem cell transplant after hcst in italy feces homo sapiens 2020-09-13v3No1 / 4
710amnon high in small intestine stomach compared to feces in state of california swiss webster research facility united states of america mus musculus mouse 2028-05-20v4No1 / 4
716amnon high in chronic bad breath halitosis compared to control in tongue china dermal layer of tongue homo sapiens adult 2028-05-22v3No1 / 4
797amnon high in age 7 months compared to 12-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 4
850amnoncommon sperm, semen, male organism, in vitro fertilization clinic, anambra state, nigeria, adult, homo sapiens2021-12-16v4No1 / 4
908amnondominant guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 4
931amnondominant riwoqe county, china, ruminal fluid, yak, tibet autonomous region, bos grunniens, rumen2022-08-25v3No1 / 4
3amnonHigher in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in chronic gastritis compared to in homo sapiens tongue china )2016-10-06v4No1 / 5
66amnoncorrelated group of bacteria in saliva (other homo sapiens, saliva, amsterdam, adult)2017-02-19v4No1 / 5
87amnonhigher in controls compared to lung and oral (contamination)2017-03-07v4No1 / 5
88amnonhigher in younger cape buffalo feces ( high in age young age compared to old age in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 5
215amnonlower in people with Roux-en-Y gastric bypass compared to controls ( high in control compared to gastric bypass in homo sapiens feces united states of america )2017-10-23v4No1 / 5
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 5
397amnoncommon panama, digestive system, intestine, fungus growing ant, acromyrmex octospinosus2018-11-14v4No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in clindamycin antibiotic compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 5
408amnondominant ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v4No1 / 5
408amnon high in stomach compared to larval stage in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 5
408amnoncommon ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / 5
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigropilosus, stomach2018-11-22v4No1 / 5
408amnondominant ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 5
418amnoncommon coral, favites abdita, mucus, ocean2018-12-02v4No1 / 5
440amnoncommon galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 5
448amnonhigh freq. in healthy horse feces (dominant equus caballus, horse, feces, farm, control, united kingdom)2019-01-08v4No1 / 5
499amnondominant digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 5
519amnon high in control compared to dental caries in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 5
550amnondominant city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 5
550amnon high in starfish wild coelomic fluid asterias amurensis compared to sea water in city hokkaido japan 2019-08-18v4No1 / 5
564amnon high in autistic disorder compared to control in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v3No1 / 5
569amnonhigh freq. in gastric biopsies of patients positive for h. pylori (dominant homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 5
598amnon high in male compared to female in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v3No1 / 5
598amnon high in female compared to male in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v3No1 / 5
644amnonhigher in younger adults (total age range 20-80) ( high in young age compared to old age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 5
666amnondominant cow, bos taurus, italy, feces2020-09-25v3No1 / 5
779amnon high in ulcerative colitis compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 5
794amnon high in antiretroviral therapy human immunodeficiency virus infectious disease hiv infection compared to control in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 5
797amnon high in control diet compared to bifidobacterium supplement in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v3No1 / 5
831amnon high in control compared to pancreatic cancer in israel adult feces homo sapiens 2021-09-11v3No1 / 5
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens subgingival dental plaque subgingival plaque china adult municipality of shanghai periodontitis chronic periodontitis 2021-09-11v3No1 / 5
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 5
919amnon high in 12-month-old human stage compared to 2-year-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 5
925amnon high in interproximal dental plaque compared to lingual dental plaque in adolescent stage supragingival dental plaque supragingival plaque kingdom of spain homo sapiens 2022-07-28v3No1 / 5
26amnon high in inguinal region axilla compared to pair of nares mucus in united states of america homo sapiens 2016-12-05v4No1 / 6
49amnonincreases during sample storage in giraffe feces (other giraffa camelopardalis, feces)2017-01-19v4No1 / 6
112amnondominant danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 6
113amnondominant danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 6
63amnon high in diet plant based diet compared to animal product diet in homo sapiens united states of america feces 2017-04-12v4No1 / 6
183amnoncommon eciton burchellii, army ant, stomach, gaster2017-08-15v4No1 / 6
183amnoncommon army ant, stomach, gaster, labidus praedator2017-08-15v4No1 / 6
231amnonhigh freq. in dog urine (dominant dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 6
239amnon high in colorectal adenocarcinoma colorectal cancer carcinoma compared to control in homo sapiens feces united states of america 2017-11-08v4No1 / 6
242amnonlower in native-americans compared to non native-american ( high in american compared to native american arapaho cheyenne in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 6
274amnondominant monkey, ethiopia, feces, chlorocebus aethiops, grivet monkey2018-01-16v4No1 / 6
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 6
344amnon high in hiv infection compared to control in homo sapiens feces united states of america state of colorado denver homosexual gay msm 2018-05-31v4No1 / 6
384amnon high in control compared to asthma in equus caballus horse canada farm oral cavity saliva hay barn mouth 2018-10-23v4No1 / 6
397amnondominant panama, digestive system, intestine, trachymyrmex zeteki, fungus growing ant2018-11-14v4No1 / 6
397amnondominant panama, digestive system, intestine, fungus growing ant, trachymyrmex cornetzi2018-11-14v4No1 / 6
397amnondominant panama, digestive system, intestine, fungus growing ant, acromyrmex octospinosus2018-11-14v4No1 / 6
397amnoncommon panama, digestive system, intestine, fungus growing ant, acromyrmex echinatior2018-11-14v4No1 / 6
397amnondominant panama, digestive system, intestine, fungus growing ant, acromyrmex echinatior2018-11-14v4No1 / 6
400amnonpositively correlated with bmi ( high in high bmi compared to low bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 6
408amnondominant ant, costa rica, united states of america, eciton, stomach2018-11-22v4No1 / 6
418amnondominant coral, favites abdita, mucus, ocean2018-12-02v4No1 / 6
440amnoncommon galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 6
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 6
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in resistant starch type 4 diet starch diet diet compared to control diet in homo sapiens feces united states of america metabolic syndrome metabolic syndrome x )2019-02-24v4No1 / 6
550amnondominant city, hokkaido, starfish, asterias amurensis, coelomic fluid, wild, japan2019-08-18v4No1 / 6
592amnondominant feces, united states of america, bos taurus, cow, farm, commonwealth of pennsylvania2020-02-18v1No1 / 6
646amnondominant protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 6
664amnondominant blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog2020-09-22v4No1 / 6
702amnon high in clostridium difficile infection compared to control in canis lupus familiaris dog state of north carolina united states of america feces 2028-04-02v4No1 / 6
703amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v3No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 6
868amnon high in iga negative fraction compared to iga positive fraction in human adult stage province of alberta clostridium difficile infection canada adult clostridium difficile colitis homo sapiens feces 2022-02-12v4No1 / 6
919amnondominant 2-month-old human stage, 1-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 6
931amnondominant riwoqe county, china, yak, tibet autonomous region, bos grunniens, ileum, colon, caecum, feces2022-08-25v3No1 / 6
18amnondominant feces, united states of america, equus caballus2016-11-09v4No1 / 7
118amnondominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 7
149amnonhigher in larvae transferred to pond compared to stream ( high in pond compared to stream in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine )2017-04-24v4No1 / 7
183amnoncommon neivamyrmex, army ant, stomach, gaster2017-08-15v4No1 / 7
207amnoncommon in people hospitalized with diarrhea (common homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 7
217amnondominant mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to probiotics lactobacillus plantarum in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 7
354amnon high in saliva oral wash compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 7
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v4No1 / 7
397amnoncommon panama, digestive system, intestine, trachymyrmex zeteki, fungus growing ant2018-11-14v4No1 / 7
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / 7
397amnondominant panama, digestive system, intestine, fungus growing ant, apterostigma dentigerum2018-11-14v4No1 / 7
406amnondominant feces, zoological garden, french republic, equus zebra, mountain zebra2018-11-21v4No1 / 7
406amnondominant feces, south africa, antidorcas marsupialis, springbok2018-11-21v4No1 / 7
406amnondominant feces, south africa, aepyceros melampus, impala2018-11-21v4No1 / 7
408amnoncommon ant, costa rica, united states of america, pseudomyrmex flavicornis, stomach2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex flavicornis, stomach2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, stomach, camponotus2018-11-22v4No1 / 7
408amnondominant ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / 7
418amnoncommon coral, ocean, porites lobata, mucus2018-12-02v4No1 / 7
418amnondominant coral, ocean, isopora palifera, mucus2018-12-02v4No1 / 7
418amnondominant coral, ocean, turbinaria reniformis, mucus2018-12-02v4No1 / 7
435amnon high in zinc deficiency low zinc diet compared to control in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 7
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 7
435amnondominant mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 7
454amnondominant feces, elaphurus davidianus, pere deer, deer, captive, china2019-01-10v4No1 / 7
526amnonhigh freq in bile of Cholelithiasis patients (dominant homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 7
550amnon high in asterias amurensis compared to patiria pectinifera in city hokkaido starfish coelomic fluid wild japan 2019-08-18v4No1 / 7
572amnon high in control compared to liver carcinoma in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 7
644amnonpositively correalted with bmi ( high in high bmi body mass index compared to low bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 7
646amnoncommon lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 7
663amnondominant lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 7
666amnondominant sheep, ovis aries, italy, feces2020-09-25v3No1 / 7
666amnondominant alpaca, vicugna pacos, italy, feces2020-09-25v3No1 / 7
679amnondominant saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v3No1 / 7
730amnon high in crohn's disease compared to control in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v1No1 / 7
734amnon high in vegetarian diet compared to omnivore diet in republic of china taiwan adult feces homo sapiens 2021-01-22v3No1 / 7
781amnondominant cattle, bos taurus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 7
806amnon high in oral wash oral cavity compared to saliva in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 7
825amnon high in control compared to type 1 diabetes mellitus type i diabetes mellitus in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 7
833amnon high in normal exercise compared to athlete high exercise in adult slovak republic age 60-65 years feces homo sapiens 2021-09-11v1No1 / 7
841amnon high in iga negative fraction compared to iga positive fraction in human adult stage state of texas adult saliva united states of america homo sapiens 2021-11-08v4No1 / 7
850amnon high in semen sperm male organism compared to vagina female organism in in vitro fertilization clinic anambra state nigeria adult homo sapiens 2021-12-16v4No1 / 7
891amnondominant urban slum, under-1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 7
892amnon high in 4-year-old human stage compared to 2-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v4No1 / 7
919amnon high in 2-month-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 7
930amnon high in non-smoker compared to cigarette smoking in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 7
932amnoncommon odontomachus chelifer, sao paulo state, ant, gaster, brazil, stomach, tropical moist broadleaf forest biome2022-08-30v4No1 / 7
932amnondominant odontomachus chelifer, sao paulo state, ant, gaster, brazil, stomach, tropical moist broadleaf forest biome2022-08-30v4No1 / 7
932amnon high in reserva biológica de mogi-guaçu savanna compared to parque estadual serra do mar-núcleo picinguaba atlantic rainforest in odontomachus chelifer sao paulo state ant gaster brazil stomach tropical moist broadleaf forest biome 2022-08-30v4No1 / 7
17amnondominant ochotona, feces, stomach, tibetan plateau2016-11-09v4No1 / 8
28amnondominant hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 8
88amnondominant syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v4No1 / 8
115amnondominant coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 8
167amnondominant mus musculus, mouse, nod mouse, feces, female, research facility, united states of america2017-07-18v4No1 / 8
274amnondominant monkey, chlorocebus djamdjamensis, bale monkey, ethiopia, feces2018-01-16v4No1 / 8
284amnon high in age 2 months compared to 12-month-old human stage in homo sapiens female feces state of california infant 2018-01-27v4No1 / 8
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 8
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 8
397amnoncommon panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in ampicillin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
406amnondominant feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 8
406amnondominant feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 8
406amnondominant feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
408amnoncommon ant, costa rica, united states of america, pseudomyrmex gracilis, stomach2018-11-22v4No1 / 8
408amnoncommon ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 8
411amnondominant feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 8
417amnondominant anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 8
418amnoncommon coral, ocean, pocillopora damicornis, mucus2018-12-02v4No1 / 8
418amnondominant coral, ocean, porites lobata, mucus2018-12-02v4No1 / 8
418amnoncommon coral, ocean, diploastrea heliopora, mucus2018-12-02v4No1 / 8
418amnondominant coral, ocean, physogyra lichtensteini, mucus2018-12-02v4No1 / 8
435amnon high in control compared to zinc deficiency low zinc diet in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon age 9 weeks 2018-12-23v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
440amnondominant galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 8
454amnondominant feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v4No1 / 8
463amnondominant intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 8
515amnondominant whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 8
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus taurus2019-04-18v4No1 / 8
516amnoncommon homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 8
518amnondominant bos taurus, cow, feces, united states of america, state of georgia, post-weaning, angus steer2019-06-11v4No1 / 8
552amnon high in common variable immunodeficiency compared to control in feces homo sapiens czech republic 2019-09-05v3No1 / 8
592amnondominant united states of america, feces, commonwealth of pennsylvania, research facility, oryctolagus cuniculus, rabbit2020-02-18v1No1 / 8
594amnondominant adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 8
620amnondominant saint louis zoo, saint louis, united states of america, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 8
646amnondominant lung, bronchoalveolar lavage, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 8
666amnoncommon european hare, lepus europaeus, lama guanicoe, italy, feces2020-09-25v3No1 / 8
666amnondominant mouflon, ovis aries musimon, italy, feces2020-09-25v3No1 / 8
702amnon high in dog canis lupus familiaris compared to cat felis catus in state of north carolina united states of america feces 2028-04-02v4No1 / 8
777amnondominant 2-days-old human, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 8
859amnon high in 1-month-old human stage compared to 6-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v4No1 / 8
889amnondominant reindeer, rangifer tarandus, ruminal fluid, siberia, russia, rumen2022-04-01v3No1 / 8
891amnoncommon under-1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 8
906amnon high in male organism compared to female organism in grey squirrel sciurus carolinensis province of ontario canada feces 2022-05-19v4No1 / 8
932amnoncommon stomach, gaster, atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 8
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 9
80amnondominant feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 9
163amnondominant ochotonidae, pika, ochotona dauurica, mongolia grassland, stomach, china2017-07-13v4No1 / 9
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
308amnondominant red abalone, haliotis rufescens, feces, united states of america, state of california, research facility2018-03-30v4No1 / 9
391amnoncommon under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v4No1 / 9
397amnondominant panama, digestive system, intestine, fungus growing ant, sericomyrmex amabilis2018-11-14v4No1 / 9
397amnoncommon panama, digestive system, intestine, fungus growing ant, apterostigma dentigerum2018-11-14v4No1 / 9
397amnondominant panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 9
399amnondominant feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 9
399amnondominant feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 9
406amnondominant feces, zoological garden, french republic, equus hemionus, onager2018-11-21v4No1 / 9
406amnondominant feces, zoological garden, french republic, aepyceros melampus, impala2018-11-21v4No1 / 9
408amnondominant ant, costa rica, united states of america, pheidole, stomach2018-11-22v4No1 / 9
408amnoncommon ant, costa rica, united states of america, eciton, stomach2018-11-22v4No1 / 9
456amnondominant mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 9
466amnondominant feces, bos taurus, cow, farm, united states of america, state of georgia2019-01-14v4No1 / 9
467amnonlower in arabinoxylan and resistant starch diet compared to normal diet ( high in control diet compared to high arabinoxylan and resistant starch diet plant fiber cell high fiber arabinoxylan diet in homo sapiens feces kingdom of denmark metabolic syndrome adult )2019-01-14v4No1 / 9
497amnondominant chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 9
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius pusillus2019-04-18v4No1 / 9
521amnonhigh freq. in weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 9
559amnondominant feces, united states of america, black rhinoceros, diceros bicornis, captive, zoological garden2019-11-03v4No1 / 9
569amnonhigh freq. in gastric biopsies of patients negative for h. pylori (dominant homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 9
572amnon high in control compared to pancreatic cancer in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 9
626amnoncommon red-tailed hawk, buteo jamaicensis, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v1No1 / 9
629amnon high in control compared to hiv infection acquired immunodeficiency syndrome in amsterdam kingdom of the netherlands adult homosexual msm feces homo sapiens 2020-05-31v4No1 / 9
630amnon high in high physical activity compared to sedentary low physical activity in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 9
645amnon high in feces compared to cloaca in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v4No1 / 9
658amnon high in european caucasian compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 9
658amnon high in caucasian european compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v3No1 / 9
666amnondominant goat, capra hircus, italy, feces2020-09-25v3No1 / 9
678amnon high in tooth disease black dental staining compared to control in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v3No1 / 9
693amnon high in control compared to polycystic ovary syndrome in graz city district austria adult feces homo sapiens female 2028-03-16v1No1 / 9
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in 2-year-old human stage 1-year-old human stage age 1-3 years child tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 9
741amnondominant pellet feed diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 9
742amnondominant dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v3No1 / 9
775amnon high in control compared to lichen planus in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 9
778amnon high in increased weight top weight group compared to bottom weight group decreased weight in farm thailand intestine black tiger shrimp penaeus monodon 2021-04-28v3No1 / 9
781amnondominant eland, tragelaphus oryx, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 9
781amnondominant impala, aepyceros melampus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 9
797amnoncommon 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 9
847amnon high in 25-44 year-old human stage compared to 80 year-old and over human stage ninth decade human stage in japan feces 2021-12-01v1No1 / 9
863amnondominant forest musk deer, moschus berezovskii, qilian county, china, deer, captive, farm, feces2022-01-28v4No1 / 9
864amnondominant ocotal state park, mexican wolf, raw meat diet, canis lupus baileyi, municipality of timilpan, captive, mexico, feces2022-02-08v3No1 / 9
866amnon high in ulcerative colitis ulcerative colitis compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 9
868amnonhigher in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga positive fraction compared to iga negative fraction in province of alberta canada adult homo sapiens feces )2022-02-12v4No1 / 9
885amnon high in c57bl/6 compared to c57bl/6 t1r2-ko in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v3No1 / 9
888amnondominant bulk tank milk, cow milk (raw), ireland, milk2022-03-30v3No1 / 9
906amnondominant grey squirrel, sciurus carolinensis, province of ontario, canada, feces2022-05-19v4No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
10amnon high in female compared to male in homo sapiens feces toronto 2016-10-27v4No1 / 10
26amnondominant canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 10
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 10
78amnondominant nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 10
99amnondominant commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 10
113amnondominant danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 10
117amnondominant zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 10
177amnonblooming bacteria (grows in storage at room temp.) (contamination)2017-07-30v4No1 / 10
234amnoncommon homo sapiens, lung, united states of america2017-11-07v4No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
307amnondecreases with aging (4 week period) ( high in young age compared to old age age aging in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 10
321amnondominant mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 10
396amnondominant fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 10
397amnoncommon panama, digestive system, intestine, fungus growing ant, cyphomyrmex costatus2018-11-14v4No1 / 10
397amnondominant panama, digestive system, intestine, fungus growing ant, cyphomyrmex costatus2018-11-14v4No1 / 10
406amnondominant feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 10
408amnon high in stomach compared to larval stage in ant cephalotes costa rica united states of america 2018-11-22v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex elongatus, stomach2018-11-22v4No1 / 10
408amnoncommon ant, costa rica, united states of america, pseudomyrmex cubaensis, stomach2018-11-22v4No1 / 10
411amnondominant zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 10
417amnondominant anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 10
418amnoncommon coral, ocean, acropora hyacinthus, mucus2018-12-02v4No1 / 10
497amnondominant chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 10
519amnon high in dental caries compared to control in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 10
530amnondominant snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 10
552amnon high in control compared to common variable immunodeficiency in feces homo sapiens czech republic 2019-09-05v3No1 / 10
559amnondominant feces, united states of america, captive, zoological garden, ceratotherium simum, white rhinoceros2019-11-03v4No1 / 10
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 10
632amnondominant feces, adult, united states of america, state of texas, research facility, horse, equus caballus2020-06-10v4No1 / 10
646amnoncommon protected brush sampling, lung, mucus, adult, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 10
655amnoncommon in patients after hematopoietic stem cell transplant (common after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v3No1 / 10
666amnondominant horse, equus caballus, italy, feces2020-09-25v3No1 / 10
781amnondominant tsessebe, damaliscus lunatus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 10
797amnon high in formula fed compared to breast fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 10
806amnon high in dentition supragingival plaque supragingival dental plaque compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 10
847amnon high in 80 year-old and over human stage ninth decade human stage compared to 25-44 year-old human stage in japan feces 2021-12-01v1No1 / 10
859amnoncommon formula fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 10
868amnonlower in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga negative fraction compared to iga positive fraction in canada province of alberta adult feces homo sapiens )2022-02-12v4No1 / 10
890amnoncommon pacific ocean, mikura-jima, japan, wild, feces, bottlenosed dolphin, tursiops truncatus2022-04-03v3No1 / 10
899amnoncommon in snail intestine from heavy metal contaminated greenhouse (dominant heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, greenhouse, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 10
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, research facility, feces2022-05-18v3No1 / 10
919amnoncommon saliva, 2-month-old human stage, 1-month-old human stage, infant, state of victoria, australia, homo sapiens2022-07-17v4No1 / 10
2amnon high in control compared to anorexia nervosa in homo sapiens feces 2016-10-05v4No1 / 11
10amnon high in male compared to female in homo sapiens feces toronto 2016-10-27v4No1 / 11
26amnonhigh freq. in combined swab of inguinal region and axilla (dominant homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 11
99amnondominant commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 11
115amnonhigher in medium and large size fish compared to small size ( high in large size medium size compared to small size in coreius guichenoti largemouth bronze gudgeon fish freshwater river biome yangtze river intestine china )2017-04-10v4No1 / 11
183amnondominant eciton burchellii, army ant, stomach, gaster2017-08-15v4No1 / 11
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 11
274amnondominant monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 11
302amnonhigh freq. in feces of canary pet birds (dominant bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 11
354amnondominant homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 11
371amnondominant feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 11
391amnondominant under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v4No1 / 11
397amnondominant panama, digestive system, intestine, fungus growing ant, atta cephalotes2018-11-14v4No1 / 11
397amnondominant panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 11
399amnondominant feces, united states of america, zoological garden, state of tennessee, gorilla gorilla2018-11-16v4No1 / 11
406amnondominant feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 11
408amnondominant ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex spinicola, stomach2018-11-22v4No1 / 11
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigropilosus, stomach2018-11-22v4No1 / 11
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v4No1 / 11
418amnondominant coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 11
418amnondominant coral, ocean, pocillopora damicornis, mucus2018-12-02v4No1 / 11
499amnondominant brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 11
522amnonlower in fructose supplemented diets ( high in no fructose diet compared to fructose diet fructose in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 11
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 11
585amnon high in stomach intestine compared to buccal mass in china pomacea canaliculata golden apple snail nanheng river qingpu district 2020-02-02v3No1 / 11
590amnondominant china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 11
592amnondominant wild, feces, eastern chimpanzee, pan troglodytes schweinfurthii, democratic republic of the congo2020-02-18v1No1 / 11
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to teeth braces braces in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 11
617amnondominant lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 11
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 11
633amnondominant feces, elephas maximus, asian elephant, captive, thailand2020-06-16v4No1 / 11
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 11
664amnoncommon blood, dog, canis lupus familiaris, thailand, bangkok, semi domestic dog2020-09-22v4No1 / 11
702amnondominant state of north carolina, united states of america, feces, sheep, ovis aries2028-04-02v4No1 / 11
729amnondominant europe, zoological garden, feces, monkey, gorilla gorilla2021-01-05v3No1 / 11
737amnondominant ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 11
757amnon high in female compared to male in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 11
781amnondominant cape buffalo, syncerus caffer caffer, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 11
787amnondominant control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 11
790amnonhigher in ducks supplemented with bacillus based probiotics compared to control diet ( high in probiotics compared to control in omsk russia intestinal contents intestine farm peking duck anas platyrhynchos )2021-06-07v3No1 / 11
848amnoncommon 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v1No1 / 11
849amnon high in control compared to multiple sclerosis multiple sclerosis in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 11
861amnondominant peri-urban community, human middle aged stage, bushbuckridge local municipality, rural community, south africa, female, homo sapiens, feces2022-01-15v3No1 / 11
863amnondominant xinglong mountain national nature reserve, alpine musk deer, moschus chrysogaster, yuzhong county, china, deer, captive, farm, feces2022-01-28v4No1 / 11
898amnon high in jejunum duodenum compared to descending colon ascending colon feces in coyote canis latrans edmonton adult organism wild canada male 2022-04-19v4No1 / 11
919amnondominant state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 11
932amnondominant atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, ant, gaster, brazil, stomach, tropical moist broadleaf forest biome2022-08-30v4No1 / 11
26amnondominant united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 12
26amnondominant homo sapiens, united states of america, pair of nares, mucus2016-12-05v4No1 / 12
50amnonhigh freq. in mitten crab intestine (dominant intestine, eriocheir sinensis, china)2017-01-19v4No1 / 12
71amnondominant liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 12
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 12
123amnondominant mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v4No1 / 12
131amnonpositively correlated with waist circumference ( high in waist circumference large waist circumference compared to small waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 12
137amnondominant gopherus polyphemus, gopher tortoise, feces, united states of america, state of florida2017-04-17v4No1 / 12
161amnonhigh freq. in barn swallows in colorado (dominant state of colorado, hirundo rustica, feces, united states of america, barn swallow)2017-07-12v4No1 / 12
163amnondominant stomach, ochotonidae, pika, ochotona curzoniae, mongolia grassland, china2017-07-13v4No1 / 12
279amnondominant pika, ochotonidae, stomach, small intestine, china2018-01-24v4No1 / 12
307amnondominant mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 12
308amnondominant united states of america, state of california, research facility, haliotis sorenseni, white abalone, feces2018-03-30v4No1 / 12
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 12
354amnondominant homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 12
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 12
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 12
396amnondominant fish, england, intestine, digestive system, oncorhynchus mykiss, rainbow trout2018-11-14v4No1 / 12
397amnondominant panama, digestive system, intestine, fungus growing ant, atta colombica2018-11-14v4No1 / 12
397amnondominant panama, digestive system, intestine, fungus growing ant, cyphomyrmex longiscapus2018-11-14v4No1 / 12
399amnondominant feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 12
408amnondominant ant, costa rica, united states of america, pseudomyrmex gracilis, stomach2018-11-22v4No1 / 12
408amnoncommon ant, costa rica, united states of america, pseudomyrmex nigrocinctus, stomach2018-11-22v4No1 / 12
413amnondominant mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 12
418amnondominant coral, ocean, fungia, mucus2018-12-02v4No1 / 12
418amnondominant coral, ocean, porites cylindrica, mucus2018-12-02v4No1 / 12
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
440amnondominant galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 12
440amnondominant galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v4No1 / 12
538amnondominant mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 12
556amnondominant homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 12
559amnondominant feces, united states of america, captive, zoological garden, rhinoceros unicornis, greater one-horned rhinoceros2019-11-03v4No1 / 12
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 12
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 12
592amnondominant feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 12
592amnondominant wild, feces, chimpanzee, pan troglodytes, africa2020-02-18v1No1 / 12
596amnondominant 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 12
645amnondominant feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 12
666amnondominant italy, feces, wild horse, equus ferus2020-09-25v3No1 / 12
669amnoncommon 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 12
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 12
696amnondominant georissa, georissa similis, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 12
766amnoncommon puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 12
777amnondominant 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 12
796amnon high in control compared to graves' disease in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 12
797amnon high in breast fed compared to formula fed in 12-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 12
797amnoncommon breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 12
806amnon high in saliva compared to oral cavity oral wash in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 12
815amnon high in red fox vulpes vulpes compared to corsac fox vulpes corsac in lake hulun wild winter mongolia feces 2021-07-04v3No1 / 12
817amnondominant bronchoalveolar lavage, lung, united states of america, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 12
847amnondominant 80 year-old and over human stage, ninth decade human stage, japan, feces2021-12-01v1No1 / 12
873amnondominant urban community, human adult stage, commonwealth of pennsylvania, adult, united states of america, homo sapiens, feces2022-03-03v1No1 / 12
906amnon high in female organism compared to male organism in grey squirrel sciurus carolinensis province of ontario canada feces 2022-05-19v4No1 / 12
914amnondominant yak, qinghai province, tibet autonomous region, bos grunniens, feces2022-06-26v3No1 / 12
918amnon high in non-pregnant compared to third trimester pregnancy in female japan human early adulthood stage adult homo sapiens saliva 2022-07-15v3No1 / 12
935amnondominant monkey, age 4-7 years, female organism, olive baboon, captive, state of oklahoma, papio anubis, united states of america, feces2022-09-18v4No1 / 12
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 13
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 13
150amnonlow in healthy dogs compared to EPI dogs without treatment ( high in exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 13
187amnondominant rat, rattus, research facility, feces, wistar rat, czech republic2017-08-23v4No1 / 13
210amnonhigher in bangladeshi diet compared to american diet in mice with american human FMT ( high in bangladesh diet diet compared to american diet in feces research facility mus musculus mouse humanized mouse )2017-10-21v4No1 / 13
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in probiotics diet lactobacillus plantarum compared to control in mus musculus mouse feces research facility united states of america female balb/c )2017-10-24v4No1 / 13
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in under-1-year-old human stage age compared to 2-year-old human stage 1-year-old human stage age 1-3 years in homo sapiens feces infant )2017-11-13v4No1 / 13
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
399amnondominant feces, united states of america, zoological garden, state of tennessee, ovis aries, sheep2018-11-16v4No1 / 13
400amnonhigh freq. in hmong (chinese) females from thailand (dominant homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 13
408amnondominant ant, costa rica, united states of america, crematogaster, stomach2018-11-22v4No1 / 13
418amnondominant coral, ocean, stylophora pistillata, mucus2018-12-02v4No1 / 13
441amnondominant mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 13
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 13
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 13
516amnondominant homo sapiens, united states of america, state of ohio, adult, urine2019-05-29v4No1 / 13
522amnonhigher in fructose supplemented diets ( high in fructose diet fructose compared to no fructose diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks high sugar diet )2019-07-03v3No1 / 13
530amnondominant snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 13
578amnondominant homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 13
585amnon high in buccal mass compared to stomach intestine in china pomacea canaliculata golden apple snail nanheng river qingpu district 2020-02-02v3No1 / 13
594amnondominant adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 13
620amnondominant village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 13
625amnondominant gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 13
642amnondominant san diego, pacific ocean, chub mackerel, scomber japonicus, feces, digesta, fish2020-08-28v4No1 / 13
644amnondominant adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 13
666amnondominant short beaked common dolphin, delphinus delphis, rectal swab, feces, italy2020-09-25v3No1 / 13
666amnondominant pygmy hippopotamus, hexaprotodon liberiensis, italy, feces2020-09-25v3No1 / 13
666amnondominant tiger, panthera tigris, italy, feces2020-09-25v3No1 / 13
666amnondominant common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v3No1 / 13
669amnondominant 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 13
713amnon high in remission compared to active disease in crohn's disease feces homo sapiens 2028-05-21v3No1 / 13
748amnondominant jersey cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 13
748amnondominant holstein dairy cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 13
781amnondominant thomson's gazelle, eudorcas thomsonii, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 13
788amnondominant cherokia georgiana georgiana, millipede, feces, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 13
797amnon high in breast fed compared to formula fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 13
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 13
833amnondominant high exercise, athlete, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v1No1 / 13
847amnondominant centenarian human stage, eleventh decade human stage, japan, feces2021-12-01v1No1 / 13
859amnoncommon breast fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 13
859amnoncommon breast fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 13
861amnondominant urban community, soweto, rural community, south africa, city, female, homo sapiens, feces2022-01-15v3No1 / 13
866amnondominant restraint stress, mouse, state of illinois, stress, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 13
868amnon high in iga positive fraction compared to iga negative fraction in clostridium difficile colitis clostridium difficile infection human adult stage adult province of alberta canada homo sapiens feces 2022-02-12v4No1 / 13
890amnondominant mikura-jima, japan, wild, bottlenosed dolphin, pacific ocean, tursiops truncatus, feces2022-04-03v3No1 / 13
902amnondominant salmonellosis, adult organism, horse, equus caballus, salmonella gastroenteritis, antibiotic, united states of america, feces2022-05-02v4No1 / 13
930amnon high in cigarette smoking compared to non-smoker in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 13
930amnondominant human adult stage, cigarette smoking, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 13
7amnondominant urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 14
42amnonhigher in stressed mice compared to control in balb/c tcr-b deficient mice ( high in stress compared to control in mus musculus research facility feces balb/c japan )2016-12-10v4No1 / 14
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
80amnondominant feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v4No1 / 14
115amnonlower in medium and large size fish compared to small size ( high in small size compared to medium size large size in coreius guichenoti largemouth bronze gudgeon fish freshwater river biome yangtze river intestine china )2017-04-10v4No1 / 14
183amnondominant army ant, stomach, gaster, labidus praedator2017-08-15v4No1 / 14
183amnondominant neivamyrmex, army ant, stomach, gaster2017-08-15v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
190amnondominant homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 14
214amnondominant mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 14
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, high fat diet, diet2017-10-24v4No1 / 14
231amnonlower in urine compared to genitalia in dogs ( high in reproductive system reproductive organ compared to urine in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 14
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v4No1 / 14
302amnonhigh freq. in feces of Cockatiel pet birds (dominant bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 14
397amnoncommon panama, digestive system, intestine, fungus growing ant, mycocepurus smithii2018-11-14v4No1 / 14
399amnondominant feces, united states of america, oryctolagus cuniculus, rabbit, research facility2018-11-16v4No1 / 14
400amnonhigh freq. in karen (burma) females from thailand (dominant homo sapiens, feces, adult, female, thailand, karen, myanmar)2018-11-18v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 14
406amnondominant feces, zoological garden, united states of america, giraffa camelopardalis, giraffe2018-11-21v4No1 / 14
406amnondominant feces, south africa, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 14
408amnon high in larval stage compared to stomach in ant cephalotes costa rica united states of america 2018-11-22v4No1 / 14
418amnondominant coral, ocean, symphyllia, mucus2018-12-02v4No1 / 14
418amnondominant coral, ocean, diploastrea heliopora, mucus2018-12-02v4No1 / 14
438amnondominant tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v4No1 / 14
456amnon high in tongue compared to caecum in mus musculus mouse research facility united states of america c57bl/6 female 2019-01-10v4No1 / 14
458amnonhigh freq. in mice strains from jackson laboratories (dominant mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 14
469amnondominant homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 14
499amnondominant ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 14
499amnondominant brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 14
499amnondominant brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 14
502amnon high in control compared to schizophrenia in homo sapiens feces adult united states of america 2019-03-12v4No1 / 14
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 14
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
546amnondominant homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 14
564amnon high in control compared to autistic disorder in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v3No1 / 14
585amnondominant china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 14
585amnondominant china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 14
596amnondominant 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v3No1 / 14
596amnondominant 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 14
596amnondominant 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 14
617amnon high in october autumn compared to spring june in lowland pasture lowland farm farm italy cow milk (raw) cow milk (fluid) milk 2020-05-03v3No1 / 14
625amnondominant son tra nature reserve, viet nam, pygathrix nemaeus, red-shanked douc, wild, feces2020-05-16v4No1 / 14
626amnoncommon strix varia, barred owl, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v1No1 / 14
646amnondominant adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in united states of america dog canis lupus familiaris feces state of louisiana 2020-09-06v4No1 / 14
666amnondominant italy, feces, wood mouse, apodemus sylvaticus2020-09-25v3No1 / 14
666amnondominant equus asinus africanus, african wild ass, feces, italy2020-09-25v3No1 / 14
666amnondominant rattus rattus, rat, italy, feces2020-09-25v3No1 / 14
693amnondominant graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 14
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v4No1 / 14
725amnondominant acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
734amnon high in omnivore diet compared to vegetarian diet in republic of china taiwan adult feces homo sapiens 2021-01-22v3No1 / 14
748amnondominant jersey cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 14
759amnondominant state of alabama, united states of america, feces, wild, wild boar, sus scrofa2021-04-04v4No1 / 14
770amnondominant age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 14
781amnondominant giraffe, giraffa tippelskirchi, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 14
790amnondominant omsk, russia, intestinal contents, intestine, farm, peking duck, anas platyrhynchos2021-06-07v3No1 / 14
797amnon high in breast fed compared to formula fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 14
797amnon high in 1-month-old human stage compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 14
797amnondominant breast fed, age 7 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 14
812amnondominant zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v3No1 / 14
831amnondominant israel, adult, feces, homo sapiens, pancreatic cancer2021-09-11v3No1 / 14
834amnondominant homo sapiens, feces, japan, adult2021-09-11v1No1 / 14
862amnondominant himalayan griffon, gyps himalayensis, china, qinghai province, bird, feces2022-01-20v4No1 / 14
865amnon high in canis lupus wolf compared to canis lupus familiaris dog in china feces 2022-02-08v3No1 / 14
873amnondominant human adult stage, rural community, africa, tanzania, adult, homo sapiens, feces2022-03-03v1No1 / 14
876amnondominant age 20 months, monkey, state of washington, macaca mulatta, juvenile organism, research facility, united states of america, feces2022-03-06v4No1 / 14
876amnondominant neonate, monkey, age 1 week, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v4No1 / 14
888amnondominant milk collection tanker, cow milk (raw), cow milk (fluid), ireland, milk2022-03-30v3No1 / 14
891amnondominant urban slum, 1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 14
919amnondominant 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 14
930amnondominant human adult stage, non-smoker, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 14
42amnonhigher on stressed mice compared to control in c57bl tcr-b deficient mice ( high in stress compared to control in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 15
51amnondominant feces, homo sapiens, united states of america2017-01-19v4No1 / 15
63amnonhigh freq. in saliva in american gut ( high in compared to in homo sapiens saliva )2017-02-15v4No1 / 15
63amnonhigh freq. in saliva in american gut (dominant homo sapiens, saliva)2017-02-15v4No1 / 15
64amnondominant saliva, homo sapiens, sichuan province2017-02-16v4No1 / 15
74amnondominant united states of america, feces, homo sapiens2017-02-27v4No1 / 15
75amnondominant homo sapiens, feces, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 15
99amnondominant commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 15
131amnonnegatively correlated with waist circumference ( high in small waist circumference compared to waist circumference large waist circumference in homo sapiens feces south korea )2017-04-16v4No1 / 15
219amnonhigher in controls compared to ASD mice (following mother VPA treatment) ( high in control compared to valproic acid autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 15
276amnondominant feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 15
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 15
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
339amnondominant under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v4No1 / 15
358amnondominant rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
371amnondominant homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 15
379amnonlower in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in control compared to campylobacter in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 15
380amnondominant tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 15
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
384amnondominant equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v4No1 / 15
397amnoncommon panama, digestive system, intestine, fungus growing ant, cyphomyrmex longiscapus2018-11-14v4No1 / 15
405amnondominant mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 15
406amnondominant feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 15
406amnondominant feces, south africa, acinonyx jubatus, cheetah2018-11-21v4No1 / 15
406amnondominant feces, south africa, acinonyx jubatus, cheetah2018-11-21v4No1 / 15
406amnondominant feces, zoological garden, diceros bicornis, black rhinoceros, united states of america, switzerland2018-11-21v4No1 / 15
418amnondominant coral, ocean, seriatopora caliendrum, mucus2018-12-02v4No1 / 15
418amnondominant coral, ocean, pavona varians, mucus2018-12-02v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 15
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 4 weeks2018-12-23v4No1 / 15
440amnondominant galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 15
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 15
456amnoncommon mus musculus, mouse, research facility, united states of america, c57bl/6, female, tongue2019-01-10v4No1 / 15
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 15
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 15
502amnondominant homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 15
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 15
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 15
515amnondominant whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ovatus2019-04-18v4No1 / 15
517amnondominant feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 15
524amnondominant homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 15
550amnoncommon city, hokkaido, starfish, asterias amurensis, coelomic fluid, wild, japan2019-08-18v4No1 / 15
550amnon high in starfish coelomic fluid wild patiria pectinifera compared to sea water in city hokkaido japan 2019-08-18v4No1 / 15
559amnondominant feces, united states of america, captive, zoological garden, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v4No1 / 15
568amnondominant gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 15
570amnondominant homo sapiens, feces, india, bihar state2019-12-16v3No1 / 15
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 15
592amnoncommon feces, wild, state of florida, carcharhinus leucas, bull shark2020-02-18v1No1 / 15
592amnondominant feces, wild, state of florida, carcharhinus leucas, bull shark2020-02-18v1No1 / 15
596amnondominant 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 15
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 15
620amnondominant saint louis zoo, saint louis, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 15
651amnondominant control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
651amnondominant parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 15
655amnon high in hematopoietic stem cell transplant after hcst compared to before hsct in italy feces homo sapiens 2020-09-13v3No1 / 15
658amnon high in african american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 15
658amnon high in hispanic hispanic or latin american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 15
666amnondominant donkey, equus asinus, equus asinus africanus, feces, italy2020-09-25v3No1 / 15
671amnondominant female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 15
702amnoncommon canis lupus familiaris, dog, state of north carolina, united states of america, feces2028-04-02v4No1 / 15
707amnon high in systemic lupus erythematosus compared to control in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 15
708amnondominant c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 15
729amnondominant cameroon, wild, feces, monkey, gorilla gorilla2021-01-05v3No1 / 15
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in tanzania pemba island adult female feces homo sapiens 2021-01-25v3No1 / 15
741amnon high in pellet feed diet compared to alfalfa diet in intestine ram's horn snail china research facility planorbella trivolvis 2021-02-17v3No1 / 15
770amnondominant age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 15
777amnoncommon 2-days-old human, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 15
778amnondominant farm, thailand, intestine, black tiger shrimp, penaeus monodon2021-04-28v3No1 / 15
779amnon high in crohn's disease compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 15
781amnondominant kirk's dik-dik, madoqua kirkii, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 15
787amnoncommon in high grain diet induced subacute acidosis (dominant acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 15
797amnon high in 3-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 15
797amnon high in 12-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 15
797amnoncommon 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
797amnondominant 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
797amnoncommon 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 15
802amnondominant cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v4No1 / 15
805amnondominant sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v3No1 / 15
806amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 15
815amnon high in vulpes corsac corsac fox compared to vulpes vulpes red fox in lake hulun wild winter mongolia feces 2021-07-04v3No1 / 15
844amnondominant iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 15
846amnondominant stimulated saliva, human adult stage, commonwealth of massachusetts, adult, saliva, united states of america, homo sapiens2021-11-20v3No1 / 15
847amnondominant human early adulthood stage, japan, feces2021-12-01v1No1 / 15
850amnondominant in vitro fertilization clinic, anambra state, sperm, semen, male organism, nigeria, adult, homo sapiens2021-12-16v4No1 / 15
860amnondominant duck, china, intestinal contents, anas platyrhynchos, intestine, research facility2022-01-12v3No1 / 15
873amnondominant human adult stage, botswana, rural community, africa, adult, homo sapiens, feces2022-03-03v1No1 / 15
888amnondominant skimmed milk powder, milk powder, cow milk based food product, ireland, milk2022-03-30v3No1 / 15
892amnon high in 2-year-old human stage compared to 4-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v4No1 / 15
919amnondominant 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, 2-year-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 15
925amnondominant vestibular dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 15
926amnondominant 2-5 year-old child stage, orenburg, supragingival dental plaque, supragingival plaque, russia, child, homo sapiens2022-07-28v3No1 / 15
15amnondominant namibia, feces, canis mesomelas2016-11-08v4No1 / 16
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in homo sapiens feces sichuan province )2016-12-06v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 16
49amnondominant giraffa camelopardalis, feces2017-01-19v4No1 / 16
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 16
211amnonHigh freq. in multiple mouse strains feces (dominant mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 16
214amnondominant mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 16
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 16
310amnondominant homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 16
319amnondominant homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 16
348amnondominant homo sapiens, saliva, italy, adult2018-07-16v4No1 / 16
352amnondominant homo sapiens, feces, new delhi, india2018-07-30v4No1 / 16
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
371amnonnegatively correlated with age in amerindian saliva ( high in obsolete_juvenile stage infant compared to adult in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
397amnondominant panama, digestive system, intestine, fungus growing ant, atta sexdens2018-11-14v4No1 / 16
399amnondominant pan troglodytes, chimpanzee, zoological garden, feces, united states of america, state of tennessee2018-11-16v4No1 / 16
407amnondominant costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 16
411amnondominant zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 16
427amnondominant united states of america, eastern red backed salamander, plethodon cinereus, salamander, feces, commonwealth of virginia2018-12-08v4No1 / 16
434amnon high in fructose diet fructose compared to control diet in rat rattus norvegicus sprague dawley feces caecum research facility switzerland 2018-12-20v4No1 / 16
440amnondominant galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 16
448amnondominant equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 16
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in mouse mus musculus feces research facility united states of america state of iowa cf-1 )2019-01-28v4No1 / 16
493amnondominant homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 16
519amnondominant homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 16
526amnonhigh freq. in bile of healthy controls (dominant control, kingdom of spain, adult, bile, gallbladder, homo sapiens)2019-07-14v3No1 / 16
532amnondominant homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 16
541amnondominant phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 16
576amnon high in aphthous stomatitis compared to control in homo sapiens czech republic adult tongue 2020-01-09v3No1 / 16
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 16
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, antibiotic, ampicillin, neomycin2020-02-09v4No1 / 16
589amnondominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 16
592amnondominant feces, democratic republic of the congo, wild, pan paniscus, bonobo2020-02-18v1No1 / 16
598amnondominant 14-year-old human stage, 13-year-old human stage, child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 16
620amnondominant lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 16
625amnondominant feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v4No1 / 16
625amnondominant pongo abelii, sumatran orangutan, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 16
652amnondominant sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 16
656amnondominant child stage, adolescent stage, age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 16
659amnondominant ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 16
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v4No1 / 16
666amnondominant pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 16
678amnondominant control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 16
680amnondominant obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 16
683amnondominant during antibiotics treatment in feces (dominant metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v4No1 / 16
696amnondominant state of sabah, malaysia, gastrointestinal system, stomach, land snail, opisthostoma concinnum, plectostoma concinnum2028-03-27v3No1 / 16
696amnondominant alycaeus jagori, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 16
696amnondominant helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 16
713amnon high in active disease compared to remission in crohn's disease feces homo sapiens 2028-05-21v3No1 / 16
723amnondominant feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 16
725amnondominant chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 16
728amnoncommon clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 16
748amnondominant holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 16
753amnondominant zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v4No1 / 16
781amnondominant elephant, loxodonta africana, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 16
794amnondominant control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 16
816amnondominant late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 16
872amnondominant age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v1No1 / 16
872amnondominant 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v1No1 / 16
884amnondominant human adult stage, state of california, adult, united states of america, homo sapiens, feces2022-03-24v4No1 / 16
892amnondominant 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v4No1 / 16
902amnondominant antibiotics induced colitis, colitis, adult organism, horse, equus caballus, antibiotic, colitis, united states of america, feces2022-05-02v4No1 / 16
920amnon high in mouse chow compared to high fat diet in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 16
922amnondominant no dental caries, 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-07-25v4No1 / 16
927amnondominant licosa island, lizard, podarcis siculus, italy, feces2022-08-15v3No1 / 16
932amnon high in odontomachus hastatus compared to odontomachus chelifer in stomach gaster atlantic rainforest parque estadual serra do mar-núcleo picinguaba sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 16
32amnondominant homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
42amnonhigh freq. in tcr-b deficient c57bl6 mice (dominant mus musculus, research facility, feces, c57bl/6, japan)2016-12-10v4No1 / 17
65amnondominant lytechinus variegatus, feces, digesta, state of florida2017-02-17v4No1 / 17
71amnondominant liolaemus ruibali, argentina, research facility, feces2017-02-25v4No1 / 17
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
116amnondominant research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 17
208amnondominant mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 17
212amnondominant mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 17
212amnondominant mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in homo sapiens feces united states of america )2017-10-23v4No1 / 17
278amnondominant homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 17
289amnondominant homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 17
290amnondominant homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 17
351amnondominant sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 17
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 17
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 17
369amnondominant mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 17
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to obsolete_juvenile stage infant in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v4No1 / 17
381amnondominant bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 17
387amnon high in winter compared to summer in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 17
406amnondominant feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 17
418amnondominant coral, ocean, mucus, echinopora mammiformis2018-12-02v4No1 / 17
418amnoncommon coral, ocean, stylophora pistillata, mucus2018-12-02v4No1 / 17
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 17
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 17
481amnondominant united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 17
499amnondominant brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 17
503amnonincreases following malaria infection ( high in late time points malaria compared to control early time points in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 17
526amnon high in control compared to cholelithiasis in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 17
570amnon high in control compared to visceral leishmaniasis in homo sapiens feces india bihar state 2019-12-16v3No1 / 17
574amnon high in primary progressive multiple sclerosis compared to control in feces homo sapiens russia adult 2020-01-05v3No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 17
590amnondominant china, turtle farm, farm, hainan autonomous prefecture, intestine, red-eared slider turtle, trachemys scripta elegans, age 0 days, neonate stage2020-02-10v4No1 / 17
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 17
598amnonhigher in kids that do no eat sweets ( high in diet without sweets compared to diet containing sweets in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 17
607amnondominant germany, homo sapiens, feces, control2020-04-19v4No1 / 17
630amnondominant madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 17
639amnondominant nature reserve, adult, wild, australia, feces, european rabbit, oryctolagus cuniculus2020-08-21v3No1 / 17
640amnondominant saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 17
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 17
660amnondominant shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 17
661amnondominant lung, farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus2020-09-20v4No1 / 17
663amnondominant low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 17
688amnondominant nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 17
729amnondominant cameroon, wild, monkey, feces, pan troglodytes troglodytes, central chimpanzee2021-01-05v3No1 / 17
730amnondominant control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 17
743amnondominant feces, farm, captive, italy, adult, european hare, lepus europaeus2021-02-21v3No1 / 17
759amnondominant state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 17
775amnondominant jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 17
777amnondominant 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 17
777amnondominant 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 17
797amnon high in breast fed compared to formula fed in age 7 months germany infant feces homo sapiens 2021-06-13v3No1 / 17
797amnoncommon 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 17
816amnondominant early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 17
839amnondominant meerkat, suricata suricatta, kalahari desert, morning, south africa, feces2021-11-08v4No1 / 17
849amnondominant fourth decade human stage, china, multiple sclerosis, multiple sclerosis, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 17
852amnondominant non-smoker, canada, adult, saliva, homo sapiens2021-12-17v4No1 / 17
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 17
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 17
867amnondominant gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 17
892amnondominant 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 17
920amnondominant south korea, male organism, mouse chow, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v3No1 / 17
922amnondominant no dental caries, 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v4No1 / 17
927amnondominant punta licosa, lizard, podarcis siculus, italy, feces2022-08-15v3No1 / 17
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v4No1 / 18
26amnondominant canis lupus familiaris, united states of america, saliva, mouth2016-12-05v4No1 / 18
36amnondominant homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
39amnonhigh freq. in obsese lepr-db mice (dominant mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 18
119amnondominant mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 18
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 18
207amnonhigh freq. in people hospitalized with diarrhea (dominant homo sapiens, israel, feces, diarrhea)2017-10-05v4No1 / 18
214amnondominant mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 18
215amnondominant homo sapiens, feces, united states of america2017-10-23v4No1 / 18
220amnondominant mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 18
246amnondominant homo sapiens, saliva, italy2017-11-21v4No1 / 18
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 18
284amnondominant 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 18
293amnondominant homo sapiens, feces, adult, united states of america, cron diet, caloric restriction diet2018-02-07v4No1 / 18
294amnondominant homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 18
294amnonhigh freq. in non-IBS healthy controls (dominant homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 18
302amnonhigh freq. in feces of parakeet pet birds (dominant bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 18
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in mus musculus mouse male c3h/hej feces united states of america research facility )2018-03-19v4No1 / 18
331amnondominant feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 18
339amnondominant homo sapiens, feces, adult, india2018-05-24v4No1 / 18
351amnondominant sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 18
368amnondominant feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 18
384amnondominant equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (dominant ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 18
408amnoncommon ant, cephalotes, stomach, costa rica, united states of america2018-11-22v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america feces )2018-11-22v4No1 / 18
418amnoncommon coral, ocean, isopora palifera, mucus2018-12-02v4No1 / 18
419amnondominant rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 18
423amnondominant bank vole, myodes glareolus, ukraine, feces2018-12-05v4No1 / 18
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in homo sapiens feces africa child )2018-12-08v4No1 / 18
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 18
430amnondominant 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v4No1 / 18
440amnondominant galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
466amnonhigh freq. in cow feces left in field for 30-60 days (dominant feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v4No1 / 18
477amnondominant homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 18
488amnondominant canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 18
532amnondominant homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 18
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 18
561amnon high in winter withered grass diet compared to spring green stage diet in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 18
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 18
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v3No1 / 18
607amnondominant germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 18
623amnoncommon skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 18
625amnondominant state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 18
625amnondominant emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 18
627amnondominant feces, pregnancy, adult, female, china2020-05-16v3No1 / 18
630amnon high in low physical activity sedentary compared to high physical activity in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 18
642amnoncommon san diego, pacific ocean, chub mackerel, scomber japonicus, feces, digesta, fish2020-08-28v4No1 / 18
650amnondominant asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 18
663amnondominant poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 18
663amnondominant poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 18
666amnondominant lama guanicoe, italy, feces2020-09-25v3No1 / 18
666amnondominant european rabbit, oryctolagus cuniculus, italy, feces2020-09-25v3No1 / 18
666amnondominant wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 18
666amnondominant brown bear, ursus arctos, italy, feces2020-09-25v3No1 / 18
671amnondominant age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 18
700amnondominant belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 18
713amnondominant remission, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 18
716amnondominant chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 18
739amnondominant age 5 years, goat, capra hircus, creole goat, research facility, ruminal fluid, rumen, argentina2021-01-30v4No1 / 18
774amnondominant control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 18
777amnoncommon 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
777amnondominant 18-month-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
777amnondominant 5-year-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
781amnondominant warthog, phacochoerus africanus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 18
797amnondominant 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 18
799amnonhigher before ketogenic diet compared to after ketogenic diet in obese participants ( high in control diet compared to ketogenic diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples before ketogenic diet (dominant obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
799amnondominant in obese participant fecal samples after 1 month ketogenic diet (dominant ketogenic diet, obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 18
817amnondominant united states of america, cheek pouch, oral cavity, saliva, oral wash, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 18
831amnondominant israel, adult, feces, homo sapiens, control2021-09-11v3No1 / 18
833amnondominant homo sapiens, feces, age 60-65 years, slovak republic, adult, normal exercise2021-09-11v1No1 / 18
841amnondominant human adult stage, state of texas, adult, saliva, united states of america, homo sapiens2021-11-08v4No1 / 18
848amnoncommon 6-month-old human stage, infant, kingdom of spain, feces, homo sapiens2021-12-13v1No1 / 18
865amnondominant inner mongolia autonomous region, china, dog, canis lupus familiaris, feces2022-02-08v3No1 / 18
874amnondominant human late adulthood stage, buffalo, postmenopausal, subgingival dental plaque, subgingival plaque, state of new york, female, united states of america, homo sapiens2022-03-04v3No1 / 18
875amnondominant human late adulthood stage, saen thong subdistrict, village, rural community, thailand, adult, homo sapiens, feces2022-03-04v3No1 / 18
880amnondominant human adult stage, kingdom of denmark, adult, homo sapiens, feces2022-03-12v3No1 / 18
885amnondominant human early adulthood stage, state of florida, united states of america, homo sapiens, feces2022-03-26v3No1 / 18
892amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-04-07v4No1 / 18
892amnondominant 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 18
898amnondominant coyote, canis latrans, edmonton, adult organism, wild, canada, male, feces2022-04-19v4No1 / 18
899amnoncommon in snail intestine from phytoremedation field (dominant phytoremedation field, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, field, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 18
920amnon high in high fat diet compared to mouse chow in south korea male organism mouse c57bl/6 mus musculus research facility feces 2022-07-19v3No1 / 18
922amnondominant human adult stage, adult, saliva, united states of america, homo sapiens2022-07-25v4No1 / 18
922amnondominant no dental caries, 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v4No1 / 18
932amnon high in odontomachus chelifer compared to odontomachus hastatus in atlantic rainforest parque estadual serra do mar-núcleo picinguaba sao paulo state ant gaster brazil stomach tropical moist broadleaf forest biome 2022-08-30v4No1 / 18
54amnondominant homo sapiens, saliva, united states of america2017-01-23v4No1 / 19
60amnondominant anser cygnoides, feces, china2017-02-03v4No1 / 19
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
66amnondominant homo sapiens, saliva, amsterdam, adult2017-02-18v4No1 / 19
99amnondominant commonwealth of virginia, united states of america, skin, mucus, pseudacris crucifer, peeper2017-04-02v4No1 / 19
115amnoncommon coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 19
121amnondominant homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 19
216amnondominant mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 19
276amnondominant feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 19
292amnondominant homo sapiens, adult, feces, control, china2018-02-05v4No1 / 19
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
330amnon high in infant age 1 year compared to fourth decade human stage adult in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
339amnoncommon under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v4No1 / 19
401amnondominant homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 19
404amnondominant homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
418amnon high in mucus compared to tissue in ocean coral diploastrea heliopora 2018-12-02v4No1 / 19
438amnondominant young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 19
438amnondominant 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 19
449amnondominant homo sapiens, feces, colombia2019-01-09v4No1 / 19
455amnondominant homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 19
463amnoncommon intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 19
477amnonhigher in agrarian tharu population compared to foraging chepang population ( high in tharu agrarian compared to chepang forager in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 19
477amnondominant homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 19
477amnondominant homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 19
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 19
489amnondominant feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 19
503amnondominant mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 19
516amnondominant homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 19
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 19
537amnonhigh freq. in feces of captive grown deer mice feces (dominant feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 19
573amnondominant feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v4No1 / 19
574amnondominant feces, homo sapiens, russia, adult2020-01-05v3No1 / 19
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 19
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 19
666amnondominant south american tapir, tapirus terrestris, italy, feces2020-09-25v3No1 / 19
671amnondominant age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 19
678amnondominant tooth disease, black dental staining, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 19
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 19
704amnondominant istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v3No1 / 19
706amnondominant state of north carolina, united states of america, feces, canis lupus familiaris, dog2028-04-10v4No1 / 19
707amnon high in control compared to systemic lupus erythematosus in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 19
725amnondominant control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 19
729amnondominant captive, monkey, feces, zoological garden, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 19
732amnondominant municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 19
736amnondominant tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 19
736amnondominant 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 19
757amnondominant feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 19
774amnondominant tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 19
796amnondominant control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 19
797amnondominant 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v3No1 / 19
797amnondominant 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 19
803amnondominant human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 19
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis, gingival erosive oral lichen planus, oral lichen planus2021-09-11v3No1 / 19
844amnondominant iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 19
866amnondominant mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, control, feces2022-02-08v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 19
867amnondominant gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 19
871amnon high in iga positive fraction compared to iga negative fraction in before antibiotics human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 19
885amnon high in c57bl/6 t1r2-ko compared to c57bl/6 in mouse state of ohio mus musculus research facility united states of america feces 2022-03-26v3No1 / 19
924amnondominant 8-year-old human stage, 7-year-old human stage, china, supragingival dental plaque, supragingival plaque, guangzhou city prefecture, child2022-07-27v3No1 / 19
925amnondominant interproximal dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 19
2amnon high in anorexia nervosa compared to control in homo sapiens feces 2016-10-05v4No1 / 20
26amnondominant united states of america, felis catus, saliva, mouth2016-12-05v4No1 / 20
45amnonhigh freq. in feces babies <2 years in india (dominant homo sapiens, feces, infant, india)2016-12-19v4No1 / 20
46amnonsmj: higher in mice feces with antiobiotics ( high in sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic compared to control in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 20
158amnondominant cat, felis catus, united states of america, saliva, mouth2017-07-06v4No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in mouse mus musculus nod mouse united states of america female feces research facility )2017-07-18v4No1 / 20
190amnonlower in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp sengeli compared to camp hukamako in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v4No1 / 20
197amnondominant 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, finland2017-09-12v4No1 / 20
188amnondominant mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 20
238amnondominant homo sapiens, feces, colombia2017-11-07v4No1 / 20
242amnonhigh freq. in native-americans (dominant homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 20
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v4No1 / 20
273amnondominant 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 20
284amnoncommon homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
284amnondominant homo sapiens, female, feces, state of california, infant, age 2 months2018-01-27v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 20
292amnondominant homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
328amnonlower in feces compared to intestinal mucosa in mice ( high in mucosa intestine digestive tract compared to feces in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 20
344amnonhigh freq. in feces of homosexual males (dominant homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 20
368amnondominant feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 20
390amnondominant homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 20
394amnondominant homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 20
399amnondominant feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
408amnondominant ant, cephalotes, stomach, costa rica, united states of america2018-11-22v4No1 / 20
418amnoncommon coral, ocean, turbinaria reniformis, mucus2018-12-02v4No1 / 20
419amnonhigh freq. in rats with induced constipation (dominant rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 20
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, control diet2018-12-13v4No1 / 20
434amnondominant rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 20
437amnondominant fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 20
457amnondominant mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 20
476amnondominant mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 20
477amnondominant homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 20
484amnondominant feces, adult, 17-29-years-old human, united states of america, state of michigan, homo sapiens2019-02-13v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 20
563amnondominant homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 20
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v3No1 / 20
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 20
591amnon high in parkinson's disease compared to control in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v4No1 / 20
594amnondominant adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in homo sapiens feces china adult 2020-03-30v4No1 / 20
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 20
629amnondominant amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 20
629amnondominant msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 20
639amnondominant lepus europaeus, european brown hare, nature reserve, adult, wild, australia, feces2020-08-21v3No1 / 20
650amnondominant state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 20
663amnondominant obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 20
666amnondominant canis lupus familiaris, dog, italy, feces2020-09-25v3No1 / 20
671amnondominant age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 20
703amnondominant saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 20
704amnon high in periodontitis compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 20
720amnondominant autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 20
723amnoncommon infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v3No1 / 20
730amnondominant crohn's disease, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 20
734amnondominant vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 20
759amnondominant wildlife sactuary, state of minnesota, canis lupus, wolf, united states of america, feces2021-04-04v4No1 / 20
766amnondominant n in feces of dog females within 24h after parturition (dominant french republic, age 2-7 years, adult organism, female organism, rectal swab, feces, canis lupus familiaris, dog)2021-04-12v4No1 / 20
766amnondominant puppy, age 2 days, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 20
797amnoncommon 12-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
803amnondominant human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 20
805amnon high in nicotine dependence cigarette smoking smoker compared to non-smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v3No1 / 20
826amnondominant age 4 years, subgingival dental plaque, adult organism, female organism, dog, subgingival plaque, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 20
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis2021-09-11v3No1 / 20
851amnondominant milan, italy, adult, homo sapiens, feces2021-12-16v3No1 / 20
866amnon high in control compared to ulcerative colitis ulcerative colitis in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 20
869amnondominant human adult stage, high bmi, kingdom of the netherlands, adult, obesity, homo sapiens, feces2022-02-18v3No1 / 20
879amnondominant wolf, canis lupus, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 20
881amnondominant bologna, adult organism, dog, italy, canis lupus familiaris, feces2022-03-12v3No1 / 20
892amnondominant 1-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, infant, united states of america, homo sapiens2022-04-07v4No1 / 20
892amnondominant 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v4No1 / 20
899amnonlower in snail intestine from phytoremedation field compared to greenhouse ( high in greenhouse compared to phytoremedation field field in heavy metal contaminated soil land snail bradybaena ravida china sedum alfredii heavy metal zhejiang province intestine )2022-04-25v3No1 / 20
920amnondominant south korea, male organism, mouse, c57bl/6, high fat diet, mus musculus, research facility, feces2022-07-19v3No1 / 20
922amnondominant no dental caries, 1-year-old human stage, supragingival dental plaque, supragingival plaque, infant, dentition, united states of america, homo sapiens2022-07-25v4No1 / 20
922amnondominant no dental caries, 4-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v4No1 / 20
15amnondominant acinonyx jubatus, namibia, feces2016-11-08v4No1 / 21
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 21
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 21
72amnondominant canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 21
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
122amnondominant homo sapiens, feces, united kingdom2017-04-13v4No1 / 21
124amnondominant mus musculus, mouse, caecum, feces, c57bl/6j, united states of america2017-04-14v4No1 / 21
149amnondominant salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, pond2017-04-24v4No1 / 21
221amnondominant rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 21
240amnonhigh freq. in infants age <3 years (dominant homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 21
241amnonhigh freq. in babies age < 3 years in finland (dominant homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 21
247amnondominant homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 21
249amnondominant homo sapiens, feces, united states of america2017-11-22v4No1 / 21
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
320amnondominant homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 21
330amnondominant fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v4No1 / 21
350amnonhigh freq. in feces of white faced capuchin from costa rica rain forest (dominant monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
390amnondominant homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 21
393amnondominant homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 21
396amnoncommon fish, england, intestine, digestive system, oncorhynchus mykiss, rainbow trout2018-11-14v4No1 / 21
398amnonhigh freq. in feces of healthy adults from belgium (dominant homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 21
399amnondominant feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 21
404amnon high in normal stool compared to hard stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 21
406amnondominant feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 21
406amnondominant feces, zoological garden, ceratotherium simum, white rhinoceros, french republic2018-11-21v4No1 / 21
409amnondominant homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 21
418amnoncommon coral, ocean, porites cylindrica, mucus2018-12-02v4No1 / 21
429amnondominant rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 21
442amnondominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 21
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 21
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 4 weeks2019-03-04v4No1 / 21
503amnon high in c57bl/6 compared to balb/c in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 21
503amnondominant mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 21
522amnondominant mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 21
529amnonhigh freq. in patients that underwent low anterior resection (dominant homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 21
575amnonhigh freq. in professional martial arts athletes (dominant young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v3No1 / 21
576amnondominant homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 21
581amnondominant in red swamp crayfish grown in flooded rice field (dominant procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v3No1 / 21
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v4No1 / 21
591amnondominant human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 21
593amnondominant homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 21
596amnoncommon 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 21
597amnondominant homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 21
607amnondominant germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 21
626amnondominant red-tailed hawk, buteo jamaicensis, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v1No1 / 21
642amnon high in gastrointestinal system alimentary part of gastrointestinal system compared to feces digesta in fish chub mackerel scomber japonicus san diego pacific ocean 2020-08-28v4No1 / 21
658amnon high in hispanic hispanic or latin american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v3No1 / 21
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 21
663amnon high in low bmi compared to obese body mass index status high bmi obesity in adult switzerland poland feces homo sapiens 2020-09-22v4No1 / 21
666amnondominant zoological garden, hippopotamus amphibius, italy, feces2020-09-25v3No1 / 21
671amnondominant 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 21
703amnondominant dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 21
716amnondominant control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 21
720amnondominant control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 21
726amnondominant tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 21
728amnondominant clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 21
734amnondominant omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 21
741amnondominant alfalfa diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 21
759amnondominant state of vermont, farm, pig, united states of america, feces, sus scrofa2021-04-04v4No1 / 21
759amnondominant city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 21
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 21
794amnondominant antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 21
806amnondominant saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 21
810amnondominant in sea turtle feces from sea turtle rescue center (dominant adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v3No1 / 21
814amnondominant high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 21
825amnondominant age 6-14 years, hangzhou city prefecture, china, child, control, homo sapiens, feces2021-08-12v3No1 / 21
835amnondominant feces, homo sapiens, japan, adult2021-09-11v3No1 / 21
848amnondominant 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v1No1 / 21
859amnoncommon formula fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 21
864amnondominant la michilia biosphere reserve, mexican wolf, dog food diet, canis lupus baileyi, municipality of suchil, captive, mexico, feces2022-02-08v3No1 / 21
867amnon high in third trimester compared to second trimester in gestational diabetes gestational diabetes human adult stage turin township italy adult pregnancy female homo sapiens feces 2022-02-09v3No1 / 21
870amnondominant fourth decade human stage, third decade human stage, auckland city, new zealand, adult, homo sapiens, feces2022-02-18v3No1 / 21
877amnondominant human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v4No1 / 21
879amnondominant adult organism, captive, dog, austria, canis lupus familiaris, research facility, feces2022-03-12v4No1 / 21
911amnon high in spinal cord injury compared to control in human adult stage china nanjing city prefecture homo sapiens feces 2022-05-21v4No1 / 21
911amnondominant human adult stage, china, nanjing city prefecture, control, homo sapiens, feces2022-05-21v4No1 / 21
918amnon high in third trimester pregnancy compared to non-pregnant in human early adulthood stage japan adult saliva female homo sapiens 2022-07-15v3No1 / 21
925amnondominant lingual dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 21
928amnondominant human early adulthood stage, kuwait, adult, homo sapiens, feces2022-08-16v3No1 / 21
932amnon high in gaster stomach compared to chitin-based cuticle cuticle in atlantic rainforest tropical moist broadleaf forest biome parque estadual serra do mar-núcleo picinguaba sao paulo state brazil odontomachus hastatus ant 2022-08-30v4No1 / 21
69amnondominant canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 22
87amnoncommon homo sapiens, lung, trachea, bronchus, state of michigan2017-03-07v4No1 / 22
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
120amnondominant homo sapiens, feces, brazil2017-04-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
219amnonhigh freq. in mother mice feces (dominant mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 22
225amnonhigh freq. in wild type cotrols (dominant mouse, mus musculus, feces, research facility, wild type genotype, united kingdom)2017-10-29v4No1 / 22
248amnondominant mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 22
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult saliva 2018-01-23v4No1 / 22
284amnondominant homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 22
293amnondominant homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
297amnondominant adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
334amnondominant mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 22
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ailurus fulgens, red panda2018-11-16v4No1 / 22
404amnonpositively correlated with fiber intake ( high in plant fiber cell high filber compared to low fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 22
418amnoncommon coral, ocean, seriatopora caliendrum, mucus2018-12-02v4No1 / 22
455amnondominant homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 22
467amnondominant homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 22
502amnondominant homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 22
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 22
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 22
552amnondominant feces, homo sapiens, czech republic2019-09-05v3No1 / 22
576amnon high in mouth mucosa compared to tongue in homo sapiens czech republic adult 2020-01-09v3No1 / 22
593amnondominant homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 22
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 22
625amnondominant black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 22
629amnondominant female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 22
648amnondominant state of louisiana, feces, canis lupus familiaris, dog2020-09-06v4No1 / 22
650amnondominant african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 22
655amnondominant in patients before hematopoietic stem cell transplant (dominant before hsct, italy, feces, homo sapiens)2020-09-13v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v3No1 / 22
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 22
666amnondominant wild, wolf, canis lupus, italy, feces2020-09-25v3No1 / 22
666amnondominant european hare, lepus europaeus, lama guanicoe, italy, feces2020-09-25v3No1 / 22
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 22
707amnondominant fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 22
713amnoncommon remission, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 22
720amnon high in control compared to autoimmune hepatitis in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 22
736amnon high in 2-year-old human stage 1-year-old human stage age 1-3 years child compared to female adult in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 22
759amnondominant state of minnesota, domestic, dog, canis lupus familiaris, united states of america, feces2021-04-04v4No1 / 22
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
779amnondominant control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
797amnon high in 1-month-old human stage compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 22
797amnondominant 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v3No1 / 22
859amnon high in breast fed compared to formula fed in 6-month-old human stage hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v4No1 / 22
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 22
865amnondominant wolf, china, canis lupus, feces2022-02-08v3No1 / 22
909amnon high in age 18 weeks compared to age 6 weeks in manchester united kingdom mouse mus musculus research facility feces 2022-05-20v3No1 / 22
918amnondominant human early adulthood stage, third trimester, japan, adult, saliva, pregnancy, female, homo sapiens2022-07-15v3No1 / 22
918amnondominant human early adulthood stage, non-pregnant, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 22
924amnon high in control compared to dental caries dental caries in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v3No1 / 22
10amnondominant homo sapiens, feces, toronto2016-10-27v4No1 / 23
42amnonhigh freq. in tcr-b deficient balb/c mice (dominant mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 23
53amnondominant homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 23
73amnondominant homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 23
132amnondominant homo sapiens, feces, united states of america2017-04-16v4No1 / 23
187amnonnegatively correlated with age 25-35 weeks ( high in early timepoints age 25 weeks compared to late timepoints age 35 weeks age in rat rattus research facility feces wistar rat czech republic )2017-08-23v4No1 / 23
197amnondominant 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, india2017-09-12v4No1 / 23
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 23
241amnonhigh freq. in babies age < 3 years in russia (dominant homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 23
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
241amnonhigh freq. in babies age < 3 years in estonia (dominant homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 23
242amnonhigher in native-americans compared to non native-american ( high in native american cheyenne arapaho compared to american in homo sapiens feces united states of america state of oklahoma )2017-11-14v4No1 / 23
284amnondominant 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 23
303amnondominant homo sapiens, feces, germany, adult2018-03-12v4No1 / 23
312amnondominant feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
383amnondominant mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 23
390amnonlower in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in non c. diff diarrhea compared to clostridium difficile intestinal infectious disease in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
394amnondominant homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 23
399amnondominant feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 23
418amnondominant coral, ocean, acropora hyacinthus, mucus2018-12-02v4No1 / 23
425amnondominant homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
487amnondominant homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 23
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 23
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 23
541amnondominant phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 23
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 23
566amnon high in insomnia compared to control in homo sapiens feces china adult 2019-11-24v4No1 / 23
568amnondominant gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 23
572amnon high in liver carcinoma compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 23
576amnon high in control compared to aphthous stomatitis in homo sapiens czech republic adult tongue 2020-01-09v3No1 / 23
601amnondominant homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 23
623amnondominant skin of body, skin, homo sapiens, umbilicus, united states of america, adult, commonwealth of pennsylvania2020-05-10v3No1 / 23
626amnondominant strix varia, barred owl, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v1No1 / 23
634amnondominant high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 23
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 23
666amnondominant homo sapiens, italy, feces2020-09-25v3No1 / 23
669amnondominant 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 23
694amnondominant china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 23
702amnondominant canis lupus familiaris, dog, state of north carolina, united states of america, feces2028-04-02v4No1 / 23
704amnondominant 10-15-years-old human, istanbul, turkey, child, saliva, homo sapiens2028-04-02v3No1 / 23
712amnondominant kazan, adult, russia, saliva, homo sapiens2028-05-21v3No1 / 23
713amnondominant active disease, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 23
734amnondominant coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 23
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 23
797amnoncommon 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 23
797amnoncommon age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 23
830amnondominant homo sapiens, feces, age 9-17 years, teenager, peru2021-09-10v4No1 / 23
832amnondominant homo sapiens, feces, adult, ibadan, nigeria2021-09-11v4No1 / 23
841amnondominant human adult stage, state of texas, adult, united states of america, homo sapiens, feces2021-11-08v4No1 / 23
843amnondominant non-celiac gluten sensitivity, human adult stage, italy, adult, feces2021-11-17v3No1 / 23
892amnondominant 2-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v4No1 / 23
922amnondominant no dental caries, 2-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v4No1 / 23
47amnonsmj: higher in mice immunized with M. vaccae ( high in immunization heat killed mycobacterium vaccae vaccination compared to vehicle bbs in c57bc/6ncrl feces united states of america mus musculus male research facility )2017-01-13v4No1 / 24
150amnondominant canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 24
173amnondominant homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 24
239amnondominant homo sapiens, feces, united states of america2017-11-08v4No1 / 24
241amnoncommon in babies age < 3 years in estonia (common homo sapiens, feces, infant, age < 3 years, estonia)2017-11-13v4No1 / 24
330amnondominant homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 24
340amnondominant feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 24
349amnondominant rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 24
354amnon high in induced sputum sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
371amnonhigher in saliva of amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in homo sapiens saliva )2018-09-06v4No1 / 24
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 24
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 24
418amnoncommon coral, ocean, galaxea astreata, mucus2018-12-02v4No1 / 24
418amnoncommon coral, ocean, fungia, mucus2018-12-02v4No1 / 24
469amnoncommon homo sapiens, adult, united states of america, state of new york, bronchoalveolar lavage, lung, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
489amnoncommon feces, anal swab, myotis myotis, bat, greater mouse eared bat, french republic2019-02-25v4No1 / 24
532amnoncommon homo sapiens, feces, czech republic, adult, short bowel syndrome2019-07-21v1No1 / 24
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua eucalyptus obliqua diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 24
566amnondominant feces, china, homo sapiens, adult2019-11-24v4No1 / 24
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 24
597amnondominant homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 24
601amnon high in type 2 diabetes mellitus compared to control in homo sapiens feces china adult 2020-03-30v4No1 / 24
617amnondominant alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 24
620amnondominant feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v4No1 / 24
641amnoncommon united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v3No1 / 24
641amnondominant united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v3No1 / 24
643amnondominant adult, south korea, feces, homo sapiens2020-08-30v4No1 / 24
666amnondominant wild cat, felis silvestris, italy, feces2020-09-25v3No1 / 24
683amnondominant state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 24
696amnoncommon georissa, georissa similis, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 24
702amnondominant felis catus, cat, state of north carolina, united states of america, feces2028-04-02v4No1 / 24
704amnonnegatively correlated with age ( high in age 5-10 years compared to 10-15-years-old human in istanbul turkey child saliva homo sapiens )2028-04-02v3No1 / 24
713amnoncommon active disease, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 24
721amnonhigher in high protein weight loss diet compared to control diet ( high in high protein diet weight loss diet weight loss compared to control diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens )2028-05-23v4No1 / 24
723amnondominant 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v3No1 / 24
745amnondominant adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 24
745amnon high in human late adulthood stage compared to 25-44 year-old human stage in adult midwest region united states of america feces homo sapiens 2021-02-25v3No1 / 24
753amnondominant china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v4No1 / 24
815amnondominant lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v3No1 / 24
826amnondominant age 4 years, supragingival dental plaque, adult organism, female organism, supragingival plaque, dog, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 24
849amnondominant fourth decade human stage, china, zhejiang province, adult, control, homo sapiens, feces2021-12-14v3No1 / 24
872amnondominant age 6-12 months, under-1-year-old human stage, gambia, child, infant, homo sapiens, feces2022-02-26v1No1 / 24
13amnon high in esophagus stomach duodenum ileum mouth compared to caecum colon rectum feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 25
53amnondominant lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
258amnonhigh freq. in lungs of hiv patients with pneumonia (dominant homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 25
284amnoncommon 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 25
290amnondominant homo sapiens, feces, adult, city, china2018-02-01v4No1 / 25
379amnondominant gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
418amnoncommon coral, ocean, physogyra lichtensteini, mucus2018-12-02v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
436amnondominant felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 25
538amnon high in feces compared to ileum terminal ileum in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 25
580amnondominant homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in colonized germ free seattle united states of america feces research facility mus musculus mouse 2020-05-04v3No1 / 25
640amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 25
661amnondominant farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus, intestine2020-09-20v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common metronidazole, vancomycin, neomycin, antibiotic, state of california, united states of america, adult, feces, homo sapiens)2028-03-04v4No1 / 25
707amnondominant fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 25
721amnondominant obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to high protein diet weight loss weight loss diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v4No1 / 25
778amnoncommon farm, thailand, intestine, black tiger shrimp, penaeus monodon2021-04-28v3No1 / 25
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 25
790amnonlower in ducks supplemented with bacillus based probiotics compared to control diet ( high in control compared to probiotics in omsk russia intestinal contents intestine farm peking duck anas platyrhynchos )2021-06-07v3No1 / 25
796amnondominant graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 25
797amnondominant 12-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 25
848amnondominant 6-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v1No1 / 25
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v4No1 / 25
891amnoncommon 1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v4No1 / 25
895amnondominant 6-12 year-old child stage, bordeaux, cystic fibrosis, french republic, child, homo sapiens, feces2022-04-16v4No1 / 25
909amnondominant manchester, united kingdom, age 18 weeks, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 25
911amnondominant human adult stage, china, spinal cord injury, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 25
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to sub-therapeutic antibiotic treatment, penicillin v potassium salt antibiotic in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility male )2017-01-12v4No1 / 26
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
114amnondominant rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in felis catus cat united states of america )2017-07-06v4No1 / 26
212amnon high in lean body mass compared to obese body mass index status db/db mouse obesity in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 26
406amnondominant feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 26
438amnondominant fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 26
499amnoncommon ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 26
578amnondominant homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 26
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 26
650amnonpositively correlated with BMI ( high in high bmi body mass index compared to low bmi in feces adult homo sapiens united states of america state of new york )2020-09-09v4No1 / 26
689amnondominant non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 26
723amnondominant infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v3No1 / 26
766amnondominant age 8 weeks, puppy, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 26
802amnondominant feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 26
826amnondominant age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, saliva, research facility, united states of america2021-08-22v4No1 / 26
869amnon high in after roux-en-y gastric bypass surgery compared to before roux-en-y gastric bypass surgery in human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 26
899amnonhigh in snail intestine from phytoremedation field compared to greenhouse ( high in phytoremedation field field compared to greenhouse in zhejiang province heavy metal contaminated soil heavy metal sedum alfredii land snail bradybaena ravida intestine china )2022-04-25v3No1 / 26
909amnondominant manchester, united kingdom, age 6 weeks, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 26
131amnondominant homo sapiens, feces, south korea2017-04-16v4No1 / 27
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in canis lupus familiaris dog feces united states of america exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
387amnoncommon in feces of wild brown bear (common ursus arctos, brown bear, feces, sweden, wild)2018-11-03v4No1 / 27
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
404amnon high in hard stool compared to normal stool in homo sapiens feces columbia city adult 2018-11-20v4No1 / 27
438amnondominant 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
488amnondominant canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 27
529amnondominant homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 27
538amnon high in feces compared to colon right colon in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 27
540amnondominant dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v4No1 / 27
584amnon high in induced type 1 diabetes type i diabetes mellitus compared to control in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v3No1 / 27
586amnondominant rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 27
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v4No1 / 27
659amnoncommon ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 27
695amnondominant milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 27
766amnon high in age 8 weeks puppy compared to age 2-7 years female organism adult organism in french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 27
797amnon high in 3-month-old human stage compared to 1-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 27
815amnondominant corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 27
924amnon high in dental caries dental caries compared to control in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v3No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in pulsed antibiotic treatment, macrolide tylosin tartrate antibiotic compared to control in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 28
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility immunization immunization mycobacterium vaccae )2017-01-13v4No1 / 28
319amnondominant homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 28
365amnondominant homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
397amnoncommon panama, digestive system, intestine, fungus growing ant, myrmicocrypta ednaella2018-11-14v4No1 / 28
399amnondominant feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 28
522amnonhigher in western diet compared to control high sugar diet ( high in high fat diet very high sugar diet western diet compared to high sugar diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 28
530amnondominant snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 28
540amnoncommon dog, canis lupus familiaris, feces, united states of america, flagstaff, state of arizona2019-07-31v4No1 / 28
562amnondominant feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 28
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 28
620amnondominant chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 28
651amnon high in female compared to male in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 28
704amnonpositively correlated with age ( high in 10-15-years-old human compared to age 5-10 years in istanbul turkey child saliva homo sapiens )2028-04-02v3No1 / 28
741amnoncommon pellet feed diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 28
766amnoncommon age 8 weeks, puppy, french republic, rectal swab, feces, canis lupus familiaris, dog2021-04-12v4No1 / 28
779amnon high in control compared to ulcerative colitis in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 28
797amnon high in age 7 months compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 28
817amnoncommon bronchoalveolar lavage, lung, united states of america, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 28
825amnondominant type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 28
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high protein diet, meat diet2021-08-29v4No1 / 28
841amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america state of texas saliva homo sapiens 2021-11-08v4No1 / 28
862amnoncommon qinghai province, china, himalayan griffon, gyps himalayensis, bird, feces2022-01-19v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, inguinal region, axilla, sebum)2016-12-05v4No1 / 29
231amnonhigh freq. in dog rectum (dominant dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 29
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 29
438amnondominant 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
503amnondecreases following malaria infection ( high in control early time points compared to late time points malaria in mouse mus musculus research facility feces balb/c japan )2019-03-12v4No1 / 29
590amnoncommon china, turtle farm, farm, hainan autonomous prefecture, intestine, red-eared slider turtle, trachemys scripta elegans, age 0 days, neonate stage2020-02-10v4No1 / 29
658amnon high in african american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 29
666amnoncommon brown bear, ursus arctos, italy, feces2020-09-25v3No1 / 29
668amnondominant new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 29
693amnon high in polycystic ovary syndrome compared to control in graz city district austria adult feces homo sapiens female 2028-03-16v1No1 / 29
704amnon high in control compared to dental caries in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 29
797amnon high in 3-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 29
817amnon high in bronchoalveolar lavage lung compared to saliva oral wash cheek pouch oral cavity in united states of america commonwealth of pennsylvania captive research facility macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 29
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, hydrolized diet2021-08-29v4No1 / 29
822amnondominant dog, canis lupus familiaris, feces, australia, city of melbourne, foxhound, research facility, high fiber2021-08-29v4No1 / 29
863amnon high in spring compared to winter in xinglong mountain national nature reserve alpine musk deer moschus chrysogaster yuzhong county china deer captive farm feces 2022-01-28v4No1 / 29
885amnondominant c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 29
892amnoncommon supragingival plaque, supragingival dental plaque, 1-year-old human stage, dental plaque, infant, united states of america, homo sapiens2022-04-07v4No1 / 29
922amnoncommon dentition, supragingival plaque, supragingival dental plaque, infant, 1-year-old human stage, no dental caries, united states of america, homo sapiens2022-07-25v4No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus mouse diet high fat diet 2017-10-22v4No1 / 30
246amnon high in high bmi body mass index obesity compared to control in homo sapiens saliva italy 2017-11-21v4No1 / 30
284amnoncommon 12-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v4No1 / 30
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
435amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, female, united states of america, state of oregon, age 9 weeks2018-12-23v4No1 / 30
438amnondominant 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
573amnoncommon feces, canis lupus familiaris, dog, united states of america, commonwealth of pennsylvania, juvenile stage2019-12-22v4No1 / 30
591amnon high in control compared to parkinson's disease in human late adulthood stage homo sapiens feces adult united states of america 2020-02-17v4No1 / 30
658amnon high in european caucasian compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 30
695amnondominant sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 30
723amnoncommon 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v3No1 / 30
774amnon high in tonsillitis compared to control in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 30
869amnon high in iga negative fraction compared to iga positive fraction in high bmi obesity human adult stage kingdom of the netherlands adult homo sapiens feces 2022-02-18v3No1 / 30
871amnon high in iga negative fraction compared to iga positive fraction in human adult stage before antibiotics amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 30
876amnoncommon age 1 week, neonate, monkey, state of washington, macaca mulatta, research facility, united states of america, feces2022-03-06v4No1 / 30
45amnoncommon in feces babies age 0-2 in india (common homo sapiens, feces, infant, india)2016-12-19v4No1 / 31
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, pond2017-04-24v4No1 / 31
219amnonhigher in controls compared toASD mice (following mother poly IC treatment) ( high in control compared to poly ic autism spectrum disorder in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 31
233amnon high in age age < 3 months compared to infant stage age > 3 months in feces homo sapiens infant united states of america 2017-11-05v4No1 / 31
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 31
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in homo sapiens feces united states of america adult )2018-11-18v4No1 / 31
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in felis catus cat feces united states of america state of colorado )2018-12-25v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age 24 weeks age in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 31
651amnon high in male compared to female in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 31
652amnon high in control compared to rheumatoid arthritis in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common before hsct, italy, feces, homo sapiens)2020-09-13v3No1 / 31
681amnondominant seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 31
796amnon high in graves' disease compared to control in taoyuan city republic of china taiwan adult feces homo sapiens 2021-06-10v3No1 / 31
797amnon high in formula fed compared to breast fed in age 7 months germany infant feces homo sapiens 2021-06-13v3No1 / 31
26amnoncommon canis lupus familiaris, united states of america, pair of nares, mucus2016-12-05v4No1 / 32
63amnoncommon in saliva in american gut (common homo sapiens, saliva)2017-02-15v4No1 / 32
63amnon high in animal product diet diet compared to plant based diet in homo sapiens united states of america feces 2017-04-12v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
354amnon high in sputum induced sputum compared to bronchial brush bronchus bronchial epithelium in homo sapiens united states of america adult 2018-07-30v4No1 / 32
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 32
578amnon high in control compared to hiv infection in homo sapiens feces adult male msm gay homosexual kingdom of spain sweden 2020-01-14v3No1 / 32
666amnoncommon wild, wolf, canis lupus, italy, feces2020-09-25v3No1 / 32
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in adult midwest region united states of america feces homo sapiens 2021-02-25v3No1 / 32
885amnondominant mouse, state of ohio, c57bl/6, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 32
187amnonpositively correlated with age 25-35 weeks ( high in late time points age 35 weeks compared to early time points 25 weeks in rat rattus research facility feces wistar rat czech republic )2017-08-23v4No1 / 33
279amnon high in small intestine stomach compared to mouth in pika ochotonidae china 2018-01-24v4No1 / 33
354amnon high in saliva oral wash compared to bronchial epithelium bronchial brush bronchus in homo sapiens united states of america adult 2018-07-30v4No1 / 33
379amnonlower in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in control compared to campylobacter in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 33
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in zambia feces papio kindae wild monkey kinda baboon )2018-11-23v4No1 / 33
646amnoncommon adult, sputum, mild disease course, cystic fibrosis, homo sapiens, state of new hampshire, united states of america2020-09-06v4No1 / 33
668amnon high in age 4 months compared to age 5 years in new zealand research facility feces felis catus cat 2020-09-26v3No1 / 33
669amnon high in 14-days-old human compared to 12-month-old human stage in sweden infant feces homo sapiens 2020-09-26v4No1 / 33
844amnon high in iron deficient diet compared to iron supplemented diet in feces australia research facility c57bl/6 mus musculus mouse 2021-11-17v3No1 / 33
892amnoncommon 1-year-old human stage, infant, saliva, united states of america, homo sapiens2022-04-07v4No1 / 33
922amnoncommon no dental caries, infant, 1-year-old human stage, saliva, united states of america, homo sapiens2022-07-25v4No1 / 33
131amnon high in male compared to female in homo sapiens feces south korea 2017-04-16v4No1 / 34
407amnoncommon costa rica, feces, monkey, cebus capucinus, white-faced capuchin, wild2018-11-21v4No1 / 34
418amnoncommon coral, ocean, pavona varians, mucus2018-12-02v4No1 / 34
418amnoncommon coral, ocean, mucus, echinopora mammiformis2018-12-02v4No1 / 34
509amnon high in urinary schistosomiasis schistosomiasis compared to control in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v4No1 / 34
629amnon high in control compared to acquired immunodeficiency syndrome hiv infection in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 34
866amnon high in iga positive fraction compared to iga negative fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 34
919amnoncommon 9-month-old human stage, 8-month-old human stage, 7-month-old human stage, 6-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 34
12amnon high in control compared to chronic fatigue syndrome in homo sapiens feces new york county 2016-11-02v4No1 / 35
24amnondisappears on transition to cow milk ( high in breast milk compared to mammalian milk beverage in homo sapiens feces infant )2016-12-01v4No1 / 35
190amnonhigher in Hadza camp Hukamako compared to hadza camp Sengeli ( high in camp hukamako compared to camp sengeli in homo sapiens tanzania hadza hunter gatherer feces )2017-09-04v4No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant finland )2017-11-12v4No1 / 35
258amnonhigher lungs of hiv pneumonia patients treated with ceftriaxone ( high in ceftriaxone compared to no ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 35
284amnon high in 12-month-old human stage compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
350amnoncommon in feces of white faced capuchin from costa rica rain forest (common monkey, cebus capucinus, feces, costa rica, white-faced capuchin, woodland area)2018-07-30v4No1 / 35
509amnon high in control compared to urinary schistosomiasis schistosomiasis in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v4No1 / 35
561amnon high in spring green stage diet compared to withered grass diet winter in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 35
596amnoncommon 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v3No1 / 35
669amnoncommon 12-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 35
759amnon high in dog food diet compared to raw meat diet in dog canis lupus familiaris state of minnesota united states of america feces 2021-04-06v4No1 / 35
864amnoncommon dog food diet, municipality of suchil, la michilia biosphere reserve, mexican wolf, canis lupus baileyi, captive, mexico, feces2022-02-08v3No1 / 35
865amnon high in dog canis lupus familiaris compared to canis lupus wolf in china feces 2022-02-08v3No1 / 35
871amnon high in iga positive fraction compared to iga negative fraction in vancomycin antibiotic human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces 2022-02-19v3No1 / 35
909amnon high in feces compared to lumen of colon in manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 35
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in mouse mus musculus feces research facility united states of america 2017-10-22v4No1 / 36
219amnonhigher in pre-weaning compared to post-weaning in mouse feces ( high in age age 21 days breast milk compared to age 28 days mouse chow in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
219amnonlower in controls compared to ASD mice (following mother poly IC treatment) ( high in poly ic autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 36
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive organ reproductive system genitalia in dog canis lupus familiaris united states of america )2017-11-02v4No1 / 36
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
399amnon high in ulcerative colitis compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 36
407amnon high in dry season compared to wet season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 36
429amnonhigher in salt sensitive rates fed salt rich diet compared to control diet ( high in salt salt rich diet compared to control diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v4No1 / 36
596amnoncommon 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 36
696amnoncommon state of sabah, malaysia, gastrointestinal system, stomach, land snail, opisthostoma concinnum, plectostoma concinnum2028-03-27v3No1 / 36
51amnonhigher in stool compared to biopsies ( high in feces compared to biopsy site biopsy in homo sapiens united states of america )2017-01-19v4No1 / 37
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 37
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in mus musculus mouse research facility feces united states of america cba/j mice )2017-08-24v4No1 / 37
219amnonlower in controls compared to ASD mice (following mother VPA treatment) ( high in valproic acid autism spectrum disorder compared to control in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 37
233amnon high in 1-year-old human stage age compared to under-1-year-old human stage in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
651amnon high in parkinson's disease compared to control in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 37
681amnoncommon seoul, south korea, adult, homo sapiens, feces2028-03-04v3No1 / 37
706amnoncommon state of north carolina, united states of america, feces, canis lupus familiaris, dog2028-04-10v4No1 / 37
723amnon high in age 0-6 months infant compared to 2-5 year-old child stage in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 37
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 37
873amnon high in hunter gatherer hadza compared to burunge sandawe maasai in tanzania rural community africa human adult stage commonwealth of pennsylvania adult homo sapiens feces 2022-03-03v1No1 / 37
297amnon high in control compared to crohn's disease ulcerative colitis in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
320amnonhigher in CD patients with remission ( high in remission compared to crohn's disease in homo sapiens feces adult )2018-04-19v4No1 / 38
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy biopsy site compared to feces luminal content in homo sapiens united states of america )2018-11-22v4No1 / 38
418amnoncommon coral, ocean, symphyllia, mucus2018-12-02v4No1 / 38
503amnonincreases following malaria infection ( high in late time points experimental cerebral malaria malaria compared to control early time points in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 38
541amnonhigher in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus obliqua diet eucalyptus obliqua compared to eucalyptus viminalis eucalyptus viminalis diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 38
584amnon high in control compared to type i diabetes mellitus induced type 1 diabetes in male rattus norvegicus rat sprague dawley research facility feces 2020-01-31v3No1 / 38
671amnon high in state of oregon compared to state of california in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 38
679amnoncommon saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v3No1 / 38
866amnon high in iga positive fraction compared to iga negative fraction in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 38
51amnon high in hiv infection compared to control in homo sapiens feces united states of america 2017-01-19v4No1 / 39
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in homo sapiens feces united states of america )2017-02-27v4No1 / 39
102amnonlower in saliva compared to teeth, cheek ( high in dentition cheek compared to saliva in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 39
131amnonnegatively correlated with age (30-80 years) ( high in fifth decade human stage fourth decade human stage age compared to human late adulthood stage in homo sapiens feces south korea )2017-04-16v4No1 / 39
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
427amnonhigher in salamanders kept at 20C compared to 10C ( high in temp 20c compared to temp 10c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 39
497amnoncommon chicken, gallus gallus, broiler chicken, austria, farm, feces, age 2 weeks2019-03-04v4No1 / 39
526amnoncommon in bile of healthy controls (common homo sapiens, gallbladder, bile, adult, kingdom of spain, control)2019-07-14v3No1 / 39
688amnon high in male organism male compared to female female organism in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 39
797amnon high in 3-month-old human stage compared to 1-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 39
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in chronic periodontitis periodontitis municipality of shanghai adult china subgingival plaque subgingival dental plaque homo sapiens 2021-09-11v3No1 / 39
872amnoncommon age 6-12 months, under-1-year-old human stage, infant, gambia, child, homo sapiens, feces2022-02-26v1No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, adult2017-04-10v4No1 / 40
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease trichuris muris late timepoints compared to control in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 40
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 40
778amnon high in decreased weight bottom weight group compared to increased weight top weight group in farm thailand intestine black tiger shrimp penaeus monodon 2021-04-28v3No1 / 40
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No1 / 40
835amnoncommon adult, japan, homo sapiens, feces2021-09-11v3No1 / 40
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 40
892amnon high in 1-year-old human stage infant compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v4No1 / 40
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 41
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
117amnoncommon zebra fish, danio rerio, research facility, larval stage, united states of america, intestine2017-04-10v4No1 / 41
352amnoncommon homo sapiens, feces, new delhi, india2018-07-30v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong 2nd generation hmong compared to united states of america in homo sapiens feces )2018-11-18v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in homo sapiens feces united states of america adult )2018-11-18v4No1 / 41
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 41
679amnon high in tonsil palatine tonsil compared to saliva in south korea age 5-10 years child fasting homo sapiens 2028-03-02v3No1 / 41
806amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 41
825amnoncommon type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 41
859amnon high in formula fed compared to breast fed in los angeles district state of california hispanic hispanic or latin american 6-month-old human stage infant feces homo sapiens 2022-01-12v4No1 / 41
872amnoncommon age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v1No1 / 41
881amnoncommon bologna, adult organism, italy, dog, canis lupus familiaris, feces2022-03-12v3No1 / 41
909amnon high in age 6 weeks compared to age 18 weeks in united kingdom manchester research facility mus musculus mouse feces 2022-05-20v3No1 / 41
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in dentition supragingival plaque supragingival dental plaque no dental caries united states of america homo sapiens 2022-07-25v4No1 / 41
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in saliva no dental caries united states of america homo sapiens 2022-07-25v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to caecum right colon transverse colon left colon feces in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 42
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in mus musculus mouse feces research facility c57bl/6 united states of america )2018-10-22v4No1 / 42
409amnonlower in colon biopsies compared to stool and luminal content ( high in feces luminal content compared to biopsy biopsy site in homo sapiens united states of america )2018-11-22v4No1 / 42
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v3No1 / 42
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 42
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant infant stage urban slum homo sapiens feces dhaka bangladesh 2022-04-03v4No1 / 42
922amnoncommon 4-year-old human stage, no dental caries, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v4No1 / 42
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
406amnoncommon feces, south africa, acinonyx jubatus, cheetah2018-11-21v4No1 / 43
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 43
666amnoncommon tiger, panthera tigris, italy, feces2020-09-25v3No1 / 43
696amnoncommon helicarionidae, kaliella, kaliella scandens, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 43
725amnon high in periodontitis acute pericementitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 43
831amnoncommon pancreatic cancer, homo sapiens, feces, adult, israel2021-09-11v3No1 / 43
876amnon high in age 1 week neonate compared to age 20 months juvenile organism in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v4No1 / 43
892amnoncommon 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v4No1 / 43
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 44
241amnoncommon in babies age < 3 years in russia (common homo sapiens, feces, infant, russia, age < 3 years)2017-11-13v4No1 / 44
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 44
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
406amnoncommon feces, zoological garden, united states of america, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
418amnon high in tissue compared to mucus in ocean coral diploastrea heliopora 2018-12-02v4No1 / 44
419amnon high in constipation compared to control in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 44
652amnon high in rheumatoid arthritis compared to control in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 44
663amnon high in obese body mass index status high bmi obesity compared to low bmi in adult switzerland poland feces homo sapiens 2020-09-22v4No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v3No1 / 44
725amnon high in periodontitis chronic periodontitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 44
757amnon high in male compared to female in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 44
797amnon high in age 7 months compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 44
797amnon high in age 7 months compared to 12-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 44
866amnon high in restraint stress stress compared to control in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 44
871amnonlower before antibiotic treatment compared to after treatment ( high in vancomycin antibiotic compared to before antibiotics in human adult stage amsterdam kingdom of the netherlands male adult homo sapiens feces )2022-02-19v3No1 / 44
50amnoncommon in mitten crab intestine (common intestine, eriocheir sinensis, china)2017-01-19v4No1 / 45
113amnoncommon danio rerio, zebra fish, research facility, united states of america, intestine, larval stage2017-04-10v4No1 / 45
149amnonhigher in larvae ever in a pond (original or transferred) compared to only stream ( high in pond compared to stream in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine )2017-04-24v4No1 / 45
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 45
396amnoncommon fish, cyprinus carpio, common carp, england, intestine, digestive system2018-11-14v4No1 / 45
869amnon high in iga positive fraction compared to iga negative fraction in human adult stage high bmi kingdom of the netherlands adult obesity homo sapiens feces 2022-02-18v3No1 / 45
879amnon high in dog canis lupus familiaris compared to wolf canis lupus in captive adult organism austria research facility feces 2022-03-12v4No1 / 45
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
246amnon high in control compared to body mass index high bmi obesity in homo sapiens saliva italy 2017-11-21v4No1 / 46
273amnoncommon 1-year-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
570amnoncommon homo sapiens, feces, india, bihar state2019-12-16v3No1 / 46
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
666amnoncommon canis lupus familiaris, dog, italy, feces2020-09-25v3No1 / 46
797amnoncommon 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v3No1 / 46
873amnon high in burunge sandawe maasai compared to hunter gatherer hadza in human adult stage rural community commonwealth of pennsylvania africa tanzania adult homo sapiens feces 2022-03-03v1No1 / 46
207amnonlower in people hospitalized with diarrhea compared to healthy controls ( high in control compared to diarrhea in feces homo sapiens israel )2017-10-05v4No1 / 47
211amnon high in male compared to female in feces united states of america research facility mus musculus mouse high fat diet diet 2017-10-22v4No1 / 47
258amnonhigher lungs of hiv pneumonia patients not treated with ceftriaxone ( high in no ceftriaxone compared to ceftriaxone in homo sapiens hiv infection uganda bronchoalveolar lavage bronchial epithelium lung pneumonia )2017-11-27v4No1 / 47
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
379amnonnegatively correlated with age 8-35 days in chickens ( high in young age compared to age old age in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 47
399amnon high in ulcerative colitis compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 47
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex flavicornis 2018-11-22v4No1 / 47
429amnonlower in salt sensitive rates fed salt rich diet compared to control diet ( high in control diet compared to salt salt rich diet in rat rattus norvegicus dahl salt-sensitive feces israel research facility )2018-12-13v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 47
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 47
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, parkinson's disease2020-02-17v4No1 / 47
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 47
640amnon high in dentition supragingival dental plaque supragingival plaque compared to saliva in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in low iron iron deficient diet compared to iron supplemented diet iron in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 47
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 47
830amnoncommon peru, teenager, age 9-17 years, feces, homo sapiens2021-09-10v4No1 / 47
546amnoncommon homo sapiens, saliva, morning, slovak republic, adult, age 21-28 years2019-08-07v3No1 / 48
558amnon high in gizzard compared to duodenum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 48
666amnoncommon short beaked common dolphin, delphinus delphis, rectal swab, feces, italy2020-09-25v3No1 / 48
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
869amnoncommon human adult stage, high bmi, obesity, adult, kingdom of the netherlands, feces, homo sapiens2022-02-18v3No1 / 48
892amnoncommon 2-year-old human stage, child, supragingival dental plaque, dental plaque, supragingival plaque, united states of america, homo sapiens2022-04-07v4No1 / 48
922amnoncommon 2-year-old human stage, child, no dental caries, supragingival dental plaque, supragingival plaque, dentition, united states of america, homo sapiens2022-07-25v4No1 / 48
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, skin, mucus2017-04-24v4No1 / 49
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 49
258amnoncommon in lungs of hiv patients with pneumonia (common homo sapiens, hiv infection, uganda, bronchoalveolar lavage, bronchial epithelium, lung, pneumonia)2017-11-27v4No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 49
645amnoncommon feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 49
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 49
710amnon high in control diet mouse chow compared to ketogenic diet in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 49
736amnoncommon 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 49
121amnoncommon homo sapiens, feces, bangladesh, adult2017-04-13v4No1 / 50
339amnon high in under-1-year-old human stage infant compared to adult in homo sapiens feces india 2018-05-24v4No1 / 50
406amnoncommon feces, equus przewalskii, przewalski horse, zoological garden, united states of america2018-11-21v4No1 / 50
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v3No1 / 50
576amnon high in tongue compared to mouth mucosa in homo sapiens czech republic adult 2020-01-09v3No1 / 50
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 50
797amnoncommon 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v3No1 / 50
834amnoncommon adult, japan, feces, homo sapiens2021-09-11v1No1 / 50
849amnoncommon zhejiang province, fourth decade human stage, adult, multiple sclerosis, multiple sclerosis, china, homo sapiens, feces2021-12-14v3No1 / 50
898amnoncommon wild, feces, coyote, canis latrans, adult organism, male, edmonton, canada2022-04-19v4No1 / 50
14amnon high in caecum right colon transverse colon left colon feces compared to stomach duodenum jejunum ileum in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 51
16amnon high in control compared to diarrhea in felis catus state of california feces 2016-11-08v4No1 / 51
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 51
413amnon high in high fat diet compared to mouse chow in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 51
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 age 8 weeks canada taconic farms 2019-07-29v4No1 / 51
589amnon high in mouse chow low fat diet compared to high fat diet + inulin in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 51
702amnoncommon felis catus, cat, state of north carolina, united states of america, feces2028-04-02v4No1 / 51
730amnoncommon crohn's disease, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 51
796amnoncommon control, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 51
865amnoncommon canis lupus, wolf, china, feces2022-02-08v3No1 / 51
911amnoncommon spinal cord injury, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 51
925amnoncommon vestibular dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 51
932amnon high in atlantic rainforest parque estadual serra do mar-núcleo picinguaba compared to savanna reserva biológica de mogi-guaçu in stomach gaster odontomachus chelifer sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 51
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in ampicillin antibiotic compared to control in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 52
354amnoncommon homo sapiens, united states of america, adult, saliva, oral wash2018-07-30v4No1 / 52
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong 2nd generation hmong in homo sapiens feces )2018-11-18v4No1 / 52
598amnonhigher in mouthwash of students compared to teachers ( high in 14-year-old human stage 13-year-old human stage child age 13-15 years compared to adult in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 52
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 52
651amnon high in control compared to parkinson's disease in state of alabama united states of america adult feces homo sapiens 2020-09-13v4No1 / 52
671amnon high in state of california compared to state of oregon in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 52
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
730amnon high in control compared to crohn's disease in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v1No1 / 52
796amnoncommon graves' disease, taoyuan city, republic of china, taiwan, adult, feces, homo sapiens2021-06-10v3No1 / 52
797amnon high in 12-month-old human stage infant compared to 2-year-old human stage child in formula fed germany homo sapiens feces 2021-06-13v3No1 / 52
830amnon high in iga igg negative fraction iga negative fraction compared to iga positive fraction in peru teenager age 9-17 years feces homo sapiens 2021-09-10v4No1 / 52
847amnoncommon ninth decade human stage, 80 year-old and over human stage, japan, feces2021-12-01v1No1 / 52
867amnoncommon gestational diabetes, gestational diabetes, second trimester, human adult stage, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 52
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 53
279amnon high in mouth compared to small intestine stomach in pika ochotonidae china 2018-01-24v4No1 / 53
279amnon high in small intestine stomach compared to caecum colon in pika ochotonidae china 2018-01-24v4No1 / 53
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, msw, heterosexual, hiv infection2020-01-14v3No1 / 53
661amnoncommon lung, farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus2020-09-20v4No1 / 53
864amnoncommon municipality of timilpan, ocotal state park, raw meat diet, feces, mexico, captive, mexican wolf, canis lupus baileyi2022-02-08v3No1 / 53
892amnon high in supragingival plaque supragingival dental plaque dental plaque compared to saliva in 4-year-old human stage child united states of america homo sapiens 2022-04-07v4No1 / 53
909amnon high in lumen of colon compared to feces in manchester united kingdom mouse mus musculus research facility 2022-05-20v3No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 54
437amnoncommon fish, zebra fish, danio rerio, juvenile organism, age 21 days, intestine, research facility, united states of america, state of oregon2018-12-26v4No1 / 54
847amnoncommon eleventh decade human stage, centenarian human stage, japan, feces2021-12-01v1No1 / 54
847amnoncommon human early adulthood stage, japan, feces2021-12-01v1No1 / 54
15amnoncommon acinonyx jubatus, namibia, feces2016-11-08v4No1 / 55
131amnon high in female compared to male in homo sapiens feces south korea 2017-04-16v4No1 / 55
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
390amnoncommon homo sapiens, feces, australia, hospital, salmonella gastroenteritis, diarrhea2018-11-04v4No1 / 55
578amnon high in sweden compared to kingdom of spain in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 55
653amnon high in saliva compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in metronidazole vancomycin neomycin antibiotic compared to control in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 55
707amnoncommon fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 55
745amnoncommon adult, midwest region, united states of america, feces, homo sapiens2021-02-25v3No1 / 55
766amnoncommon in feces of dog females within 24h after parturition (common french republic, age 2-7 years, adult organism, female organism, rectal swab, feces, canis lupus familiaris, dog)2021-04-12v4No1 / 55
774amnon high in control compared to tonsillitis in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 55
814amnoncommon high bmi, age 50-70 years, adult, obese body mass index status, overweight body mass index status, obesity, female, germany, homo sapiens, feces2021-06-30v4No1 / 55
926amnoncommon 2-5 year-old child stage, supragingival plaque, supragingival dental plaque, child, orenburg, russia, homo sapiens2022-07-28v3No1 / 55
45amnonhigher in younf babies compared to 2 year olds in india ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant india )2016-12-19v4No1 / 56
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
488amnonlower in feces of dogs with lymphoma compared to healthy controls ( high in control compared to lymphoma in canis lupus familiaris dog feces italy )2019-02-25v4No1 / 56
488amnoncommon canis lupus familiaris, dog, feces, italy, lymphoma2019-02-25v4No1 / 56
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 56
591amnoncommon human late adulthood stage, homo sapiens, feces, adult, united states of america, control2020-02-17v4No1 / 56
648amnon high in control compared to antibiotic metronidazole in united states of america dog canis lupus familiaris feces state of louisiana 2020-09-06v4No1 / 56
650amnoncommon state of new york, european, caucasian, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 56
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
775amnon high in lichen planus compared to control in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 56
812amnoncommon zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v3No1 / 56
817amnon high in oral cavity cheek pouch oral wash saliva compared to bronchoalveolar lavage lung in united states of america commonwealth of pennsylvania captive research facility macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 56
911amnon high in control compared to spinal cord injury in human adult stage nanjing city prefecture china homo sapiens feces 2022-05-21v4No1 / 56
922amnoncommon 4-year-old human stage, no dental caries, child, saliva, united states of america, homo sapiens2022-07-25v4No1 / 56
925amnoncommon lingual dental plaque, adolescent stage, supragingival dental plaque, supragingival plaque, kingdom of spain, homo sapiens2022-07-28v3No1 / 56
928amnoncommon human early adulthood stage, adult, kuwait, feces, homo sapiens2022-08-16v3No1 / 56
26amnon high in pair of nares mucus compared to saliva mouth in canis lupus familiaris united states of america 2016-12-05v4No1 / 57
532amnon high in short bowel syndrome compared to control in homo sapiens feces czech republic adult 2019-07-21v1No1 / 57
596amnoncommon 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 57
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 57
753amnon high in canis lupus wolf zoological garden captive compared to farm dog breeding center canis lupus familiaris dog in china adult feces 2021-03-12v4No1 / 57
759amnoncommon state of minnesota, domestic, dog, canis lupus familiaris, united states of america, feces2021-04-04v4No1 / 57
892amnoncommon 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 57
116amnoncommon research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 58
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 58
503amnondecreases following malaria infection ( high in control early time points compared to late time points experimental cerebral malaria malaria in mouse mus musculus research facility c57bl/6 feces japan )2019-03-12v4No1 / 58
563amnon high in control compared to hiv infection in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 58
644amnon high in male compared to female in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 58
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 58
666amnoncommon homo sapiens, italy, feces2020-09-25v3No1 / 58
759amnoncommon wildlife sactuary, state of minnesota, canis lupus, wolf, united states of america, feces2021-04-04v4No1 / 58
806amnon high in oral wash oral cavity compared to supragingival plaque supragingival dental plaque dentition in homo sapiens adult state of new york united states of america 2021-06-19v3No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in high bmi age 50-70 years adult obese body mass index status overweight body mass index status obesity female germany homo sapiens feces )2021-06-30v4No1 / 58
866amnon high in iga negative fraction compared to iga positive fraction in human adult stage adult homo sapiens united states of america feces 2022-02-08v4No1 / 58
877amnon high in high breath methane content compared to low breath methane content in human early adulthood stage austria adult homo sapiens feces 2022-03-08v4No1 / 58
922amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 59
596amnoncommon 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 59
843amnoncommon non-celiac gluten sensitivity, italy, feces, human adult stage, adult2021-11-17v3No1 / 59
892amnoncommon 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 59
922amnoncommon child, 2-year-old human stage, no dental caries, saliva, united states of america, homo sapiens2022-07-25v4No1 / 59
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
149amnoncommon salamandra salamandra, fire salamander, germany, larval stage, amphibian larval stage, intestine, stream2017-04-24v4No1 / 60
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, c57bl/6j, mouse chow2017-10-23v4No1 / 60
371amnonlower in saliva of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens saliva )2018-09-06v4No1 / 60
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
522amnonlower in western diet compared to control high sugar diet ( high in high sugar diet compared to western diet very high sugar diet high fat diet in mouse mus musculus feces germany research facility female c57bl/6j janvier labs age 18 weeks )2019-07-03v3No1 / 60
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 60
734amnoncommon vegetarian diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 60
831amnoncommon control, homo sapiens, feces, adult, israel2021-09-11v3No1 / 60
844amnoncommon iron deficient diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 60
925amnoncommon supragingival dental plaque, supragingival plaque, interproximal dental plaque, kingdom of spain, adolescent stage, homo sapiens2022-07-28v3No1 / 60
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in american diet diet compared to cron diet caloric restriction diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
586amnon high in control diet compared to fructose diet fructose in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v4No1 / 61
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 61
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
790amnoncommon omsk, russia, intestinal contents, intestine, farm, peking duck, anas platyrhynchos2021-06-07v3No1 / 61
849amnoncommon control, fourth decade human stage, china, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 61
51amnon high in control compared to hiv infection in homo sapiens feces united states of america 2017-01-19v4No1 / 62
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, high fat diet, c57bl/6j2017-10-23v4No1 / 62
593amnoncommon homo sapiens, feces, adult, south korea, rheumatoid arthritis2020-03-08v3No1 / 62
851amnoncommon feces, milan, italy, adult, homo sapiens2021-12-16v3No1 / 62
919amnoncommon 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 62
102amnonhigher in teeth compared to cheeks, saliva ( high in dentition compared to saliva cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 63
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in mus musculus mouse feces united states of america )2017-04-14v4No1 / 63
163amnon high in ochotona dauurica mongolia grassland compared to ochotona curzoniae tibet platue in ochotonidae pika stomach china 2017-07-13v4No1 / 63
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
354amnoncommon homo sapiens, united states of america, adult, sputum, induced sputum2018-07-30v4No1 / 63
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 63
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
575amnoncommon in professional martial arts athletes (common young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v3No1 / 63
630amnon high in female compared to male in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
630amnon high in male compared to female in madrid kingdom of spain feces adult homo sapiens 2020-05-31v3No1 / 63
726amnoncommon tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 63
872amnon high in infant age 6-12 months under-1-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 63
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 64
671amnon high in age 1 month compared to 3-month-old human stage in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 64
695amnon high in sesame allergy compared to milk allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 64
865amnoncommon inner mongolia autonomous region, china, feces, dog, canis lupus familiaris2022-02-08v3No1 / 64
930amnoncommon non-smoker, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 64
17amnon high in high altitude compared to low altitude in ochotona feces stomach tibetan plateau 2016-11-09v4No1 / 65
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to dentition cheek in homo sapiens atlanta united states of america mouth )2017-04-03v4No1 / 65
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
640amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 65
875amnoncommon saen thong subdistrict, village, rural community, thailand, adult, human late adulthood stage, feces, homo sapiens2022-03-04v3No1 / 65
895amnoncommon 6-12 year-old child stage, cystic fibrosis, bordeaux, french republic, child, feces, homo sapiens2022-04-16v4No1 / 65
919amnoncommon 2-year-old human stage, 21-month-old human stage, 20-month-old human stage, 19-month-old human stage, 18-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
572amnon high in pancreatic cancer compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 66
650amnoncommon asian, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 66
671amnon high in state of california compared to state of oregon in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 66
734amnoncommon coronary heart disease, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 66
852amnoncommon non-smoker, canada, adult, saliva, homo sapiens2021-12-17v4No1 / 66
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
114amnon high in adult compared to tadpole in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 67
194amnon high in colon ileum compared to feces in homo sapiens kingdom of norway 2017-09-07v4No1 / 67
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
576amnoncommon homo sapiens, czech republic, adult, tongue2020-01-09v3No1 / 67
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
805amnon high in non-smoker compared to cigarette smoking nicotine dependence smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v3No1 / 67
874amnoncommon buffalo, state of new york, united states of america, postmenopausal, human late adulthood stage, female, subgingival plaque, subgingival dental plaque, homo sapiens2022-03-04v3No1 / 67
879amnon high in canis lupus wolf compared to dog canis lupus familiaris in adult organism captive austria research facility feces 2022-03-12v4No1 / 67
8amnon high in stomach compared to colon in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 68
211amnonCommon in multiple mouse strains feces (common mus musculus, mouse, research facility, united states of america, feces, high fat diet)2017-10-22v4No1 / 68
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 68
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
417amnoncommon anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 68
574amnoncommon feces, homo sapiens, russia, adult2020-01-05v3No1 / 68
593amnoncommon homo sapiens, feces, adult, south korea, osteoarthritis2020-03-08v3No1 / 68
734amnoncommon omnivore diet, republic of china, taiwan, adult, feces, homo sapiens2021-01-22v3No1 / 68
872amnoncommon 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v1No1 / 68
902amnoncommon antibiotics induced colitis, antibiotic, colitis, colitis, adult organism, horse, equus caballus, united states of america, feces2022-05-02v4No1 / 68
72amnoncommon canis lupus familiaris, feces, united states of america, iowa2017-02-25v4No1 / 69
231amnoncommon in dog urine (common dog, canis lupus familiaris, united states of america, urine)2017-11-02v4No1 / 69
379amnonhigher in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in campylobacter compared to control in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 69
558amnon high in crop compared to gizzard in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 69
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 69
723amnoncommon feces, municipality of yogyakarta, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 69
797amnon high in formula fed compared to breast fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 69
846amnoncommon commonwealth of massachusetts, united states of america, human adult stage, adult, stimulated saliva, saliva, homo sapiens2021-11-20v3No1 / 69
22amnon high in control compared to hiv infection in united states of america feces homo sapiens 2016-11-28v4No1 / 70
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in c57bc/6ncrl feces united states of america mus musculus male research facility no immunization: vehicle as control )2017-01-13v4No1 / 70
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in homo sapiens feces thailand adult )2018-11-18v4No1 / 70
405amnon high in control diet compared to ketogenic diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 70
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
419amnon high in control compared to constipation in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 70
552amnoncommon feces, homo sapiens, czech republic2019-09-05v3No1 / 70
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 70
594amnon high in yaounde city compared to rural community ngoantet in adult cameroon feces homo sapiens 2020-03-12v4No1 / 70
742amnoncommon dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v3No1 / 70
803amnoncommon human late adulthood stage, type 2 diabetes mellitus, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 70
896amnon high in starch diet compared to glucose diet in age 2 months jackson laboratories mouse state of utah c57bl/6j mus musculus research facility female united states of america feces 2022-04-17v4No1 / 70
28amnoncommon hawaii, feces, terrestrial biome, achatinella mustelina, environmental system determined by an organism2016-12-05v4No1 / 71
39amnonhiger in obese mice eating whole grain diet compared to normal chow ( high in whole grain diet diet compared to normal diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 71
394amnon high in control compared to ulcerative colitis in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 71
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
644amnoncommon adult, united states of america, hispanic or latin american, feces, homo sapiens2020-08-31v4No1 / 71
645amnon high in cloaca compared to feces in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v4No1 / 71
656amnoncommon child stage, adolescent stage, age 1-18 years, sri lanka, feces, homo sapiens2020-09-13v3No1 / 71
663amnoncommon obese body mass index status, obesity, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 71
870amnoncommon auckland city, fourth decade human stage, third decade human stage, adult, new zealand, homo sapiens, feces2022-02-18v3No1 / 71
914amnon high in control compared to diarrhea in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v3No1 / 71
114amnoncommon rana pipiens, northern leopard frog, adult, research facility, digesta, intestine, state of wisconsin, united states of america2017-04-10v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
653amnon high in tongue dermal layer of tongue compared to saliva in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 72
663amnon high in poland compared to switzerland in adult feces homo sapiens 2020-09-22v4No1 / 72
716amnoncommon control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v3No1 / 72
817amnoncommon united states of america, cheek pouch, oral cavity, saliva, oral wash, commonwealth of pennsylvania, captive, research facility, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
844amnon high in iron supplemented diet compared to iron deficient diet in mouse australia c57bl/6 mus musculus research facility feces 2021-11-17v3No1 / 72
859amnon high in 6-month-old human stage compared to 1-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v4No1 / 72
879amnoncommon canis lupus familiaris, dog, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 72
26amnoncommon united states of america, homo sapiens, pair of nares, mucus2016-12-05v4No1 / 73
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in mus musculus mouse feces research facility c57bl/6 female united states of america state of oregon )2018-12-23v4No1 / 73
477amnonlower in agrarian tharu population compared to foraging chepang population ( high in chepang forager compared to tharu agrarian in homo sapiens feces adult himalayas nepal rural community )2019-01-28v4No1 / 73
861amnoncommon urban community, city, soweto, rural community, south africa, female, homo sapiens, feces2022-01-15v3No1 / 73
873amnon high in tanzania botswana rural community compared to urban community commonwealth of pennsylvania united states of america in human adult stage adult homo sapiens feces 2022-03-03v1No1 / 73
879amnoncommon canis lupus, wolf, adult organism, captive, austria, research facility, feces2022-03-12v4No1 / 73
22amnon high in hiv infection compared to control in united states of america feces homo sapiens 2016-11-28v4No1 / 74
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, notophthalmus viridescens, newt2017-04-02v4No1 / 74
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, tharu, agrarian2019-01-28v4No1 / 74
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, hiv infection2020-01-14v3No1 / 74
589amnon high in mouse chow low fat diet compared to high fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 74
634amnoncommon high physical activity, endurance athlete, germany, adult, homo sapiens, saliva2020-06-16v3No1 / 74
696amnoncommon alycaeus jagori, state of sabah, malaysia, gastrointestinal system, stomach, land snail2028-03-27v3No1 / 74
759amnon high in raw meat diet compared to dog food diet in dog canis lupus familiaris state of minnesota united states of america feces 2021-04-06v4No1 / 74
774amnoncommon tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 74
832amnoncommon nigeria, ibadan, adult, feces, homo sapiens2021-09-11v4No1 / 74
299amnon high in control compared to mouth neoplasm cancer in saliva adult homo sapiens china 2018-02-27v4No1 / 75
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
589amnon high in high fat diet compared to mouse chow low fat diet in mouse mus musculus c57bl/6 research facility feces jackson laboratories united states of america state of georgia 2020-02-10v4No1 / 75
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 75
794amnoncommon antiretroviral therapy, human immunodeficiency virus infectious disease, hiv infection, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 75
797amnon high in formula fed compared to breast fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v3No1 / 75
74amnoncommon united states of america, feces, homo sapiens2017-02-27v4No1 / 76
438amnonhigher in kindergarten compared to primary and middle school kids ( high in 2-5 year-old child stage age 3-6 compared to 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raute2019-01-29v4No1 / 76
484amnoncommon feces, united states of america, adult, state of michigan, 17-29-years-old human, homo sapiens2019-02-13v4No1 / 76
663amnon high in switzerland compared to poland in adult feces homo sapiens 2020-09-22v4No1 / 76
666amnoncommon pygmy hippopotamus, hexaprotodon liberiensis, italy, feces2020-09-25v3No1 / 76
666amnoncommon common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v3No1 / 76
866amnon high in iga negative fraction compared to iga positive fraction in mouse state of illinois c57bl/6 mus musculus research facility united states of america feces 2022-02-08v4No1 / 76
54amnoncommon homo sapiens, saliva, united states of america2017-01-23v4No1 / 77
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, nasal cavity, mucus2017-02-21v4No1 / 77
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 77
279amnoncommon pika, ochotonidae, stomach, small intestine, china2018-01-24v4No1 / 77
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
556amnoncommon homo sapiens, feces, united states of america, adult2019-09-14v1No1 / 77
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v3No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 77
799amnonlower before ketogenic diet compared to after ketogenic diet in obese participants ( high in ketogenic diet compared to control diet in obesity high bmi adult estonia feces homo sapiens )2021-06-13v3No1 / 77
799amnoncommon in obese participant fecal samples before ketogenic diet (common obesity, high bmi, adult, estonia, feces, homo sapiens)2021-06-13v3No1 / 77
930amnoncommon cigarette smoking, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 77
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 78
596amnon high in under-1-year-old human stage compared to 2-5 year-old child stage age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 78
630amnoncommon madrid, kingdom of spain, feces, adult, homo sapiens2020-06-01v3No1 / 78
759amnon high in wildlife sactuary canis lupus wolf compared to dog canis lupus familiaris in state of minnesota united states of america feces 2021-04-06v4No1 / 78
898amnon high in descending colon ascending colon feces compared to jejunum duodenum in coyote canis latrans edmonton adult organism wild canada male 2022-04-19v4No1 / 78
399amnoncommon feces, united states of america, zoological garden, panthera leo, lion, state of tennessee2018-11-16v4No1 / 79
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
407amnon high in wet season compared to dry season in costa rica feces monkey cebus capucinus white-faced capuchin wild 2018-11-21v4No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
529amnoncommon homo sapiens, feces, taiwan, taipei city, adult, control2019-07-18v3No1 / 79
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in teeth braces braces compared to control in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 79
671amnon high in 3-month-old human stage age 6 months compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 79
732amnoncommon municipality of reus, kingdom of spain, adult, feces, homo sapiens2021-01-11v3No1 / 79
736amnon high in adult female compared to 2-year-old human stage 1-year-old human stage age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
777amnoncommon 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 79
777amnon high in 3-month-old human stage infant compared to 18-month-old human stage child in municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 79
822amnon high in high fiber compared to hydrolized diet in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v4No1 / 79
880amnoncommon kingdom of denmark, human adult stage, adult, feces, homo sapiens2022-03-12v3No1 / 79
26amnoncommon united states of america, felis catus, mucus, pair of nares2016-12-05v4No1 / 80
163amnoncommon ochotonidae, pika, ochotona dauurica, mongolia grassland, stomach, china2017-07-13v4No1 / 80
406amnonlower in captive white rhinoceros compared to wild ( high in wild south africa compared to captive french republic in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v4No1 / 80
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 80
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
339amnoncommon homo sapiens, feces, adult, india2018-05-24v4No1 / 81
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
522amnon high in high sugar diet age 18 weeks compared to age 6 weeks mouse chow in mouse mus musculus feces germany research facility female c57bl/6j janvier labs 2019-07-03v3No1 / 81
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 81
671amnoncommon age 1 month, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 81
678amnon high in control compared to tooth disease black dental staining in supragingival plaque supragingival dental plaque kingdom of spain homo sapiens adult 2028-03-02v3No1 / 81
777amnon high in 3-year-old human stage compared to 5-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 81
873amnoncommon botswana, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v1No1 / 81
911amnoncommon control, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
358amnonhigher in helminth infected rats compared to controls ( high in hymenolepis diminuta compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
650amnon high in male compared to female in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 82
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 82
707amnoncommon fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
716amnoncommon chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 82
826amnon high in supragingival plaque supragingival dental plaque compared to subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v4No1 / 82
39amnonlower in whole wheat diet compared to normal chow ( high in normal diet control compared to diet whole wheat diet in mus musculus research facility feces obesity )2016-12-09v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 83
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 83
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 83
648amnoncommon united states of america, dog, canis lupus familiaris, feces, state of louisiana2020-09-06v4No1 / 83
721amnon high in high protein diet weight loss weight loss diet compared to high fiber fiber diet in obesity overweight body mass index status adult scotland gaz:00052100 feces homo sapiens 2028-05-23v4No1 / 83
777amnoncommon 5-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 83
777amnon high in 18-month-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 83
816amnon high in early pregnancy compared to late pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 83
114amnoncommon rana pipiens, northern leopard frog, research facility, digesta, intestine, state of wisconsin, united states of america, tadpole2017-04-10v4No1 / 84
231amnoncommon in dog rectum (common dog, canis lupus familiaris, united states of america, rectum, feces)2017-11-02v4No1 / 84
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
406amnonhigher in captive bovidae compared to wild ( high in zoological garden compared to wild in feces bovidae )2018-11-21v4No1 / 84
663amnoncommon lung, bronchoalveolar lavage, poland, adult, homo sapiens2020-09-22v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 85
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
405amnon high in ketogenic diet compared to control diet in mouse mus musculus research facility feces united states of america swiss webster 2018-11-20v4No1 / 85
550amnoncommon city, hokkaido, starfish, coelomic fluid, wild, patiria pectinifera, japan2019-08-18v4No1 / 85
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v3No1 / 85
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
629amnon high in heterosexual msw compared to homosexual msm in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 85
663amnoncommon low bmi, switzerland, adult, feces, homo sapiens2020-09-22v4No1 / 85
668amnoncommon new zealand, research facility, feces, felis catus, cat2020-09-26v3No1 / 85
680amnoncommon obesity, adult, novosibirsk, russia, feces, homo sapiens2028-03-04v3No1 / 85
802amnoncommon cornell university, state of new york, united states of america, adult, saliva, homo sapiens2021-06-16v4No1 / 85
804amnon high in iga negative fraction compared to iga positive fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 85
844amnoncommon iron supplemented diet, mouse, australia, c57bl/6, mus musculus, research facility, feces2021-11-17v3No1 / 85
867amnoncommon gestational diabetes, gestational diabetes, human adult stage, third trimester, turin township, italy, adult, pregnancy, female, homo sapiens, feces2022-02-09v3No1 / 85
26amnon high in pair of nares mucus compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
766amnon high in age 2 days compared to age 8 weeks in puppy french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 86
841amnoncommon feces, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 86
319amnoncommon homo sapiens, united states of america, state of texas, saliva2018-04-18v4No1 / 87
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
340amnoncommon feces, felis catus, cat, city of melbourne, australia2018-05-27v4No1 / 87
344amnoncommon in feces of homosexual males (common homo sapiens, feces, united states of america, state of colorado, denver, homosexual, gay, msm)2018-05-31v4No1 / 87
430amnoncommon 20-year-old human stage, homo sapiens, adult, united states of america, state of arizona, city, feces2018-12-15v4No1 / 87
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to 2-5 year-old child stage child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
892amnoncommon saliva, united states of america, human adult stage, adult, homo sapiens2022-04-07v4No1 / 87
919amnon high in 2-year-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
477amnoncommon homo sapiens, feces, himalayas, nepal, rural community, raji2019-01-29v4No1 / 88
487amnoncommon homo sapiens, feces, united states of america, metabolic syndrome, metabolic syndrome x2019-02-24v4No1 / 88
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 88
805amnoncommon sputum, city of london, united kingdom, adult, homo sapiens2021-06-18v3No1 / 88
822amnon high in hydrolized diet compared to high fiber in dog canis lupus familiaris feces australia city of melbourne foxhound research facility 2021-08-29v4No1 / 88
830amnon high in iga positive fraction compared to iga igg negative fraction iga negative fraction in homo sapiens feces age 9-17 years teenager peru 2021-09-10v4No1 / 88
884amnoncommon state of california, united states of america, human adult stage, adult, feces, homo sapiens2022-03-24v4No1 / 88
914amnon high in diarrhea compared to control in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v3No1 / 88
922amnoncommon human adult stage, united states of america, saliva, adult, homo sapiens2022-07-25v4No1 / 88
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, high fat diet2017-10-23v4No1 / 89
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
399amnoncommon feces, united states of america, research facility, mouse, mus musculus2018-11-18v4No1 / 89
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
703amnoncommon dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 89
803amnoncommon human late adulthood stage, control, commonwealth of massachusetts, caribbean latino, adult, united states of america, feces, homo sapiens2021-06-18v4No1 / 89
114amnon high in tadpole compared to adult in rana pipiens northern leopard frog research facility digesta intestine state of wisconsin united states of america 2017-04-10v4No1 / 90
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
899amnoncommon in snail intestine from heavy metal contaminated greenhouse (common greenhouse, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 90
137amnon high in juvenile stage compared to adult in gopherus polyphemus gopher tortoise feces united states of america state of florida 2017-04-17v4No1 / 91
503amnon high in balb/c compared to c57bl/6 in mouse mus musculus research facility feces japan 2019-03-12v4No1 / 91
666amnoncommon wild cat, felis silvestris, italy, feces2020-09-25v3No1 / 91
26amnon high in pair of nares mucus compared to inguinal region axilla sebum in united states of america homo sapiens 2016-12-05v4No1 / 92
578amnoncommon homo sapiens, feces, adult, male, kingdom of spain, sweden, control, msw, heterosexual2020-01-14v3No1 / 92
668amnon high in age 5 years compared to age 4 months in new zealand research facility feces felis catus cat 2020-09-26v3No1 / 92
774amnoncommon control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 92
777amnoncommon 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 92
866amnon high in control compared to crohn's disease crohn's disease in human adult stage adult united states of america homo sapiens feces 2022-02-08v4No1 / 92
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 93
799amnoncommon in obese participant fecal samples after 1 month ketogenic diet (common ketogenic diet, high bmi, estonia, adult, obesity, homo sapiens, feces)2021-06-13v3No1 / 93
836amnoncommon oral lichen planus, gingival erosive oral lichen planus, chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 93
918amnoncommon non-pregnant, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 93
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility female )2017-01-12v4No1 / 94
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to digestive tract intestine mucosa in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 94
348amnoncommon homo sapiens, saliva, italy, adult2018-07-16v4No1 / 94
354amnon high in bronchus bronchial brush bronchial epithelium compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msm, gay, homosexual2018-11-06v4No1 / 94
488amnoncommon canis lupus familiaris, dog, feces, italy, control2019-02-25v4No1 / 94
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 94
759amnoncommon state of new york, new york city, wild, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 94
17amnon high in low altitude compared to high altitude in ochotona feces stomach tibetan plateau 2016-11-09v4No1 / 95
214amnoncommon mouse, mus musculus, feces, united states of america, research facility, strain 129s, mouse chow2017-10-23v4No1 / 95
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in united states of america eastern red backed salamander plethodon cinereus salamander feces commonwealth of virginia )2018-12-08v4No1 / 95
723amnonhigher in children age 2-4 years compared to mothers ( high in 2-5 year-old child stage child compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
736amnoncommon tanzania, pemba island, adult, female, feces, homo sapiens2021-01-25v3No1 / 95
826amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 96
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
678amnoncommon tooth disease, black dental staining, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 96
759amnon high in wild new york city state of new york compared to research facility city of boston commonwealth of massachusetts in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in capra hircus goat china research facility ruminal fluid rumen shanxi province dairy goat )2021-05-23v3No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
457amnonhigher in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet + polydextrose polydextrose compared to high fat diet in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 97
477amnoncommon homo sapiens, feces, adult, nepal, himalayas, rural community, forager, chepang2019-01-28v4No1 / 97
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 97
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
730amnoncommon control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 97
839amnoncommon morning, south africa, kalahari desert, feces, meerkat, suricata suricatta2021-11-08v4No1 / 97
922amnon high in child 4-year-old human stage compared to human adult stage adult in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 97
532amnoncommon homo sapiens, feces, czech republic, adult, control2019-07-21v1No1 / 98
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 98
663amnoncommon poland, low bmi, adult, feces, homo sapiens2020-09-22v4No1 / 98
753amnoncommon zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v4No1 / 98
26amnoncommon canis lupus familiaris, united states of america, saliva, mouth2016-12-05v4No1 / 99
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
441amnoncommon mus musculus, mouse, c57bl/6j, feces, research facility, united states of america, jackson laboratories2019-01-06v4No1 / 99
458amnonpositively correlated with age ( high in age 24 weeks age compared to age 3 weeks in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 99
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 100
455amnoncommon homo sapiens, adult, canada, saliva, atherosclerosis2019-01-10v4No1 / 100
563amnon high in hiv infection compared to control in homo sapiens feces rectal swab united states of america male msm homosexual 2019-11-18v4No1 / 100
702amnon high in felis catus cat compared to canis lupus familiaris dog in state of north carolina united states of america feces 2028-04-02v4No1 / 100
804amnon high in iga positive fraction compared to iga negative fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 100
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, high fat diet2018-11-26v4No1 / 101
438amnoncommon young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 101
766amnon high in age 2-7 years female organism adult organism compared to age 8 weeks puppy in french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 101
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 101
66amnoncommon homo sapiens, saliva, adult, amsterdam2017-02-18v4No1 / 102
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
704amnon high in dental caries compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 102
826amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 102
877amnoncommon human early adulthood stage, austria, adult, homo sapiens, feces2022-03-08v4No1 / 102
922amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v4No1 / 102
149amnon high in pond compared to stream in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 103
477amnoncommon homo sapiens, feces, adult, united states of america2019-01-28v4No1 / 103
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, control2019-11-18v4No1 / 103
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
822amnon high in meat diet high protein diet compared to hydrolized diet in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v4No1 / 103
493amnoncommon homo sapiens, adult, saliva, united states of america, state of new york2019-02-27v4No1 / 104
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 104
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus similis2019-04-18v4No1 / 104
693amnoncommon graz city district, austria, adult, feces, homo sapiens, female2028-03-16v1No1 / 104
777amnon high in 2-days-old human compared to 3-month-old human stage in infant municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 104
918amnoncommon third trimester, pregnancy, human early adulthood stage, japan, adult, saliva, female, homo sapiens2022-07-15v3No1 / 104
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
704amnoncommon 10-15-years-old human, istanbul, turkey, child, saliva, homo sapiens2028-04-02v3No1 / 105
888amnoncommon cow milk based food product, skimmed milk powder, milk powder, ireland, milk2022-03-30v3No1 / 105
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay msm homosexual in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 106
438amnoncommon 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
712amnoncommon kazan, adult, russia, saliva, homo sapiens2028-05-21v3No1 / 106
797amnon high in 12-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 106
806amnoncommon saliva, homo sapiens, adult, state of new york, united states of america2021-06-19v3No1 / 106
149amnon high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage intestine 2017-04-24v4No1 / 107
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
273amnon high in 1-month-old human stage age compared to 1-month-old human stage age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 107
704amnoncommon istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v3No1 / 107
710amnon high in ketogenic diet compared to control diet mouse chow in state of california united states of america swiss webster research facility feces mus musculus mouse 2028-05-20v4No1 / 107
892amnon high in saliva compared to supragingival plaque supragingival dental plaque dental plaque in 4-year-old human stage child united states of america homo sapiens 2022-04-07v4No1 / 107
42amnonlower on stressed mice compared to control in c57bl tcr-b deficient mice ( high in control compared to stress in c57bl/6 mus musculus research facility feces japan )2016-12-10v4No1 / 108
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
436amnoncommon felis catus, cat, feces, united states of america, state of colorado2018-12-25v4No1 / 108
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, feces, jackson laboratories2019-07-30v4No1 / 108
802amnoncommon feces, cornell university, state of new york, united states of america, adult, homo sapiens2021-06-16v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 109
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
387amnon high in summer compared to winter in ursus arctos brown bear feces sweden wild 2018-11-03v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
538amnon high in jackson laboratories compared to taconic farms in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 110
822amnon high in hydrolized diet compared to high protein diet meat diet in dog canis lupus familiaris feces australia city of melbourne foxhound research facility 2021-08-29v4No1 / 110
899amnoncommon in snail intestine from phytoremedation field (common phytoremedation field, field, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
438amnoncommon 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 111
477amnon high in nepal rural community himalayas compared to united states of america in homo sapiens feces adult 2019-01-28v4No1 / 111
563amnoncommon homo sapiens, feces, rectal swab, united states of america, male, msm, homosexual, hiv infection2019-11-18v4No1 / 111
770amnon high in age < 1 year infant compared to age 10-15 years adult organism in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 111
466amnonlower in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in unshaded sunlight compared to shaded in feces bos taurus cow farm united states of america state of georgia late timepoints 30-60 days )2019-01-14v4No1 / 112
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
663amnoncommon poland, obese body mass index status, obesity, adult, feces, homo sapiens2020-09-22v4No1 / 112
794amnon high in control compared to antiretroviral therapy human immunodeficiency virus infectious disease hiv infection in municipality of logrono kingdom of spain adult homo sapiens feces 2021-06-08v4No1 / 112
863amnon high in winter compared to spring in xinglong mountain national nature reserve alpine musk deer moschus chrysogaster yuzhong county china deer captive farm feces 2022-01-28v4No1 / 112
873amnoncommon urban community, commonwealth of pennsylvania, united states of america, human adult stage, adult, homo sapiens, feces2022-03-03v1No1 / 112
71amnoncommon liolaemus ruibali, feces, argentina, research facility2017-02-25v4No1 / 113
214amnon high in c57bl/6j compared to strain s129 in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 113
217amnoncommon mus musculus, mouse, research facility, feces, female, c57bl/62017-10-24v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 113
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
594amnoncommon adult, cameroon, homo sapiens, saliva2020-03-12v4No1 / 113
861amnoncommon peri-urban community, rural community, bushbuckridge local municipality, human middle aged stage, south africa, female, homo sapiens, feces2022-01-15v3No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
417amnon high in mongolia summer compared to winter china in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 114
438amnoncommon fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 115
529amnonhigher in CRC patients that underwent low anterior resection ( high in low anterior resection compared to control in homo sapiens feces taiwan taipei city adult )2019-07-18v3No1 / 115
703amnoncommon saliva, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 115
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 116
592amnoncommon wild, feces, eastern chimpanzee, pan troglodytes schweinfurthii, democratic republic of the congo2020-02-18v1No1 / 116
149amnonhigher in larvae transferred to stream compared to pond ( high in stream compared to pond in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v4No1 / 117
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 117
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 117
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in fish ictalurus punctatus channel catfish intestine compared to pond water fresh water in united states of america state of alabama research facility )2019-02-12v4No1 / 118
658amnon high in asian burmese compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 118
822amnon high in high fiber compared to high protein diet meat diet in dog canis lupus familiaris feces australia city of melbourne foxhound research facility 2021-08-29v4No1 / 118
538amnon high in ileum terminal ileum compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 119
568amnon high in viet nam compared to thailand in gallus gallus chicken feces broiler chicken 2019-12-08v3No1 / 119
743amnoncommon feces, farm, captive, italy, adult, european hare, lepus europaeus2021-02-21v3No1 / 119
113amnon high in adult compared to larval stage in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 120
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, lean body mass, control2017-10-22v4No1 / 120
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
358amnonlower in helminth infected rats compared to controls ( high in control compared to hymenolepis diminuta in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 120
383amnoncommon mus musculus, mouse, feces, research facility, c57bl/6, united states of america, mouse chow, f1515 diet2018-10-22v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
753amnoncommon china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v4No1 / 120
777amnon high in 5-year-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 120
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in mus musculus mouse caecum feces c57bl/6j united states of america )2017-04-14v4No1 / 121
294amnon high in control compared to irritable bowel syndrome in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in homo sapiens feces united states of america adult state of colorado city 2018-11-06v4No1 / 121
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
515amnoncommon whole body, beetle, aphodius depressus, detritivorous beetle, feces, bulgaria, balkan mountains2019-04-18v4No1 / 121
537amnoncommon in feces of captive grown deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, research facility, captive)2019-07-28v3No1 / 121
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces adult united states of america state of texas research facility horse equus caballus )2020-06-10v4No1 / 121
581amnoncommon in red swamp crayfish grown in flooded rice field (common procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v3No1 / 122
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
741amnon high in alfalfa diet compared to pellet feed diet in intestine ram's horn snail china research facility planorbella trivolvis 2021-02-17v3No1 / 123
822amnon high in meat diet high protein diet compared to high fiber in research facility foxhound city of melbourne australia feces canis lupus familiaris dog 2021-08-29v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in homosexual msm gay compared to heterosexual msw in homo sapiens feces united states of america state of colorado denver )2018-05-31v4No1 / 124
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
598amnoncommon 14-year-old human stage, 13-year-old human stage, child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
69amnoncommon canis lupus familiaris, beagle dog, united states of america, research facility, feces2017-02-21v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
427amnoncommon united states of america, eastern red backed salamander, plethodon cinereus, salamander, feces, commonwealth of virginia2018-12-08v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
873amnoncommon tanzania, human adult stage, rural community, africa, adult, homo sapiens, feces2022-03-03v1No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in canis lupus familiaris dog feces united states of america )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 18 weeks, high sugar diet2019-07-03v3No1 / 126
273amnon high in 1-month-old human stage age age 1 week compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 127
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 127
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius sphacelatus2019-04-18v4No1 / 127
753amnon high in farm dog breeding center canis lupus familiaris dog compared to captive zoological garden canis lupus wolf in china adult feces 2021-03-12v4No1 / 127
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
113amnon high in larval stage compared to adult in danio rerio zebra fish research facility united states of america intestine 2017-04-10v4No1 / 128
131amnoncommon homo sapiens, feces, south korea2017-04-16v4No1 / 128
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
173amnoncommon homo sapiens, saliva, austria, graz city district2017-07-26v4No1 / 129
458amnoncommon in mice strains from jackson laboratories (common mus musculus, mouse, research facility, feces, female, united states of america, jackson laboratories)2019-01-11v4No1 / 129
841amnoncommon saliva, human adult stage, state of texas, adult, united states of america, homo sapiens2021-11-08v4No1 / 129
330amnoncommon fourth decade human stage, homo sapiens, feces, kingdom of norway, oslo, adult2018-05-13v4No1 / 130
522amnoncommon mouse, mus musculus, feces, germany, research facility, female, c57bl/6j, janvier labs, age 6 weeks, mouse chow2019-07-03v3No1 / 130
586amnon high in fructose diet fructose compared to control diet in rattus norvegicus rat sprague dawley research facility male israel feces 2020-02-09v4No1 / 130
592amnoncommon wild, feces, chimpanzee, pan troglodytes, africa2020-02-18v1No1 / 130
125amnoncorrelated with diet induced metabolic disease in germ free transplantation ( high in c57bl/6j diet induced metabolic disease compared to cast/eij in mus musculus mouse feces united states of america )2017-04-14v4No1 / 131
526amnon high in cholelithiasis compared to control in homo sapiens gallbladder bile adult kingdom of spain 2019-07-14v3No1 / 131
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
8amnon high in colon compared to stomach in mus musculus mouse strain o129 kingdom of norway 2016-10-21v4No1 / 132
39amnoncommon in obese lepr-db mice (common mus musculus, research facility, feces, obesity)2016-12-09v4No1 / 132
149amnonhigher in larvae transferred to pond compared to stream ( high in pond compared to stream in salamandra salamandra fire salamander germany larval stage amphibian larval stage skin mucus )2017-04-24v4No1 / 132
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 132
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
417amnon high in winter china compared to mongolia summer in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 132
578amnoncommon homo sapiens, feces, adult, male, msm, gay, homosexual, kingdom of spain, sweden, control2020-01-14v3No1 / 132
625amnoncommon emperor tamarin, saguinus imperator, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 132
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 132
851amnon high in feces compared to colonic mucosa sigmoid colon brushing sigmoid colon in adult milan italy homo sapiens 2021-12-16v3No1 / 132
246amnoncommon homo sapiens, saliva, italy2017-11-21v4No1 / 133
278amnoncommon homo sapiens, united states of america, state of california, adult, saliva2018-01-23v4No1 / 133
578amnon high in kingdom of spain compared to sweden in homo sapiens feces hiv infection adult male msm gay homosexual 2020-01-14v3No1 / 133
766amnon high in age 8 weeks compared to age 2 days in puppy french republic rectal swab feces canis lupus familiaris dog 2021-04-12v4No1 / 133
775amnoncommon jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 133
794amnoncommon control, municipality of logrono, kingdom of spain, adult, homo sapiens, feces2021-06-08v4No1 / 133
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces male mus musculoides united states of america nyulmc nod/shiltj (no. 001976, jackson labs) research facility )2017-01-12v4No1 / 134
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
920amnoncommon research facility, south korea, feces, mouse chow, mus musculus, mouse, c57bl/6, male organism2022-07-19v3No1 / 135
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, finland2017-09-12v4No1 / 136
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 136
594amnoncommon adult, cameroon, feces, homo sapiens, ngoantet, rural community2020-03-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
212amnoncommon mouse, mus musculus, feces, research facility, united states of america, obese body mass index status, db/db mouse, obesity2017-10-22v4No1 / 137
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
617amnoncommon alpine pasture, alpine, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 137
920amnoncommon high fat diet, south korea, male organism, mouse, c57bl/6, mus musculus, research facility, feces2022-07-19v3No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
26amnon high in saliva mouth compared to pair of nares mucus in united states of america felis catus 2016-12-05v4No1 / 138
197amnon high in finland compared to india in 13-year-old human stage feces homo sapiens obsolete_juvenile stage juvenile organism 2017-09-12v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in homo sapiens united states of america feces )2017-04-11v4No1 / 139
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in mouse mus musculus feces research facility united kingdom )2017-10-29v4No1 / 139
797amnon high in 2-year-old human stage child compared to 12-month-old human stage infant in formula fed germany homo sapiens feces 2021-06-13v3No1 / 139
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
538amnon high in colon right colon compared to feces in mus musculus mouse research facility c57bl/6 jackson laboratories age 8 weeks canada 2019-07-29v4No1 / 140
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
741amnoncommon alfalfa diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 141
396amnon high in rainbow trout oncorhynchus mykiss compared to common carp cyprinus carpio in fish england intestine digestive system 2018-11-14v4No1 / 142
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in mouse mus musculus feces research facility united states of america obese body mass index status db/db mouse obesity )2017-10-22v4No1 / 143
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in fourth decade human stage adult compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
334amnonhigher in il-1alpha knockout mice compared to c57bl/6 controls ( high in il-1alpha knockout compared to c57bl/6 in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 145
822amnoncommon hydrolized diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 145
241amnonhigher in babies from russia compared to estonia ( high in russia compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 146
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
666amnoncommon zoological garden, hippopotamus amphibius, italy, feces2020-09-25v3No1 / 146
815amnoncommon corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 146
15amnoncommon namibia, feces, canis mesomelas2016-11-08v4No1 / 147
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 147
406amnoncommon feces, south africa, lycaon pictus, african wild dog2018-11-21v4No1 / 147
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 147
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 147
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, aphodius haemorrhoidalis2019-04-18v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
214amnon high in strain s129 compared to c57bl/6j in mouse mus musculus feces united states of america research facility jackson laboratories high fat diet 2017-10-23v4No1 / 148
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
307amnoncommon mus musculus, mouse, male, c3h/hej, feces, united states of america, research facility2018-03-19v4No1 / 148
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in state of minnesota united states of america feces 2021-04-06v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
826amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 150
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in zambia feces monkey baboon papio 2018-11-23v4No1 / 151
481amnoncommon united states of america, state of alabama, research facility, channel catfish, ictalurus punctatus, intestine2019-02-12v4No1 / 151
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 151
822amnoncommon meat diet, high protein diet, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 151
889amnon high in woodland yamalo-nenets autonomous okrug compared to nenets autonomous okrug in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v3No1 / 151
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 152
866amnoncommon restraint stress, stress, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 152
885amnoncommon human early adulthood stage, state of florida, united states of america, feces, homo sapiens2022-03-26v3No1 / 152
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in mus musculus mouse feces israel research facility c57bl/6 )2018-05-15v4No1 / 153
822amnoncommon high fiber, research facility, foxhound, city of melbourne, australia, feces, canis lupus familiaris, dog2021-08-29v4No1 / 153
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 154
220amnon high in diet high fat diet compared to mouse chow low fat diet in mus musculus mouse feces research facility united states of america female balb/c 2017-10-24v4No1 / 154
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in rattus rat research facility wistar rat czech republic feces )2018-08-19v4No1 / 154
594amnoncommon adult, cameroon, feces, homo sapiens, city, yaounde2020-03-12v4No1 / 154
629amnon high in msm homosexual compared to msw heterosexual in male adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 154
826amnon high in subgingival plaque subgingival dental plaque compared to supragingival plaque supragingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v4No1 / 154
833amnoncommon normal exercise, adult, slovak republic, age 60-65 years, feces, homo sapiens2021-09-11v1No1 / 154
833amnoncommon homo sapiens, feces, age 60-65 years, slovak republic, adult, athlete, high exercise2021-09-11v1No1 / 154
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease trichuris muris late timepoints in mus musculus mouse feces research facility sweden )2017-04-12v4No1 / 155
273amnon high in 1-month-old human stage age compared to 1-year-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 155
526amnoncommon in bile of Cholelithiasis patients (common homo sapiens, gallbladder, bile, adult, kingdom of spain, cholelithiasis)2019-07-14v3No1 / 155
836amnoncommon chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 155
725amnoncommon control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 156
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
653amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 157
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 157
902amnoncommon salmonella gastroenteritis, salmonellosis, adult organism, horse, equus caballus, antibiotic, united states of america, feces2022-05-02v4No1 / 158
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
379amnoncommon gallus gallus, chicken, feces, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
678amnoncommon control, supragingival plaque, supragingival dental plaque, kingdom of spain, homo sapiens, adult2028-03-02v3No1 / 160
815amnoncommon lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
368amnoncommon feces, united states of america, mouse, mus musculus, research facility, nzb/w f12018-09-03v4No1 / 161
909amnoncommon age 18 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 161
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 162
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
26amnoncommon united states of america, felis catus, saliva, mouth2016-12-05v4No1 / 163
413amnon high in mouse chow compared to high fat diet in mouse mus musculus research facility feces jackson laboratory c57bl/6j ldlr -/- 2018-11-26v4No1 / 163
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, peromyscus maniculatus, deer mice, age 3-5 weeks, province of ontario, algonquin provincial park, wild)2019-07-28v3No1 / 163
696amnon high in opisthostoma concinnum plectostoma concinnum compared to alycaeus jagori in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 163
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
919amnon high in 12-month-old human stage compared to 2-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v4No1 / 164
408amnon high in larval stage compared to stomach in ant costa rica united states of america pseudomyrmex spinicola 2018-11-22v4No1 / 165
906amnoncommon feces, sciurus carolinensis, grey squirrel, province of ontario, canada2022-05-19v4No1 / 165
652amnoncommon sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 166
658amnon high in asian burmese compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 166
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in no dental caries supragingival dental plaque supragingival plaque dentition united states of america homo sapiens 2022-07-25v4No1 / 167
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
438amnonlower in kindergarten compared to primary and middle school kids ( high in 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 compared to 2-5 year-old child stage age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, polydextrose, high fat diet + polydextrose2019-01-11v4No1 / 168
909amnoncommon age 6 weeks, manchester, united kingdom, mouse, mus musculus, research facility, feces2022-05-20v3No1 / 168
190amnoncommon homo sapiens, tanzania, hadza, hunter gatherer, feces2017-09-04v4No1 / 169
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
197amnoncommon 13-year-old human stage, feces, homo sapiens, obsolete_juvenile stage, juvenile organism, india2017-09-12v4No1 / 170
671amnoncommon 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
885amnoncommon c57bl/6, research facility, state of ohio, mouse, mus musculus, united states of america, feces2022-03-26v3No1 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
666amnoncommon italy, feces, wood mouse, apodemus sylvaticus2020-09-25v3No1 / 171
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
594amnon high in ngoantet rural community compared to city yaounde in homo sapiens feces cameroon adult 2020-03-12v4No1 / 172
241amnonlower in babies age <1 year compared to age 1-3 years ( high in 2-year-old human stage 1-year-old human stage age age 1-3 years compared to under-1-year-old human stage in homo sapiens feces infant )2017-11-13v4No1 / 173
163amnoncommon stomach, ochotonidae, pika, ochotona curzoniae, mongolia grassland, china2017-07-13v4No1 / 174
851amnon high in colonic mucosa sigmoid colon brushing sigmoid colon compared to feces in milan italy adult homo sapiens 2021-12-16v3No1 / 174
99amnoncommon commonwealth of virginia, united states of america, skin, mucus, anaxyrus americanus, american toad2017-04-02v4No1 / 176
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, ketogenic diet2018-11-20v4No1 / 177
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ruficapillus2019-04-18v4No1 / 178
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
625amnoncommon state of minnesota, como zoo, united states of america, white-faced saki, pithecia pithecia, zoological garden, feces2020-05-16v4No1 / 179
759amnoncommon city of boston, commonwealth of massachusetts, research facility, feces, united states of america, rattus norvegicus, rat2021-04-06v4No1 / 179
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in mus musculus mouse research facility switzerland c57bl/6j feces mouse chow )2018-09-06v4No1 / 180
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
892amnon high in 4-year-old human stage child compared to human adult stage adult organism in saliva united states of america homo sapiens 2022-04-07v4No1 / 180
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 181
924amnoncommon guangzhou city prefecture, 8-year-old human stage, 7-year-old human stage, child, supragingival dental plaque, supragingival plaque, china2022-07-27v3No1 / 181
639amnoncommon lepus europaeus, european brown hare, nature reserve, adult, wild, australia, feces2020-08-21v3No1 / 182
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
321amnoncommon mus musculus, mouse, c57bl/6j, feces, united states of america, research facility2018-04-22v4No1 / 183
396amnon high in common carp cyprinus carpio compared to rainbow trout oncorhynchus mykiss in fish england intestine digestive system 2018-11-14v4No1 / 184
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
458amnoncommon in mice strains from harlan sprague dawley (common mus musculus, mouse, research facility, feces, female, united states of america, harlan sprague dawley)2019-01-11v4No1 / 184
555amnon high in supragingival plaque dentition compared to saliva in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 184
777amnon high in 3-year-old human stage compared to 18-month-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 185
188amnoncommon mus musculus, mouse, research facility, female, cba/caj, taconic farms, feces2017-10-25v4No1 / 185
550amnon high in sea water compared to starfish wild coelomic fluid patiria pectinifera in city hokkaido japan 2019-08-18v4No1 / 185
861amnon high in soweto city urban community compared to bushbuckridge local municipality peri-urban community rural community in human middle aged stage south africa female homo sapiens feces 2022-01-15v3No1 / 185
457amnonlower in mice fed polydextrose+high fat diet compared to high fat diet ( high in high fat diet compared to high fat diet + polydextrose polydextrose in mouse mus musculus feces research facility c57bl/6ncrl finland male )2019-01-11v4No1 / 186
661amnoncommon farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus, intestine2020-09-20v4No1 / 186
26amnon high in saliva mouth compared to pair of nares mucus in canis lupus familiaris united states of america 2016-12-05v4No1 / 187
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
423amnoncommon bank vole, myodes glareolus, ukraine, feces2018-12-05v4No1 / 187
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
872amnon high in 1-year-old human stage compared to infant age 6-12 months under-1-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 188
885amnoncommon c57bl/6 t1r2-ko, mouse, state of ohio, mus musculus, research facility, united states of america, feces2022-03-26v3No1 / 188
158amnoncommon cat, felis catus, united states of america, saliva, mouth2017-07-06v4No1 / 189
197amnon high in india compared to finland in 13-year-old human stage feces homo sapiens obsolete_juvenile stage juvenile organism 2017-09-12v4No1 / 189
352amnon high in feces compared to small intestine duodenum in homo sapiens new delhi india 2018-07-30v4No1 / 190
413amnoncommon mouse, mus musculus, research facility, feces, jackson laboratory, c57bl/6j, ldlr -/-, mouse chow2018-11-26v4No1 / 190
860amnoncommon china, research facility, duck, anas platyrhynchos, intestine, intestinal contents2022-01-12v3No1 / 190
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces alouatta pigra howler monkey central america state of florida 2017-03-03v4No1 / 193
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 193
866amnoncommon control, mouse, state of illinois, c57bl/6, mus musculus, research facility, united states of america, feces2022-02-08v4No1 / 193
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
826amnoncommon supragingival plaque, supragingival dental plaque, age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 195
592amnoncommon united states of america, feces, commonwealth of pennsylvania, research facility, oryctolagus cuniculus, rabbit2020-02-18v1No1 / 196
620amnoncommon feces, wild, nouabale-ndoki national park, republic of congo, gorilla gorilla2020-05-06v4No1 / 196
866amnon high in control compared to restraint stress stress in c57bl/6 united states of america state of illinois research facility feces mus musculus mouse 2022-02-08v4No1 / 196
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
777amnon high in 3-month-old human stage compared to 2-days-old human in infant homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 197
80amnoncommon feces, alouatta pigra, howler monkey, tropical broadleaf forest biome, central america, woodland area2017-03-03v4No1 / 198
372amnon high in high fat diet compared to mouse chow in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 199
592amnoncommon feces, democratic republic of the congo, wild, pan paniscus, bonobo2020-02-18v1No1 / 199
334amnoncommon mus musculus, mouse, feces, israel, research facility, c57bl/62018-05-15v4No1 / 200
411amnoncommon zambia, feces, monkey, papio kindae, kinda baboon, wild2018-11-23v4No1 / 200
922amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 200
6amnoncommon urine, female, homo sapiens, pregnancy, state of tennessee2016-10-13v4No1 / 201
42amnoncommon in tcr-b deficient c57bl6 mice (common feces, research facility, mus musculus, c57bl/6, japan)2016-12-10v4No1 / 201
384amnoncommon equus caballus, horse, canada, farm, oral cavity, saliva, pasture, mouth2018-10-22v4No1 / 201
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 202
248amnoncommon mouse, mus musculus, research facility, fvb/n mice, germany, feces2017-11-22v4No1 / 203
405amnoncommon mouse, mus musculus, research facility, feces, united states of america, swiss webster, control diet2018-11-20v4No1 / 203
438amnonlower in centenarians compared to adults ( high in fifth decade human stage fourth decade human stage 65-79 year-old human stage compared to tenth decade human stage ninth decade human stage age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
457amnoncommon mouse, mus musculus, feces, research facility, c57bl/6ncrl, finland, male, high fat diet2019-01-11v4No1 / 204
617amnonhigher in cow milk of cows in alpine pasture compared to lowland farm ( high in alpine pasture alpine compared to lowland farm lowland pasture in farm italy cow milk (raw) cow milk (fluid) milk )2020-05-03v3No1 / 204
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in third decade human stage homo sapiens adult canada toronto 2020-09-13v3No1 / 205
889amnon high in winter compared to summer in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v3No1 / 205
568amnon high in thailand compared to viet nam in gallus gallus chicken feces broiler chicken 2019-12-08v3No1 / 206
725amnoncommon chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 206
863amnoncommon qilian county, farm, captive, china, forest musk deer, moschus berezovskii, deer, feces2022-01-28v4No1 / 206
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse jackson laboratories mouse chow 2017-10-23v4No1 / 207
702amnoncommon equus caballus, horse, state of north carolina, united states of america, feces2028-04-02v4No1 / 207
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 207
927amnoncommon licosa island, italy, podarcis siculus, lizard, feces2022-08-15v3No1 / 207
88amnondifferent between herds in cape buffalo feces ( high in herd croc bridge herd compared to lower sabie herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 208
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
150amnoncommon canis lupus familiaris, dog, feces, united states of america2017-04-26v4No1 / 208
123amnon high in diet normal diet regular mouse chow compared to high fat diet in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 209
503amnoncommon mouse, mus musculus, research facility, feces, c57bl/6, japan2019-03-12v4No1 / 210
826amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 211
658amnon high in asian burmese compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 212
669amnon high in 12-month-old human stage compared to 2-month-old human stage in sweden infant feces homo sapiens 2020-09-26v4No1 / 212
17amnoncommon ochotona, feces, stomach, tibetan plateau2016-11-09v4No1 / 214
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
826amnoncommon dentition, subgingival plaque, subgingival dental plaque, age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, research facility, united states of america2021-08-22v4No1 / 215
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
892amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in saliva united states of america homo sapiens 2022-04-07v4No1 / 216
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 217
759amnon high in commonwealth of massachusetts city of boston research facility compared to wild state of new york new york city in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
80amnon high in tropical moist broadleaf forest biome compared to dry forest in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 218
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in msw heterosexual compared to homosexual gay msm in homo sapiens feces hiv infection kingdom of spain sweden adult male )2020-01-14v3No1 / 220
466amnoncommon in cow feces left in field for 30-60 days (common feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v4No1 / 221
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 221
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
369amnoncommon mus musculus, mouse, research facility, switzerland, c57bl/6j, feces, mouse chow2018-09-06v4No1 / 224
411amnoncommon zambia, feces, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 224
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mouse mus musculus )2018-11-18v4No1 / 225
873amnon high in botswana compared to tanzania in africa rural community human adult stage adult homo sapiens feces 2022-03-03v1No1 / 226
902amnon high in salmonella gastroenteritis salmonellosis compared to control in adult organism horse equus caballus united states of america feces 2022-05-02v4No1 / 226
42amnoncommon in tcr-b deficient balb/c mice (common mus musculus, research facility, feces, balb/c, japan)2016-12-10v4No1 / 227
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
873amnon high in urban community commonwealth of pennsylvania united states of america compared to tanzania botswana africa rural community in human adult stage adult feces homo sapiens 2022-03-03v1No1 / 227
927amnon high in licosa island compared to punta licosa in lizard podarcis siculus italy feces 2022-08-15v3No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in mouse mus musculus feces united states of america research facility strain 129s )2017-10-23v4No1 / 232
331amnon high in dry season compared to wet season in feces monkey theropithecus gelada ethiopia 2018-05-13v4No1 / 232
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to 14-year-old human stage 13-year-old human stage child age 13-15 years in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 232
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 232
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 232
708amnoncommon c57bl/6, state of montana, united states of america, research facility, feces, mouse, mus musculus2028-05-16v4No1 / 232
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to vancomycin antibiotic in human adult stage amsterdam kingdom of the netherlands feces male homo sapiens adult )2022-02-19v3No1 / 232
351amnoncommon sea urchin, lytechinus variegatus, research facility, eagle harbor, state of florida, united states of america, feces2018-07-30v4No1 / 233
826amnoncommon state of illinois, united states of america, saliva, research facility, age 4 years, adult organism, female organism, beagle dog, dog, canis lupus familiaris2021-08-22v4No1 / 233
872amnon high in 1-year-old human stage compared to 2-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 233
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 234
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
639amnon high in european brown hare lepus europaeus compared to oryctolagus cuniculus european rabbit in nature reserve adult wild australia feces 2020-08-21v3No1 / 235
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in a/j balb/c compared to c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 237
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic neomycin ampicillin in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 238
434amnoncommon rat, rattus norvegicus, sprague dawley, feces, caecum, research facility, switzerland2018-12-20v4No1 / 238
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in young adult stage soldiers compared to tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage adult age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
620amnoncommon chimpanzee, pan troglodytes troglodytes, wild, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 238
896amnon high in glucose diet compared to starch diet in feces state of utah united states of america research facility age 2 months female c57bl/6j jackson laboratories mus musculus mouse 2022-04-17v4No1 / 238
119amnoncommon mus musculus, mouse, feces, research facility, sweden2017-04-12v4No1 / 239
286amnoncommon in feces of individuals with kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
406amnoncommon feces, zoological garden, french republic, gorilla gorilla, monkey, gorilla2018-11-21v4No1 / 239
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 239
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 240
725amnoncommon acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 240
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, high fat diet, mouse, diet2017-10-24v4No1 / 241
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, control diet2020-02-09v4No1 / 241
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
666amnoncommon south american tapir, tapirus terrestris, italy, feces2020-09-25v3No1 / 242
161amnoncommon in barn swallows in colorado (common state of colorado, hirundo rustica, feces, united states of america, barn swallow)2017-07-12v4No1 / 245
384amnon high in pasture compared to barn hay in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 245
889amnon high in nenets autonomous okrug compared to woodland yamalo-nenets autonomous okrug in tundra reindeer rangifer tarandus ruminal fluid siberia russia rumen 2022-04-01v3No1 / 247
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
781amnoncommon kirk's dik-dik, madoqua kirkii, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 248
351amnoncommon sea urchin, lytechinus variegatus, coelomic fluid, research facility, eagle harbor, state of florida, united states of america2018-07-30v4No1 / 249
429amnoncommon rat, rattus norvegicus, dahl salt-sensitive, feces, israel, research facility, salt rich diet, salt2018-12-13v4No1 / 249
559amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum white rhinoceros in feces united states of america captive zoological garden 2019-11-03v4No1 / 249
219amnoncommon in mother mice feces (common mus musculus, mouse, feces, c57bl/6, research facility, female, south korea)2017-10-24v4No1 / 250
399amnoncommon feces, united states of america, loxodonta africana, african elephant, zoological garden, state of tennessee2018-11-16v4No1 / 252
666amnoncommon european rabbit, oryctolagus cuniculus, italy, feces2020-09-25v3No1 / 252
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
45amnonlower in young babies compared to 2 year olds in india ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant india )2016-12-19v4No1 / 253
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 254
71amnon high in feces colon hindgut compared to small intestine stomach in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 255
214amnon high in diet high fat diet compared to nih 31m chow mouse chow in mouse mus musculus feces united states of america research facility 2017-10-23v4No1 / 255
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to ampicillin antibiotic in mus musculus mouse c57bl/6j feces united states of america research facility )2018-04-22v4No1 / 255
561amnon high in grass growth diet summer compared to spring green stage diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 256
625amnoncommon black-handed spider monkey, ateles geoffroyi, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 256
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-04v4No1 / 257
503amnoncommon mouse, mus musculus, research facility, feces, balb/c, japan2019-03-12v4No1 / 257
617amnoncommon lowland pasture, lowland farm, farm, italy, cow milk (raw), cow milk (fluid), milk2020-05-03v3No1 / 257
308amnoncommon red abalone, haliotis rufescens, feces, united states of america, state of california, research facility2018-03-30v4No1 / 258
759amnon high in state of vermont farm pig compared to state of alabama wild wild boar in united states of america feces sus scrofa 2021-04-04v4No1 / 258
167amnoncommon feces, female, research facility, mus musculus, nod mouse, mouse, united states of america2017-07-18v4No1 / 260
220amnoncommon mus musculus, mouse, feces, research facility, united states of america, female, balb/c, diet, mouse chow, low fat diet2017-10-24v4No1 / 262
63amnon high in male compared to female in homo sapiens feces united states of america 2017-12-04v4No1 / 262
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to ampicillin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
49amnoncommon giraffa camelopardalis, feces2017-01-19v4No1 / 264
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america mouse mus musculus research facility nzb/w f1 )2018-09-03v4No1 / 265
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 267
559amnoncommon feces, united states of america, captive, zoological garden, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v4No1 / 267
78amnonhigher in younger gazelles ( high in age young age compared to old age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 268
759amnon high in state of alabama wild wild boar compared to state of vermont farm pig in united states of america feces sus scrofa 2021-04-04v4No1 / 268
379amnonpositively correlated with age 8-35 days in chickens ( high in age old age compared to young age in gallus gallus chicken feces united kingdom )2018-09-14v4No1 / 271
568amnoncommon gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 272
78amnonhigher in older gazelles ( high in age old age compared to young age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 273
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
384amnoncommon equus caballus, horse, canada, farm, barn, hay, oral cavity, saliva, mouth2018-10-22v4No1 / 274
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 275
892amnon high in adult human adult stage compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v4No1 / 275
137amnon high in adult compared to juvenile stage in gopherus polyphemus gopher tortoise feces united states of america state of florida 2017-04-17v4No1 / 277
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to wild south africa in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v4No1 / 277
550amnon high in patiria pectinifera compared to asterias amurensis in city hokkaido starfish coelomic fluid wild japan 2019-08-18v4No1 / 278
688amnoncommon nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 278
438amnon high in 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage adult in homo sapiens feces china 2018-12-30v4No1 / 279
639amnoncommon nature reserve, adult, wild, australia, feces, european rabbit, oryctolagus cuniculus2020-08-21v3No1 / 280
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
225amnoncommon in polgA mutants (accelerated aging) (common mouse, mus musculus, feces, research facility, polga mutant, united kingdom)2017-10-29v4No1 / 281
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 281
696amnon high in georissa georissa similis compared to alycaeus jagori in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 282
384amnon high in barn hay compared to pasture in equus caballus horse canada farm saliva mouth 2018-10-22v4No1 / 283
334amnonlower in il-1alpha knockout mice compared to c57bl/6 controls ( high in c57bl/6 compared to il-1alpha knockout in mus musculus mouse feces israel research facility )2018-05-15v4No1 / 284
586amnoncommon rattus norvegicus, rat, sprague dawley, research facility, male, israel, feces, fructose diet, fructose2020-02-09v4No1 / 287
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
596amnon high in 2-5 year-old child stage age 1-7 years compared to under-1-year-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 288
729amnon high in central chimpanzee pan troglodytes troglodytes cameroon wild compared to eastern chimpanzee pan troglodytes verus europe captive zoological garden in feces monkey 2021-01-05v3No1 / 288
861amnon high in peri-urban community rural community bushbuckridge local municipality compared to city urban community soweto in human middle aged stage female south africa feces homo sapiens 2022-01-15v3No1 / 289
863amnoncommon farm, yuzhong county, xinglong mountain national nature reserve, moschus chrysogaster, alpine musk deer, china, deer, captive, feces2022-01-28v4No1 / 290
653amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 291
922amnon high in human adult stage adult compared to 4-year-old human stage child in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 291
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
625amnoncommon gorilla gorilla, state of minnesota, como zoo, united states of america, zoological garden, feces2020-05-16v4No1 / 293
561amnon high in grass growth diet summer compared to withered grass diet winter in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 294
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
708amnonlower in mice with iron deficient diet ( high in iron supplemented diet iron compared to low iron iron deficient diet in c57bl/6 state of montana united states of america research facility feces mouse mus musculus )2028-05-16v4No1 / 295
737amnoncommon ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 295
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
476amnoncommon mouse, mus musculus, feces, research facility, united states of america, state of iowa, cf-12019-01-28v4No1 / 297
331amnoncommon feces, monkey, theropithecus gelada, ethiopia2018-05-13v4No1 / 298
219amnonlower in pre-weaning compared to post-weaning in mouse feces ( high in age age 28 days post-weaning compared to age 21 days pre-weaning in mus musculus mouse feces c57bl/6 male research facility south korea )2017-10-24v4No1 / 299
406amnoncommon feces, south africa, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 300
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 300
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 301
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
723amnon high in 2-5 year-old child stage compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 305
927amnoncommon punta licosa, lizard, podarcis siculus, italy, feces2022-08-15v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in mus musculus mouse research facility feces female united states of america )2019-01-11v4No1 / 306
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in third decade human stage toronto canada adult homo sapiens 2020-09-13v3No1 / 306
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
748amnon high in jersey cow compared to holstein dairy cow in united states of america state of mississippi research facility female organism feces bos taurus cow 2021-03-10v4No1 / 308
80amnoncommon feces, central america, alouatta palliata, mantled howler monkey, state of florida2017-03-03v4No1 / 309
358amnoncommon rattus, rat, research facility, wistar rat, czech republic, feces2018-08-19v4No1 / 309
625amnoncommon feces, guanacaste conservation area, costa rica, wild, alouatta palliata, mantled howler monkey2020-05-16v4No1 / 309
190amnon high in dry season compared to wet season in homo sapiens tanzania hadza hunter gatherer feces 2017-09-04v4No1 / 311
816amnon high in late pregnancy compared to early pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 312
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
80amnon high in dry forest compared to tropical moist broadleaf forest biome in feces central america alouatta palliata mantled howler monkey state of florida 2017-03-03v4No1 / 314
13amnon high in caecum colon rectum feces compared to esophagus stomach duodenum ileum mouth in mus musculus united states of america gastrointestinal system 2016-11-08v4No1 / 316
208amnoncommon mus musculus, mouse, feces, united states of america, state of texas, balb/c2017-10-06v4No1 / 316
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
406amnonlower in captive bovidae compared to wild ( high in wild compared to zoological garden in feces bovidae )2018-11-21v4No1 / 319
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 320
729amnoncommon cameroon, wild, feces, monkey, gorilla gorilla2021-01-05v3No1 / 321
515amnoncommon whole body, beetle, detritivorous beetle, feces, bulgaria, balkan mountains, onthophagus ovatus2019-04-18v4No1 / 322
123amnoncommon mus musculus, mouse, feces, research facility, united states of america, c57bl/6j2017-04-13v4No1 / 325
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 325
522amnon<