Summary for ontology term: antananarivo

Number of annotations with term: 8

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.285714
d__BacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGCTTTATAAGATAGCGGTGAAATACCTGGGCTTAACCTAGGAACTGCCGTTATTACTATAGAGCTAGAGTGATAGAGAGGATATTGGAATACCCAG0.285714
d__BacteriaTACGGAAGGTTCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACTTTTAAGTCAGCTGTGAAATCTGGCGGCTCAACCGTCAGACTGCAGTTGATACTGGAAGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.285714
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTCAGGAAAGTCTGGAGTAAAAGGCTATGGCTCAACCATAGTGTGCTCTGGAAACTGTCTGACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.285714
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGACAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGCCCGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.285714
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTATTAAGTCTGATGTGAAAGCCAATGGCCTAACCATTGAATTGCATTGGAAACTGGTAAACTAGAATACTGGAGAGGTAAGTGGAACTCCATG0.285714
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.285714

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__SolobacteriumTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCTGTTAAGTAAGTGGTTAAATTGTTGGGCTCAACCCAATCCAGCCACTTAAACTGGCAGGCTAGAGTATTGGAGAGGCAAGTGGAATTCCATGT0.666667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAACAAGTCTGAAGTGAAAGCCCGGGGCTCAACCGCGGGACTGCTTTGGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGCGGTTTCTTAAGCGCGGGGTGAAAGGCAGTGGCTTAACCACTGTTAGCCCTGCGAACTGGGAGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTGTCAAGTCAGCGGTCAAAAGTCGGGGCTCAACCCCGTGAAGCCGTTGAAACTGGCGGTCTTGAGTGAGCGAGAAGTAGGCGGAATGCGTGGT0.333333
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTATTAAGTCTAAGATAAAAGCCCGAGGCTTAACCTCGGTTCGTCTTAGAAACTGGTAGACTTGAGTGCAGTAGAGGCAAGTGGAATTTCTAGT0.333333
d__BacteriaTACGTAGGTAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTAACAAGTTGGTAGTGAAATTCCGAAGCTTAACTTCGGCGCTACTACCAAGACTGTTGAACTTGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.333333
d__BacteriaAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGTTAAGCGTGTTGTGAAATGTCGTGGCTCAACCTGGGCATTGCAGCGCGAACTGGCAGACTTGAGTGCGCGGGAAGTAGGCGGAATTCGTCG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTATTAAGTCTGATGTGAAAGCCAATGGCCTAACCATTGAATTGCATTGGAAACTGGTAAACTAGAATACTGGAGAGGTAAGTGGAACTCCATG0.320000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTCCGTAGGCGGGCTAATAAGTCAGTGGTGAAATCTCACAGCTCAACTGTGAAATTGCCATTGATACTGTTAGTCTTGAGTGAGTTTGATGTTGCTGGAATGTGTAG0.307692
d__BacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGCTTTATAAGATAGCGGTGAAATACCTGGGCTTAACCTAGGAACTGCCGTTATTACTATAGAGCTAGAGTGATAGAGAGGATATTGGAATACCCAG0.285714
d__BacteriaTACGGAAGGTTCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACTTTTAAGTCAGCTGTGAAATCTGGCGGCTCAACCGTCAGACTGCAGTTGATACTGGAAGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.285714
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCCGGGAATTGCGTTCTGAACTGGGTGGCTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.285714
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCAAGGTAAGTCAGCGGTGAAAGACCAGGGCTCAACTCTGGAAGTGCCGTTGATACTGTCTGGCTAGAATGGTTCCGCCGTGGGAGGAATGAGTAG0.235294
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCACTAAGGGTCTGTGGTGAAAGATCGAAGCTTAACTTCGGTAAGCCATGGAAACCGTAGAGCTGGAGTGTGTGAGAGGATCGTGGAATTCCATGT0.222222
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTGCGCAGGCGGTCTCTTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACGGAAACTGGAAGACTGGAGTATCGGAGAGGAAAGCAGAATTCCTAGT0.222222
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCGTCGTAAGTCGGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATCGAAACTGCGATGCTAGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.222222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTTCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTTTTAAGCGTGTTGTGAAATACTGTCGCTCAACGACAGAGGTGCAGCGCGAACTGGAGGACTTGAGTGCGCGGAATGTAGGCGGAATTCGTCG0.222222

Annotations:

common ontology terms
term enrichment score
TermScore
antananarivo0.600000
madagascar0.461538
bangui0.333333
LOWER IN antananarivo0.333333
LOWER IN bangui0.333333
central african republic0.285714
LOWER IN madagascar0.285714
LOWER IN central african republic0.285714
stunted growth0.200000
duodenum0.153846
child0.054054
africa0.051282
homo sapiens0.007353
feces0.006329
Fraction of dbbact annotations with this term covered by the query
TermScore
bangui0.500000
LOWER IN antananarivo0.500000
antananarivo0.500000
LOWER IN bangui0.500000
stunted growth0.500000
central african republic0.333333
LOWER IN madagascar0.333333
madagascar0.333333
LOWER IN central african republic0.333333
duodenum0.090909
child0.027778
africa0.026316
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
child1.000000
africa1.000000
madagascar0.750000
antananarivo0.750000
feces0.500000
duodenum0.500000
central african republic0.250000
bangui0.250000
LOWER IN madagascar0.250000
LOWER IN antananarivo0.250000
LOWER IN central african republic0.250000
LOWER IN bangui0.250000
stunted growth0.125000

Problems / suggestions? Please email info AT dbbact DOT org