Summary for ontology term: antibiotic

Number of annotations with term: 60

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.210526
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.184211
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.131579
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAAGGTCTGTGGTGAAAGACTGAAGCTTAACTTCAGTAAGCCATAGAAACCGGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.105263
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.105263
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTTTTCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.105263
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTGGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.105263
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGCATGGTAAGTCAGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTTGAAACTGTCATGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.105263
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.105263
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.078947

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACTCGGGCTCAACTTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.416667
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTAATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTTGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.416667
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGAATTATTGGGTGTAAAGGGTGCGTAGACGGGATAACAAGTTGGTTGTGAAACCCCTCGGCTCAACTGAGGAACTGCAACCAAAACTATTATTCTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAG0.416667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGAGACAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGCCTGACTGGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.416667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGACGGCAAGTCAGATGTGAAAACTGAGGGCTCAACCTTCAGACTGCATTTGAAACTGCTGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAG0.416667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGAGCAAGTCTGAAGTGAAAGCCCGCGGCCCAACTGCGGGACTGCTTTGGAAACTGCCCGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCGGCAAGTCTGAAGTGAAAGGCAGGGGCTTAACCCCTGAACTGCTTTGGAAACTGCCATGCTAGAGTGCTGGAGAGGTAAGTGGAATTCCTAG0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAGGATAAGTTGAATGTGAAATCTATGGGCTCAACCCATAGCTGCGTTCAAAACTGTTCTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.375000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACTGTTAAGTCAGCGGTGAAATACCACGGCTCAACCGTGGGGCTGCCGTTGATACTGGCGGTCTGGAGTACGATCGGCGCCGGCGGAATGTGTCA0.181818
d__BacteriaTACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTGTTAAGTCTGCGGTGAAATGTCATGGCCCAACCTTGGCATGCCGCGGATACTGATGGTCTTGAGTGCACACAAGGAAGATGGAATTCGTCGT0.173913
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGAAGTCTTGAGTGCACGCAGGGATGCTGGAATTCGTCG0.170213
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGTGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGGGATCAAGTCAGTGGTGAAATGGTGCGGCTCAACCGTAGCATTGCCGTTGAAACTGGTTCTCTTGAGTGCGAATGAGGCAGGCGGAATGTGTTG0.160000
d__BacteriaCACGTAAGCCTCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTATCTAAGCTTGGTGTGAAATTCAGGAGCTCAACTCCTGAACTGCATTGAGAACTGGATAGCTAGAGTTACTGAAGTGGAATCAGAATTCCAGG0.156863
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGGTAAGTCAGTGGTGAAAGTTTGCGGCTCAACCGTAAAATTGCCGTTGAAACTGCCGTTCTTGAGTGCGAGCGAGGTAGGCGGAATGTGCCG0.156863
d__BacteriaTACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTGGTCCAAGTCAGGGGTGAAAGCCCGGAGCTCAACTCCGGAACTGCCTTTGATACTGGATTGCTGGAATACGGATGCCGTGGGAGGAATGAGTAG0.156863
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__VerrucomicrobiaceaeTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGGGTACGTAGGCTGTAAATTAAGTCGTGCGTGAAAGGCAGGGGCTCAACCTCTGGAGTGCGCATGATACTGATTTACTGGAGTAATGGAGGGGGAACCGGAATTCTTGG0.150943
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCGAAACTGGCAGGCTTGAGTCTCGTAGAGGGAGGTAGAATTCCAGG0.136364
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCAGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGATTGCATTGGAAACTGTTCAGCTTGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.127660

Annotations:

common ontology terms
term enrichment score
TermScore
antibiotic0.706371
LOWER IN antibiotic0.549020
mus musculoides0.210526
nyulmc0.210526
nod/shiltj (no. 001976, jackson labs)0.210526
vancomycin0.201923
metronidazole0.200573
LOWER IN metronidazole0.179104
neomycin0.176471
equus caballus0.166667
horse0.166667
ampicillin0.150943
research facility0.134889
c57bl/6j0.133333
LOWER IN control0.127273
LOWER IN vancomycin0.125000
control0.118769
male0.117647
mouse0.112490
adult organism0.111111
colon0.111111
rex rabbit0.111111
amsterdam0.105263
age 2 months0.105263
mus musculus0.103738
sprague dawley0.100000
kingdom of the netherlands0.095238
LOWER IN ampicillin0.092308
rattus norvegicus0.090909
belgium0.086957
oryctolagus cuniculus0.086957
rat0.083333
colitis0.080000
sichuan province0.080000
feces0.078728
caecum0.071429
israel0.070175
united states of america0.069098
sus scrofa0.064516
pig0.064516
before antibiotics0.064516
state of louisiana0.062500
salmonella gastroenteritis0.062500
salmonellosis0.062500
pulsed antibiotic treatment, macrolide tylosin tartrate0.062500
LOWER IN pulsed antibiotic treatment, macrolide tylosin tartrate0.062500
sub-therapeutic antibiotic treatment, penicillin v potassium salt0.062500
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.062500
LOWER IN tylosin phosphate0.062500
zebrafish0.062500
age 15d0.062500
LOWER IN neomycin0.062500
tylosin phosphate0.062500
larvae0.060606
danio rerio0.055556
human adult stage0.054054
state of texas0.052632
switzerland0.051282
nasopharynx0.050000
cow0.048780
state of california0.048780
LOWER IN colitis0.044444
fish0.044444
bos taurus0.042553
dog0.037736
canada0.036364
canis lupus familiaris0.035714
LOWER IN cefoperazone0.032258
cefoperazone0.032258
LOWER IN before antibiotics0.032258
LOWER IN ciprofloxacin0.032258
ciprofloxacin0.032258
LOWER IN clindamycin0.032258
clindamycin0.032258
LOWER IN streptomycin0.032258
streptomycin0.032258
LOWER IN amoxicillin0.032258
LOWER IN doxycycline0.032258
acute severe colitis0.032258
probiotic0.031746
adult0.031414
iga positive fraction0.030769
LOWER IN iga negative fraction0.030769
iga negative fraction0.030769
LOWER IN iga positive fraction0.030769
ulcerative colitis0.029412
female0.025641
child0.020833
homo sapiens0.020619
LOWER IN antibiotics induced colitis0.000000
antibiotics induced colitis0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
before antibiotics1.000000
LOWER IN vancomycin1.000000
antibiotic0.937500
LOWER IN antibiotic0.875000
LOWER IN metronidazole0.857143
ampicillin0.800000
vancomycin0.750000
neomycin0.750000
metronidazole0.714286
LOWER IN ampicillin0.600000
state of louisiana0.500000
salmonella gastroenteritis0.500000
salmonellosis0.500000
pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
mus musculoides0.500000
nyulmc0.500000
nod/shiltj (no. 001976, jackson labs)0.500000
LOWER IN pulsed antibiotic treatment, macrolide tylosin tartrate0.500000
sub-therapeutic antibiotic treatment, penicillin v potassium salt0.500000
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.500000
LOWER IN cefoperazone0.500000
cefoperazone0.500000
LOWER IN before antibiotics0.500000
LOWER IN ciprofloxacin0.500000
LOWER IN tylosin phosphate0.500000
ciprofloxacin0.500000
LOWER IN clindamycin0.500000
clindamycin0.500000
LOWER IN streptomycin0.500000
zebrafish0.500000
age 15d0.500000
streptomycin0.500000
LOWER IN neomycin0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
acute severe colitis0.500000
tylosin phosphate0.500000
probiotic0.333333
colon0.333333
rex rabbit0.333333
larvae0.333333
amsterdam0.250000
age 2 months0.250000
equus caballus0.222222
horse0.222222
c57bl/6j0.200000
iga positive fraction0.200000
LOWER IN iga negative fraction0.200000
iga negative fraction0.200000
LOWER IN iga positive fraction0.200000
sprague dawley0.200000
kingdom of the netherlands0.166667
danio rerio0.166667
rattus norvegicus0.142857
adult organism0.125000
state of texas0.125000
belgium0.125000
oryctolagus cuniculus0.125000
ulcerative colitis0.125000
israel0.117647
switzerland0.111111
rat0.111111
nasopharynx0.100000
sichuan province0.100000
male0.090909
cow0.090909
LOWER IN control0.075676
research facility0.074830
control0.070270
mouse0.070175
LOWER IN colitis0.066667
colitis0.066667
fish0.066667
mus musculus0.063492
sus scrofa0.062500
pig0.062500
bos taurus0.058824
caecum0.055556
human adult stage0.045455
dog0.043478
feces0.041401
canada0.040000
canis lupus familiaris0.038462
state of california0.038462
united states of america0.036437
child0.027778
adult0.017341
female0.015873
homo sapiens0.011070
LOWER IN antibiotics induced colitis0.000000
antibiotics induced colitis0.000000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.800000
research facility0.683333
united states of america0.666667
antibiotic0.566667
LOWER IN control0.400000
LOWER IN antibiotic0.400000
control0.383333
mus musculus0.283333
mouse0.283333
adult0.166667
male0.166667
homo sapiens0.150000
equus caballus0.133333
horse0.133333
mus musculoides0.133333
nyulmc0.133333
nod/shiltj (no. 001976, jackson labs)0.133333
metronidazole0.116667
vancomycin0.116667
LOWER IN metronidazole0.100000
c57bl/6j0.100000
adult organism0.100000
colitis0.100000
caecum0.100000
neomycin0.100000
ampicillin0.083333
female0.066667
LOWER IN vancomycin0.066667
kingdom of the netherlands0.066667
amsterdam0.066667
human adult stage0.066667
sus scrofa0.066667
belgium0.066667
pig0.066667
age 2 months0.066667
colon0.066667
oryctolagus cuniculus0.066667
rex rabbit0.066667
sichuan province0.066667
state of california0.066667
rattus norvegicus0.066667
sprague dawley0.066667
rat0.066667
LOWER IN ampicillin0.050000
israel0.050000
antibiotics induced colitis0.050000
canis lupus familiaris0.033333
dog0.033333
state of louisiana0.033333
salmonella gastroenteritis0.033333
salmonellosis0.033333
state of texas0.033333
pulsed antibiotic treatment, macrolide tylosin tartrate0.033333
LOWER IN pulsed antibiotic treatment, macrolide tylosin tartrate0.033333
sub-therapeutic antibiotic treatment, penicillin v potassium salt0.033333
LOWER IN sub-therapeutic antibiotic treatment, penicillin v potassium salt0.033333
before antibiotics0.033333
nasopharynx0.033333
bos taurus0.033333
canada0.033333
cow0.033333
LOWER IN colitis0.033333
LOWER IN tylosin phosphate0.033333
danio rerio0.033333
fish0.033333
zebrafish0.033333
larvae0.033333
age 15d0.033333
LOWER IN neomycin0.033333
tylosin phosphate0.033333
switzerland0.033333
probiotic0.016667
LOWER IN cefoperazone0.016667
cefoperazone0.016667
LOWER IN before antibiotics0.016667
LOWER IN antibiotics induced colitis0.016667
LOWER IN ciprofloxacin0.016667
ciprofloxacin0.016667
LOWER IN clindamycin0.016667
clindamycin0.016667
LOWER IN streptomycin0.016667
streptomycin0.016667
iga positive fraction0.016667
LOWER IN iga negative fraction0.016667
iga negative fraction0.016667
LOWER IN iga positive fraction0.016667
LOWER IN amoxicillin0.016667
LOWER IN doxycycline0.016667
ulcerative colitis0.016667
child0.016667
acute severe colitis0.016667
Exp. ID User ID Description Date Region Flag Sequences
871amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens antibiotic vancomycin adult male kingdom of the netherlands amsterdam human adult stage 2022-02-19v3No1 / 2
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in feces research facility antibiotic mus musculus israel mouse )2018-10-23v4No1 / 3
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 3
327amnonhigher in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in antibiotic compared to control in nasopharynx bos taurus canada cow )2018-04-30v4No1 / 4
446amnonhigher in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in antibiotic streptomycin compared to control in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v4No1 / 4
399amnonhigher in clindamycin treated mice compared to controls ( high in antibiotic clindamycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 6
399amnonhigher in ampicillin treated mice compared to controls ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 10
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 10
902amnondominant feces, united states of america, antibiotic, salmonella gastroenteritis, equus caballus, horse, adult organism, salmonellosis2022-05-02v4No1 / 13
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 15
586amnoncommon feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 15
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
902amnondominant feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
586amnondominant feces, research facility, antibiotic, ampicillin, rattus norvegicus, sprague dawley, israel, rat, neomycin, male2020-02-09v4No1 / 16
46amnonsmj: higher in mice feces with antiobiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 20
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 25
446amnonlower in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in control compared to antibiotic streptomycin in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v4No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 26
46amnonsmj: higher in mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 28
871amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens antibiotic vancomycin adult male kingdom of the netherlands amsterdam human adult stage 2022-02-19v3No1 / 35
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 40
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 44
871amnonlower before antibiotic treatment compared to after treatment ( high in antibiotic vancomycin compared to before antibiotics in feces homo sapiens adult male kingdom of the netherlands amsterdam human adult stage )2022-02-19v3No1 / 44
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in nasopharynx bos taurus canada cow )2018-04-30v4No1 / 45
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
902amnoncommon feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 68
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic ampicillin neomycin compared to control in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 80
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 94
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 127
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 134
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
902amnoncommon feces, united states of america, antibiotic, salmonella gastroenteritis, equus caballus, horse, adult organism, salmonellosis2022-05-02v4No1 / 158
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 163
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 193
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 225
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 231
871amnonhigher before antibiotic treatment compared to after treatment ( high in before antibiotics compared to antibiotic vancomycin in feces homo sapiens adult male kingdom of the netherlands amsterdam human adult stage )2022-02-19v3No1 / 232
434amnonlower in antibiotics treated rats compared to controls ( high in control compared to antibiotic ampicillin neomycin in feces research facility caecum rattus norvegicus sprague dawley switzerland rat )2018-12-20v4No1 / 238
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 255
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 275
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 364
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to antibiotic clindamycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 394
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 698
902amnon high in control compared to colitis antibiotic colitis antibiotics induced colitis in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 1755

Problems / suggestions? Please email info AT dbbact DOT org