Summary for ontology term: arapaho

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.250000
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTGAAAAGTCGGATGTGAAATCCCCGTGCTTAACATGGGAGCTGCATTCGAAACTTTCGGACTTGAGTGTCGGAGAGGTAAGCGGAATTCCCGG0.250000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__ParasutterellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGTTGAGTAAGACAGATGTGAAATCCCCGAGCTTAACTCGGGAATGGCATATGTGACTGCTCGACTAGAGTGTGTCAGAGGGAGGTGGAATTCCACG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATCGCAAGTCAGATGTGAAAACTATGGGCTTAACCCATAAACTGCATTTGAAACTGTGGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTAG0.250000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGACAACAAGTTAGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACTAAAACTATTGTTCTTGAGTGTTGGAGAGGAAAGTGGAATTCCTAG0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__OdoribacterTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTATTAAGTTAGTGGTTAAATATTTGAGCTAAACTCAATTGTGCCATTAATACTGGTAAACTGGAGTACAGACGAGGTAGGCGGAATAAGTTAA0.250000
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__Desulfovibrionaceae;g__BilophilaTACGGAGGGTGCAAGCGTTAATCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGCTTGGTAAGTCAGGGGTGAAATCCCACAGCCCAACTGTGGAACTGCCTTTGATACTGCCAGGCTTGAGTACCGGAGAGGGTGGCGGAATTCCAGG0.250000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCGGCAGAGGTCTGTGGTGAAAGACTGAAGCTTAACTTCAGTAAGCCATAGAAACCGGGCTGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGGGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCATAGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG0.500000
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAGGTAAGTTAGTTGTGAAATCCCTCGGCTCAACTGAGGAACTGCGACTAAAACTGCTTTTCTTGAGTGCTGGAGAGGAAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGGATAGCAAGTCAGGCGTGAAATCCATCGGCTTAACCGGTGAACTGCGCTTGAAACTGTAATTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCGAG0.133333
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__Desulfovibrionaceae;g__DesulfovibrioTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGTAGGCTGTTGTGTAAGTCAGGGGTGAAATCCCACGGCTCAACCGTGGAACTGCCCTTGATACTGCATGACTTGAATCCGGGAGAGGGTGGCGGAATTCCAGG0.062500
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCATCGCAAGTCGGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACCGAAACTGTGAAGCTCGAGTGTCGGAGAGGAAAGCGGAATTCCTAGT0.055556
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTCTGCAAGTCTGGAGTGAAAACCCGGGGCTCAACCCTGGGACTGCTTTGGAAACTGTGGAGCTTGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.052632
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGTAGACAAGTCAGATGTGAAATACCGGGGCTCAACTCCGGGGCTGCATTTGAAACTGTATATCTTGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.043478
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTATGTAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTATGTAACTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.040816
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTGCTATAAGTCTGATGTGAAAGCCCGGGGCTCAACCGCGGGACTGCATTGGAAACTGTAGGACTGGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.040000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAGCAAGTTGGGAGTGAAATCTGTGGGCTCAACCCACAAATTGCTTTCAAAACTGTTTTTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.040000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__GordonibacterTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGTCAAGCGGAACCTCTAACCCGAGGGCTCAACCCCCGGTCGGGTTCCGAACTGGCAGGCTCGAGTTTGGTAGAGGAAGATGGAATTCCCGGT0.038462
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGCAGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCCGGACTGCATTGGAAACTGTTGATCTTGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.036697

Annotations:

common ontology terms
term enrichment score
TermScore
cheyenne0.600000
native american0.600000
arapaho0.600000
state of oklahoma0.500000
LOWER IN american0.333333
american0.333333
LOWER IN cheyenne0.333333
LOWER IN native american0.333333
LOWER IN arapaho0.333333
united states of america0.008065
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
cheyenne0.500000
native american0.500000
arapaho0.500000
LOWER IN american0.500000
american0.500000
LOWER IN cheyenne0.500000
LOWER IN native american0.500000
LOWER IN arapaho0.500000
state of oklahoma0.333333
united states of america0.004049
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
united states of america1.000000
state of oklahoma1.000000
cheyenne0.750000
native american0.750000
arapaho0.750000
LOWER IN american0.250000
american0.250000
LOWER IN cheyenne0.250000
LOWER IN native american0.250000
LOWER IN arapaho0.250000

Problems / suggestions? Please email info AT dbbact DOT org