Summary for ontology term: asian

Number of annotations with term: 13

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGTAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTGTATGGGGATAAAGTCAGTCACGTGTGATTGTTTGCAGGTACCATACGAATAAGGACCGGCTAATT0.300000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATTCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTGTGCAGAACGAAAAGGGCTTGGCTAATACCTAAGTCTGATGACGGTACTGCAAGAATAAGCACCGGC0.300000
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCTAAGAATATTCCGCAATGGACGAAAGTCTGACGGAGCGACGCCGCGTGGATGATGAAGGTCGGAAGATTGTAAAATCCTTTTATGACTGAAGAATAAGTATGGTGAGAGAAACGCCGTATGGTGACAGTAGGTCATGAATAAGCAACGG0.300000
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCTAAGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCGACGCCGTGTGAATGAAGAAGGCCGAAAGGTTGTAAAATTCTTTTGCAGATGAAGAATAATCATAGGAGGGAATGCCTGTGAGATGACGGTAATCATGCGAATAAGCCCCGG0.300000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CapnocytophagaTGAGGAATATTGGTCAATGGTCGAAAGACTGAACCAGCCATGCCGCGTGCAGGACAGACGGCCCTAGAGGTTGTAAACTGCTTTTATATGGGAAGAATAAGGAGTACGCGTACTTTGATGACGGTACCATATGAATAAGCATCGGCTAAC0.300000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTGGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTCGGGGACGAAAGGGTAGACGAGGTAATGCGTTTACTAAGACGGTACCCGACGAGGAAGCCACGGC0.300000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAACGAAGAAGGTCTTCGGATTGTAAAGTTCTGTGATTCGGGACGAAAGGGTTTGTGGTGAATAATCATAGACATTGACGGTACCGAAAAAGCAAGCCACGG0.300000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAAAGTCTGATCCAGCAATTCTGTGTGCACGATGACGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAAAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.300000
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaTTAAGAATATTCCGCAATGGACGCAAGTCTGACGGAGCGACGCCGCGTGGATGAAGAATGCCGAAAGGTTGTAAAATCCTTTTAAGCCTGATGAATAAGCACAATAGGGAATGATTGTGCGGTGACCGTAGGGCTTGAATAAGCACCGGC0.300000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__AnaeroglobusTGGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGACGGCCTTCGGGTTGTAAAGCTCTGTTATAGGGGACGAACGGCCGGGTAGCGAAGAGGTAGCCGGCATGACGGTACCGTAAGAGAAAGCCACGG0.300000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAAGAAGGTCCTGCTCTTTGTGGTGGGGTTGACGGTAGCTGGGTTAATGAAGCGCCGGCTA0.600000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTCGCCAGTGAAGCAGGCCTGCTCCTTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAACT0.600000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCTCATGGTCAAGCCGCAACTGTGGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTAC0.600000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGGAAGGCCTTCGGGTTGTAAACTCCTTTCGCCCGGGACGAAGCCCACCTGGTGGGTGACGGTACCGTGGAGAAGAAGCACCGGCTAACTACGTGC0.600000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGAAGGCCTTCGGGTTGTAAACTCCTTTCGCCCGGGACGAAGCCCACCTGGTGGGTGACGGTACCGTGGAGAAGAAGCACCGGCTAACTACGTGCC0.600000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCTCATGGTCAAGCCGCAACAATGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.400000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAGAGTCTGATCCAGCAATTCTGTGTGCACGATGAAGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAAAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.400000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAAGCAGGCCTGCCTCGTTTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAA0.400000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTGAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG0.400000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGATGGGGACGAACGTGCCTAATGCGAATAGTTTTAGGCAATGACGGTACCCATCGAGGAAGCCACGG0.400000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TAGGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCATGCCGCGTGATGGATGACGGCCTTAGGGTTGTAAACATCTTTTCTACTAGAGGAATAGAGTTCACGTGTGGACAGACGACTGTATAGTAGGAATAAGGATCGGCTAACTC0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGTTAGGGACGAAGCCGCACCTGTTTTTGGGTGTGGTGACGGTACCTTTGTTAAGAAGCACCGGCTAA0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTCCGGGTTGTAAACTGCTTTTAGTTGGGAATAAAAAGAGGGACGTGTCCCTAATTGTATGTACCTTCAGAAAAAGGACCGGCTAATT0.428571
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTCGCGTGAAGGAAGACCGTCCTAAGGATTGTAAACTTCTTTTATACGGGAATAACGGGCGATACGAGTATTGCATTGAATGTACCGTAAGAATAAGCATCGGCTAACT0.428571
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCTAAGAATATTCCGCAATGGACGAAAGTCTGACGGAGCGACGCCGCGTGGATGAAGAAGGCTGAAAAGTTGTAAAATCCTTTTGTTGATGAAGAATAAGGAGAAGAGGGAATGCTTCTCTGATGACGGTAATCAGCGAATAAGCCCCGGC0.428571
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGCAGGACGACGGCCCTATGGGTTGTAAACTGCTTTTATAGGGGAATAAAGTGATCTACGTGTAGTTTATTGTATGTACCCTATGAATAAGGACCGGCTAATT0.428571
d__Bacteria;p__"Bacteroidetes"TAGGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCATGCCGCGTGATGGAAGACGGCCTTAGGGTTGTAAACATCTTTTCTGCTAGAGGAATATAGTTCACGTGTGGACAGACGACTGTATAGCAGGAATAAGGATCGGCTAACTC0.428571
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGTCTTCTTGCGAATAGTTAGGAGAATTGACGGTACCGGAATAGAAAGCCACGG0.428571
d__Bacteria;p__"Bacteroidetes"TAGGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCATGCCGCGTGATGGATGACGGCCTTAGGGTTGTAAACATCTTTTCTACTAGAGGAATAGCGCTTATGTATAGGCAGATGACTGTATAGTAGGAATAAGGATCGGCTAACTC0.428571
d__Bacteria;p__"Bacteroidetes"TAGGGAATATTGGTCAATGGGCGGAAGCCTGAACCAGCCATGCCGCGTGATGGATGACGGCCTTAGGGTTGTAAACATCTTTTCTACTAGAGGAATATAGTCCACGTGTGGACAGACGACTGTATAGTAGGAATAAGGATCGGCTAACTC0.428571

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN asian0.666667
asian0.666667
caucasian0.500000
european0.500000
bacteroides plebeius0.500000
seaweed degrading0.500000
burmese0.500000
LOWER IN caucasian0.500000
LOWER IN european0.500000
6-year-old human stage0.500000
8-year-old human stage0.500000
9-year-old human stage0.500000
10-year-old human stage0.500000
11-year-old human stage0.500000
LOWER IN burmese0.500000
7-year-old human stage0.333333
hispanic0.333333
LOWER IN hispanic0.333333
state of nebraska0.250000
LOWER IN african american0.250000
african american0.250000
hispanic or latin american0.250000
LOWER IN hispanic or latin american0.250000
supragingival dental plaque0.142857
supragingival plaque0.100000
state of new york0.083333
dentition0.043478
child0.027778
united states of america0.008097
homo sapiens0.007380
adult0.005780
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.923077
united states of america0.923077
asian0.692308
dentition0.615385
child0.615385
state of nebraska0.615385
supragingival plaque0.615385
supragingival dental plaque0.615385
6-year-old human stage0.615385
7-year-old human stage0.615385
8-year-old human stage0.615385
9-year-old human stage0.615385
10-year-old human stage0.615385
11-year-old human stage0.615385
feces0.384615
burmese0.384615
LOWER IN asian0.307692
adult0.307692
state of new york0.307692
LOWER IN burmese0.230769
caucasian0.153846
european0.153846
LOWER IN caucasian0.153846
LOWER IN european0.153846
bacteroides plebeius0.076923
seaweed degrading0.076923
LOWER IN african american0.076923
african american0.076923
hispanic or latin american0.076923
hispanic0.076923
LOWER IN hispanic or latin american0.076923
LOWER IN hispanic0.076923
Exp. ID User ID Description Date Region Flag Sequences
650amnonother feces, asian, bacteroides plebeius, seaweed degrading2020-09-12v4No1 / 1
658amnon high in hispanic or latin american hispanic compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 17
650amnondominant feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 18
658amnon high in african american compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 29
658amnon high in caucasian european compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 30
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
658amnon high in asian burmese compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 118
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 157
658amnon high in asian burmese compared to african american in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 166
658amnon high in asian burmese compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 212
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475

Problems / suggestions? Please email info AT dbbact DOT org