Summary for ontology term: atherosclerosis

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGTTAAGTCAGCGGTGAAATCTAGGAGCTTAACTCCTAAATTGCCATTGATACTGGCGGGCTTGAGTGTAGATGAGGTAGGCGGAATGCGTGG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGGAGATTAAGTGTGTTGTGAAATGTAGACGCTCAACGTCTGAATTGCAGCGCATACTGGTTTCCTTGAGTACGCACAACGTTGGCGGAATTCGTCG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.666667
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaTACGTAAGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGCAGGCGGGTCGCCAAGCTTGGTAAGAAATACCGGGGCTCAACTCCGGAGCTATATTGAGAACTGGCGAGCTAGAGTTGCCGAAGGGTATCCGGAATTCCGCG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGCGATCAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGGTCGTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.400000
d__Archaea;p__"Euryarchaeota";c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__MethanobrevibacterTACCGGCAGCTCTAGTGGTAGCAGTTTTTATTGGGCCTAAAGCGTCCGTAGCCGGTTTAATAAGTCTCTGGTGAAATCCTGCAGCTTAACTGTGGGAATTGCTGGAGATACTATTAGACTTGAGATCGGGAGAGGTTAGAGGTACTCCCA0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.315789
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.222222

Annotations:

common ontology terms
term enrichment score
TermScore
atherosclerosis1.000000
canada0.076923
saliva0.041667
adult0.011494
homo sapiens0.007353
feces0.006329
Fraction of dbbact annotations with this term covered by the query
TermScore
atherosclerosis1.000000
canada0.040000
saliva0.021739
adult0.005780
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
adult1.000000
canada1.000000
atherosclerosis1.000000
feces0.500000
saliva0.500000

Problems / suggestions? Please email info AT dbbact DOT org