Summary for ontology term: atlanta

Number of annotations with term: 15

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTACGTATGTCGCGAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGCCTGACAAGTCAGGGGTGAAAACCTGCGGCTCAACCGCAGGCCTGCCTTTGAAACTGCTAGGCTGGAGTACCGGAGAGGTGGACGGAACTGCACG1.000000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTCAGCTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGGCTGGAACTCCTGG0.666667
d__Bacteria;p__SR1;g__SR1_genera_incertae_sedisTACGTAGGTCTCAAGCGTTATCCGGATTTACTGGGCGTAAAGTGTCCGTAGTCTGATCTGTAAGTCTGTTTTCAAATCCTACGACTCAATCGTAGAAAGGGAATGGATACTGTAGATCTAGAAGTATCTAGGGGTTAGTGGAATTTCCGG0.666667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGAAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTTAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGAGTGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCTTCGGCTCAACCGAAGAAGTGCATCGGAAACTGGGAGACTTGAGTACAGAAGAGGGCAGTGGAACTCCATG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCAGGCGTTATCCGAATTTATTGGGTTTAAAGGGTGCGTAGGCCGTTTGATAAGCGTGCTGTGAAATATAGTGGCTCAACCTCTATCGTGCAGCGCGAACTGTCGAACTTGAGTGCGTAGTAGGTAGGCGGAATTCGTGG0.666667
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGAAATGCAAGTTAGTTGTGAAATACCTCGGCTTAACTGAGGAACTGCAACTAAAACTATATTTCTTGAGTATCGGGGGGGTTTGTGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGTAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.666667
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__NeisseriaceaeTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTATTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGATAGCTAGAGTGTGTCAGAGGGGGGTGGAATTCCACG0.666667
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGAGCTCAACTCTGTATTGCGTTGGAAACTGCATGACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.666667

Annotations:

common ontology terms
term enrichment score
TermScore
atlanta1.333333
cheek0.400000
age<17 years0.347826
LOWER IN cheek0.210526
adolescent stage0.170213
obsolete_juvenile stage0.145455
LOWER IN crohn&#39;s disease0.125000
crohn's disease0.125000
hiv infection0.114286
LOWER IN hiv infection0.114286
periodontitis0.105263
LOWER IN periodontitis0.105263
LOWER IN ulcerative colitis0.086957
ulcerative colitis0.086957
mouth0.078853
dentition0.074766
LOWER IN dentition0.071429
immature stage0.051613
child0.050314
LOWER IN saliva0.039216
saliva0.037383
control0.020779
LOWER IN control0.020779
united states of america0.016064
homo sapiens0.014652
feces0.006294
Fraction of dbbact annotations with this term covered by the query
TermScore
atlanta2.000000
LOWER IN crohn&#39;s disease1.000000
crohn's disease1.000000
age<17 years0.500000
LOWER IN cheek0.500000
cheek0.500000
periodontitis0.250000
LOWER IN periodontitis0.250000
LOWER IN ulcerative colitis0.125000
adolescent stage0.125000
ulcerative colitis0.125000
obsolete_juvenile stage0.100000
hiv infection0.100000
LOWER IN hiv infection0.100000
LOWER IN dentition0.043478
dentition0.043478
mouth0.041667
immature stage0.028571
child0.027778
saliva0.021739
LOWER IN saliva0.021739
control0.010811
LOWER IN control0.010811
united states of america0.008097
homo sapiens0.007380
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
united states of america1.000000
atlanta1.000000
mouth0.733333
cheek0.333333
control0.266667
feces0.266667
child0.266667
obsolete_juvenile stage0.266667
age<17 years0.266667
immature stage0.266667
adolescent stage0.266667
LOWER IN control0.266667
dentition0.266667
LOWER IN dentition0.200000
LOWER IN saliva0.200000
saliva0.133333
LOWER IN cheek0.133333
hiv infection0.133333
LOWER IN hiv infection0.133333
LOWER IN crohn&#39;s disease0.066667
LOWER IN ulcerative colitis0.066667
crohn's disease0.066667
ulcerative colitis0.066667
periodontitis0.066667
LOWER IN periodontitis0.066667
Exp. ID User ID Description Date Region Flag Sequences
102amnon high in hiv infection compared to control in homo sapiens united states of america cheek atlanta mouth 2017-04-04v4No1 / 2
102amnon high in hiv infection compared to control in homo sapiens united states of america dentition atlanta mouth 2017-04-04v4No1 / 4
102amnon high in control compared to periodontitis in homo sapiens united states of america atlanta mouth 2017-04-04v4No1 / 7
102amnon high in control compared to hiv infection in homo sapiens united states of america cheek atlanta mouth 2017-04-04v4No1 / 15
102amnon high in control compared to hiv infection in homo sapiens united states of america dentition atlanta mouth 2017-04-04v4No1 / 18
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 22
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 37
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 38
102amnonlower in saliva compared to teeth, cheek ( high in cheek dentition compared to saliva in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 39
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
102amnon high in periodontitis compared to control in homo sapiens united states of america atlanta mouth 2017-04-04v4No1 / 53
102amnonhigher in teeth compared to cheeks, saliva ( high in dentition compared to saliva cheek in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 63
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to cheek dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 65
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162

Problems / suggestions? Please email info AT dbbact DOT org