Summary for ontology term: bacterial vaginosis

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTGTACCAAGTCAGCGGTGAAATACCTGTGCTTAACGCAGGCTGTGCCGTTGAAACTGGCATGCTAGAATACGGGAGCCGTGGGAGGAATGTGTGG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTCACTTAAGTCCATCTTAGAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAGACTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AerococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGGGCGCAGGCTGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAAGTGCATTGGAAACTGGGAAGCTTGAGTACAGAAGAGGAAAGTGGAACTCCATG0.500000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGATAGATAAGTCTCTTGTGAAATCTAATGGCTTAACCATTAAACTGCTTGGGAAACTATCTATCTAGAGTAGGGGAGAGGCAGATGGAATTCTTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__FinegoldiaTACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGCAGGCGGTTTAGAAAGTCTAATGTTAAAAATCGGGGCTCAACCCCGTAAAGCATTAGAAACTATTAAACTTGAGTAGTGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCTCGTAGGTGGCTGGTCAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGAAACTGATTAGCTTGAGTATAGGAGAGGTTAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__GardnerellaTACGTAGGGCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGCTTGTAGGCGGTTCGTCGCGTCTGGTGTGAAAGCCCATCGCTTAACGGTGGGTCTGCGCCGGGTACGGGCGGGCTAGAGTGCAGTAGGGGAAACTGGAATTCTCGG0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__SutterellaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCTGTAAGATGGGTGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTCATGACTGCAGGACTAGAGTTCACCAGAGGGGGGTGGAATTCCAAG0.500000
d__BacteriaTACGTAGGTCCCAAGCGTTATCCGGAGTGACTGGGCGTAAAGAGTTGCGTAGGCGGCTAAGTAAGCGAGTAATGAAAACTATCGGCTCAACCGGTAGCCTGTTATTCGAACTGCTTGGCTCGAGATTATCAGAGGTCGCTGGAATTCCTA0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTGATTAAGTCAGTGGTGAAAAGCTATGGCTCAACCATAGTCTTGCCGTTGATACTGGTTAGCTTGAGTGTAGATGATGTAGGCGGAACGTGTAG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__PeptococcusAACATAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGCAGGCGGTCTGTTAAGTCAGATGTGAAAGGTTAGGGCTCAACCCTGAACGTGCATCTGATACTGGCAGACTTGAGTATGGAAGAGGTAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGATTCTCAAGTTGGATGTGAAACCCCTTGGCTAAACTGAGGGCTTGCATTCAAAACTGAGGACCTTGAGTATCAGAGGGGAAAGTGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__MurdochiellaTACGTAGGGGGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGTACGTAGGCGGTTTGTTAAGTTTGGCGTTAAATCACGGGGCTCAACCCCGTTCAGCGTTGAAAACTGGCAAACTTGAGTAGTAGAGGGGACAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__AnaerococcusTACGTATGGACCGAGCGTTATCCGGAATCATTGGGCGTAAAGGGTACGTAGGCGGTTAAATAAGTTAGAAGTGAAATCCCATAGCTCAACTATAGTAAGCTTCTAAAACTGTATAACTTGAGAAATGAAAGGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__NegativicoccusTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCGCGTAGGCGGTATGATAAGTCTGTCTTAGAAGTGCGGGGCTTAACCCCGTGAGGGGACAGAGACTGTCATACTAGAGTCTCGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__NegativicoccusTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCGCGTAGGCGGTATGGTAAGTCTGTCTTAGAAGTGCGGGGCTTAACCCCGTGAGGGGACAGAGACTGTCATACTGGAGTCTCGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTCTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGAAGGGCATCGGAAACTGGATAACTTGAGTGCAAGAGAGGACAGTGGAACTCCATG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__AnaerococcusTACGTATGGACCGAGCGTTGTCCGGAATCATTGGGCGTAAAGGGTACGTAGGCGGCCTAGTAAGTTAGAAGTGAAATAATATAGCTCAACTATATAAAGCTTTTAAAACTGCAAGGCTTGAGAGATGGAAGGGAAAGTGGAATTCCTAGT0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTGTACCAAGTCAGCGGTGAAATACCTGTGCTTAACGCAGGCTGTGCCGTTGAAACTGGCATGCTAGAATACGGGAGCCGTGGGAGGAATGTGTGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AerococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGGGCGCAGGCTGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAAGTGCATTGGAAACTGGGAAGCTTGAGTACAGAAGAGGAAAGTGGAACTCCATG0.500000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGATAGATAAGTCTCTTGTGAAATCTAATGGCTTAACCATTAAACTGCTTGGGAAACTATCTATCTAGAGTAGGGGAGAGGCAGATGGAATTCTTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__FinegoldiaTACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGCAGGCGGTTTAGAAAGTCTAATGTTAAAAATCGGGGCTCAACCCCGTAAAGCATTAGAAACTATTAAACTTGAGTAGTGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCTCGTAGGTGGCTGGTCAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGAAACTGATTAGCTTGAGTATAGGAGAGGTTAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__SutterellaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCTGTAAGATGGGTGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTCATGACTGCAGGACTAGAGTTCACCAGAGGGGGGTGGAATTCCAAG0.500000
d__BacteriaTACGTAGGTCCCAAGCGTTATCCGGAGTGACTGGGCGTAAAGAGTTGCGTAGGCGGCTAAGTAAGCGAGTAATGAAAACTATCGGCTCAACCGGTAGCCTGTTATTCGAACTGCTTGGCTCGAGATTATCAGAGGTCGCTGGAATTCCTA0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTGATTAAGTCAGTGGTGAAAAGCTATGGCTCAACCATAGTCTTGCCGTTGATACTGGTTAGCTTGAGTGTAGATGATGTAGGCGGAACGTGTAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTGGGTTAAGTGTGTTGTGAAATGTAGATGCCCAACATCTGAATTGCAGCGCATACTGGTCCACTTGAGTGCGCGCAACGTAGGCGGAATTCGTCG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGTGGCGTGTCGCGTCTGCTGTGAAATTCCAGGGCTTAACTTTGGGATTGCAGTGGGTACGGGCATGCTAGAGTGCAGTAGGGGAGATTGGAATTCCTGG0.500000

Annotations:

common ontology terms
term enrichment score
TermScore
LOWER IN bacterial vaginosis0.500000
bacterial vaginosis0.500000
vagina0.166667
south africa0.125000
control0.010417
LOWER IN control0.010417
homo sapiens0.006897
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN bacterial vaginosis0.500000
bacterial vaginosis0.500000
vagina0.090909
south africa0.066667
control0.005263
LOWER IN control0.005263
homo sapiens0.003460
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
vagina1.000000
south africa1.000000
control0.500000
LOWER IN bacterial vaginosis0.500000
LOWER IN control0.500000
bacterial vaginosis0.500000

Problems / suggestions? Please email info AT dbbact DOT org