Summary for ontology term: bangladesh

Number of annotations with term: 11

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGG0.555556
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTG0.555556
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTG0.470588
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTAATAAGTCTGAAGTTAAAGGCAGTGGCTTAACCATTGTTCGCTTTGGAAACTGTTAGACTTGAGTGCAGAAGGGGAGAGTGG0.470588
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTG0.470588
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGCTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTG0.470588
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTA0.470588
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCG0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCG0.375000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__LactobacillaceaeTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGTAGTGCATTGGAAACTGGAAGACTTGAGTGCAGAAGAGGAGAGTG0.375000

Annotations:

common ontology terms
term enrichment score
TermScore
bangladesh1.000000
dhaka0.705882
diarrhea0.266667
LOWER IN diarrhea0.153846
1-year-old human stage0.107143
under-1-year-old human stage0.088235
infant stage0.083916
pathogen0.083333
LOWER IN 1-year-old human stage0.076923
infant0.071856
LOWER IN under-1-year-old human stage0.066667
homo sapiens0.014652
feces0.012658
adult0.011380
LOWER IN control0.010204
control0.010204
urban slum0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
bangladesh1.000000
dhaka1.000000
diarrhea0.500000
LOWER IN diarrhea0.500000
pathogen0.076923
1-year-old human stage0.066667
LOWER IN 1-year-old human stage0.066667
under-1-year-old human stage0.052632
LOWER IN under-1-year-old human stage0.052632
infant stage0.045455
infant0.038462
homo sapiens0.007380
feces0.006369
adult0.005780
LOWER IN control0.005405
control0.005405
urban slum0.000000
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
bangladesh1.000000
infant0.545455
dhaka0.545455
infant stage0.545455
urban slum0.545455
adult0.363636
1-year-old human stage0.272727
under-1-year-old human stage0.272727
diarrhea0.181818
pathogen0.090909
LOWER IN control0.090909
control0.090909
LOWER IN diarrhea0.090909
LOWER IN 1-year-old human stage0.090909
LOWER IN under-1-year-old human stage0.090909
Exp. ID User ID Description Date Region Flag Sequences
121amnoncausitive agent for acute diarrhea (other feces, homo sapiens, pathogen, bangladesh, diarrhea)2017-04-13v4No1 / 1
891amnondominant feces, homo sapiens, infant, bangladesh, dhaka, infant stage, under-1-year-old human stage, urban slum2022-04-03v4No1 / 7
891amnoncommon feces, homo sapiens, infant, bangladesh, dhaka, infant stage, under-1-year-old human stage, urban slum2022-04-03v4No1 / 8
891amnondominant feces, homo sapiens, infant, bangladesh, dhaka, infant stage, 1-year-old human stage, urban slum2022-04-03v4No1 / 14
121amnondominant feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 19
891amnoncommon feces, homo sapiens, infant, bangladesh, dhaka, infant stage, 1-year-old human stage, urban slum2022-04-03v4No1 / 25
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v4No1 / 42
121amnoncommon feces, homo sapiens, adult, bangladesh2017-04-13v4No1 / 50
121amnonhigh in diarrhea compared to recovery period ( high in diarrhea compared to control in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 162
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v4No1 / 363

Problems / suggestions? Please email info AT dbbact DOT org