Summary for ontology term: bangui

Number of annotations with term: 9

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__SolobacteriumTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCTGTTAAGTAAGTGGTTAAATTGTTGGGCTCAACCCAATCCAGCCACTTAAACTGGCAGGCTAGAGTATTGGAGAGGCAAGTGGAATTCCATGT0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAACAAGTCTGAAGTGAAAGCCCGGGGCTCAACCGCGGGACTGCTTTGGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.125000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGCGGTTTCTTAAGCGCGGGGTGAAAGGCAGTGGCTTAACCACTGTTAGCCCTGCGAACTGGGAGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.125000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTGTCAAGTCAGCGGTCAAAAGTCGGGGCTCAACCCCGTGAAGCCGTTGAAACTGGCGGTCTTGAGTGAGCGAGAAGTAGGCGGAATGCGTGGT0.125000
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTATTAAGTCTAAGATAAAAGCCCGAGGCTTAACCTCGGTTCGTCTTAGAAACTGGTAGACTTGAGTGCAGTAGAGGCAAGTGGAATTTCTAGT0.125000
d__BacteriaTACGTAGGTAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTAACAAGTTGGTAGTGAAATTCCGAAGCTTAACTTCGGCGCTACTACCAAGACTGTTGAACTTGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.125000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.125000
d__BacteriaAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.125000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGTTAAGCGTGTTGTGAAATGTCGTGGCTCAACCTGGGCATTGCAGCGCGAACTGGCAGACTTGAGTGCGCGGGAAGTAGGCGGAATTCGTCG0.125000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.666667
d__BacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGCTTTATAAGATAGCGGTGAAATACCTGGGCTTAACCTAGGAACTGCCGTTATTACTATAGAGCTAGAGTGATAGAGAGGATATTGGAATACCCAG0.666667
d__BacteriaTACGGAAGGTTCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACTTTTAAGTCAGCTGTGAAATCTGGCGGCTCAACCGTCAGACTGCAGTTGATACTGGAAGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTCAGGAAAGTCTGGAGTAAAAGGCTATGGCTCAACCATAGTGTGCTCTGGAAACTGTCTGACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGACAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGCCCGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.666667
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTATTAAGTCTGATGTGAAAGCCAATGGCCTAACCATTGAATTGCATTGGAAACTGGTAAACTAGAATACTGGAGAGGTAAGTGGAACTCCATG0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCGTTCTGAACTGGGTAACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.307692
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGATAGTCAGTCAGGTGTGAAATCCTATGGCTTAACCATAGAACTGCATTTGAAACTACTATTCTAGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.240000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAACAAGTCTGAAGTGAAAGCCCGGGGCTCAACCGCGGGACTGCTTTGGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.200000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTGTCAAGTCAGCGGTCAAAAGTCGGGGCTCAACCCCGTGAAGCCGTTGAAACTGGCGGTCTTGAGTGAGCGAGAAGTAGGCGGAATGCGTGGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.200000
d__BacteriaAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.200000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGTTAAGCGTGTTGTGAAATGTCGTGGCTCAACCTGGGCATTGCAGCGCGAACTGGCAGACTTGAGTGCGCGGGAAGTAGGCGGAATTCGTCG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGCATGCAAGTCAGATGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTTGAAACTGTGTGTCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG0.200000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGCCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGATGGCATGGCAAGTCTGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTGGAAACTGTCAAGCTTGAGTGCAGGAGGGGTAAGCGGAATTCCTAG0.200000

Annotations:

common ontology terms
term enrichment score
TermScore
bangui0.608696
central african republic0.466667
stunted growth0.400000
LOWER IN antananarivo0.307692
antananarivo0.307692
LOWER IN bangui0.307692
LOWER IN madagascar0.266667
madagascar0.266667
LOWER IN central african republic0.266667
duodenum0.150943
stomach0.076923
child0.054054
africa0.051282
homo sapiens0.007353
feces0.006324
Fraction of dbbact annotations with this term covered by the query
TermScore
bangui0.500000
LOWER IN antananarivo0.500000
antananarivo0.500000
LOWER IN bangui0.500000
stunted growth0.500000
central african republic0.333333
LOWER IN madagascar0.333333
madagascar0.333333
LOWER IN central african republic0.333333
duodenum0.090909
stomach0.058824
child0.027778
africa0.026316
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
child1.000000
africa1.000000
central african republic0.777778
bangui0.777778
feces0.444444
duodenum0.444444
stunted growth0.333333
LOWER IN madagascar0.222222
LOWER IN antananarivo0.222222
madagascar0.222222
antananarivo0.222222
LOWER IN central african republic0.222222
LOWER IN bangui0.222222
stomach0.111111

Problems / suggestions? Please email info AT dbbact DOT org