Summary for ontology term: barbacenia macrantha

Number of annotations with term: 10

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGCAGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGAGTGTGTAGGCGGCGGTTTAAGTCCCGTGTGAAATCTCCCTGGCTCAACCGGGAGGGTGCGCGGGAAACTGGAGCGCTCGAGCGTGGGCGAGGAAAGCGGAATTCCTG0.600000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGTTTATACAGTCAGATGTGAAATTCCTGGGCTCAACCTGGGGACTGCATTTGATACGTATGAACTTGAGTGGAGAAGAGGGTCGTGGAATTTCCAG0.588235
d__BacteriaTACGTAGAAGACTAGTGTTACTCATCTTTAATCGGTTTAAAGGGTACCTAGACAGAAAATCAAGCCTTAGAAACAAAAAAGGTACTAATTTTCTAGAGTTTTATGGAAGAATGTCGAATTACTAGAAGAGAGATAAAATTCATTGATACT0.555556
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaGACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTCAAGTCCGCCGTCAAATCCCAGGGCCCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAAGGGCAGAGGGAATTTCCGG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCGGACACAGTCGGATGTGAAATTCCCGGGCTTAACCTGGGGGCTGCATTCGATACGTGTTTGCTTGAGTGGGGAAGAGGGTCGTGGAATTCCCAG0.470588
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__SpirosomaTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTTTCTTAAGTCTGGTTTGAAAGCAGGCGGCTTAACCGTGTGATGTGGCTGGAAACTGGGGAACTTGAATGGGTTGGCGGCTGCCGGAACGGGTCA0.470588
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp3;g__Gp3TACGTAGGCAGCAAGCGTTGTTCGGAGTTACTGGGCGTAAAGAGTGGGTAGGCGGTGCTCTAAGTTTGGTGTGAAATCTCCCGGCTCAACTGGGAGGGTGCGCTAAAGACTGGAGTGCTTGAGTGTGGGAGAGGAAAGCGGAATTCCTGG0.444444
d__BacteriaTACGTAGAAGACTAGTGTTATTCATCTTTAATCGGTATAAAGGGTACCTAGACAGAATACCAAGCCATAATAGGTACTAGTATTCTAGAGTTTTATGTGAGAATATACGAATTACCAGAGTAGAGTCCAAATTCTGTTATACTGGTAGGA0.421053
d__BacteriaAACGGAGGGGGCTAGTGTTATTCGTGTTGACTGGGCGTAAAGGGTACGTAGGTGGCGAAGTGAGCTTTAAGTCAAAAACTGGCGTTGCGTCTTTTGGGCTTAACATTTTTTACTCCTTTGCTTGAGTTCTTAGGGCGATATTCGTATTCC0.421053
d__BacteriaTACGTAGAAGACTAGTGTTATTCATCTTTCCTGGGTATATAGGGTACCTAGACGGATAATCAAGCTTTAAATAAAGTACTAATTTTCTAGAGTTTTATGTGAAAAGATAGAATTATCTGAAGAGAGTTAAAATTCTTTGAAACAGGTGAA0.400000

Annotations:

common ontology terms
term enrichment score
TermScore
minas gerais state0.666667
campos rupestres0.666667
barbacenia macrantha0.666667
stem endosphere0.250000
root endosphere0.222222
leaf endosphere0.222222
leaf surface0.200000
stem0.166667
brazil0.100000
root0.100000
leaf0.085106
rhizosphere0.038462
Fraction of dbbact annotations with this term covered by the query
TermScore
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
stem endosphere0.333333
root endosphere0.250000
leaf endosphere0.250000
leaf surface0.200000
stem0.142857
root0.066667
brazil0.052632
leaf0.047619
rhizosphere0.021277
Fraction of annotations for the query sequences containing the term
TermScore
minas gerais state1.000000
campos rupestres1.000000
brazil1.000000
barbacenia macrantha1.000000
leaf0.400000
root endosphere0.200000
root0.200000
rhizosphere0.200000
leaf surface0.200000
stem0.200000
stem endosphere0.200000
leaf endosphere0.200000

Problems / suggestions? Please email info AT dbbact DOT org