Summary for ontology term: before hsct

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGGGGAAGATAATGACGGTACCCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTA0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAAGGAAGAAGTATCTCGGTATGTAAACTTCTATCAGCAGGGAAGATAGTGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.250000
d__BacteriaTGAGGGATATTGGGCAATGGGGGAAACCCTGACCCAGCAACGCCGCGTGAGGGATGACGGTTTTCGGATTGTAAACCTCTGTCCTCTGTGAAGATAGTGACGGTAGCAGAGGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.250000
d__BacteriaTGGGGAATATTGCGCAATGGGGGCAACCCTGACGCAGCAACGCCGCGTGCAGGAAGAAGGTCTTCGGATTGTAAACTGTTGTCGCAAGGGAAGAAGACAGTGACGGTACCTTGTGAGAAAGTCACGGCTAACTACGTGCCAGCAGCCGCG0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACATATGTGTAAGTAACTGTGCACATCTTGACGGTACCTAATCAGAAAGCCACGGC0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGTTAGAGAAGAACAGCGCATAGAGTAACTGTTATGCGTGTGACGGTATCTAACCAGAAAGCCACGGC0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGGATGAGAGTAACTGTTCATCCCTTGACGGTATCTAACCAGAAAGCCACGGC0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCGCAATGGGGGCAACCCTGACGCAGCAACGCCGCGTGATTGAAGAAGGCCTTCGGGTTGTAAAGATCTTTAATCAGGGACGAAAAATGACGGTACCTGAAGAATAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGT0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCTCATGGTCAAGCCGCAACAATGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGTGCTAGAGTAACTGTTAGCGCCTTGACGGTATCTAACCAGAAAGCCACGGC0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGGACGTTAGTAACTGAACGTCCCCTGACGGTATCTAACCAGAAAGCCACGGC0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTGGGGAATCTTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGCGGGATGAAGGCCTTCGGGTTGTAAACCGCTTTCAGCAGGGACGAGGCGAAAGTGACGGTACCTGCAGAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTGTTAGCATCGAAGAAGCGAAAGTGACGGTAGGTGCAGAGAAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTACGGGACGAATCATGACGGTACCGTACAAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGT0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTTAGGGACGAAAATTGACGGTACCTAACAAGAAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGT0.181818
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCATTTTTTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.125000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCGTTAGGGACGAATTCTGACGGTACCTAACAAGAAAGCACCGGCTAACTACGTGCCAGCAGCCGCGGT0.125000
d__Bacteria;p__FirmicutesTAGGGAATTTTCGGCAATGGGCGAAAGCCTGACCGAGCAACGCCGCGTGAAGGAAGAAGTCATTCGTGATGTAAACTTCTGTTATGAAGGAAGAACGGCAGATGGAGGGAATGCCATGTGCGTGACGGTACTTCATGAGGAAGCCACGGC0.095238
d__Bacteria;p__FirmicutesTGGGGAATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAGGGAAGAAGGTCTTCGGATTGTAAACCTCTGTTGTCAGGGACGATGATGACGGTACCTGACGAGGAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTA0.086957
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGGATATTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGAAGGATGAAGGTCTTCGGATTGTAAACTTCTTTTATTAAGGACGAAGAAAGTGACGGTACTTAATGAATAAGCTCCGGCTAACTACGTGCCAGCAGCCGCG0.086957
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITAGGGAATTTTCGGCAATGGGGGAAACCCTGACCGAGCAACGCCGCGTGAAGGAAGAAGGTTTTCGGATTGTAAACTTCTGTTATAAAGGAAGAACGGCGGCTACAGGAAATGGTAGCCGAGTGACGGTACTTTATTAGAAAGCCACGGC0.086957
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTACTCATTGACGTTACCCGCAGAAGAAGCACCGGC0.080000
d__BacteriaTGAGGGATATTGGTCAATGGGGGAAACCCTGAACCAGCAACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTGTCCTCTGTGAAGATAATGACGGTAGCAGAGGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.054054

Annotations:

common ontology terms
term enrichment score
TermScore
before hsct0.600000
LOWER IN after hcst0.333333
LOWER IN hematopoietic stem cell transplant0.333333
after hcst0.333333
hematopoietic stem cell transplant0.333333
LOWER IN before hsct0.333333
italy0.095238
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
before hsct0.500000
LOWER IN after hcst0.500000
LOWER IN hematopoietic stem cell transplant0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
LOWER IN before hsct0.500000
italy0.050000
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
italy1.000000
before hsct0.750000
LOWER IN after hcst0.250000
LOWER IN hematopoietic stem cell transplant0.250000
after hcst0.250000
hematopoietic stem cell transplant0.250000
LOWER IN before hsct0.250000

Problems / suggestions? Please email info AT dbbact DOT org