Summary for ontology term: biopsy

Number of annotations with term: 45

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaCACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACACACAAT0.069767
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CloacibacteriumTACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGACTTATAAGTCAGTGGTGAAAGCCTGTCGCTTAACGATAGAACTGCCATTGATACTGTAAGTCTTGAGTATATTTGAGGTAGCTGGAATAAGTAG0.046512
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGCGTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG0.046512
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.046512
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGAAGGCTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGGTCATCTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.046512
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGTCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.046512
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.046512
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACGAGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.023256
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCATG0.023256
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCTTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTTAGCCTCCGAAACTGGAAGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.023256

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__FirmicutesTACGTAGATGGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGATCATAAGTTGCGTGTGAAATGCAGGGGCTCAACCCCTGAACTGCGCGCAAAACTGTGGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__ParvimonasTACGTATGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGTAGGCGGTCTATTAAGTCAGGTGTGAAAGCGTGAGGCTTAACCTCATTAAGCACTTGAAACTGATAGACTTGAGTGAAGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptoniphilaceae;g__PeptoniphilusTACGTAGGGGGCTAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTTCGCAGGCGGCAATGCAAGTCAGATGTAAAAGGCAAAGGCTCAACCTTTGTAAGCATCTGAAACTGTATAGCTTGAGAAGTGTAGAGGCAAGTGGAATTTTTAGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGTGGTCCTGCAAGTCAGTGGTGAAAAGCTGAGGCTCAACCTCAGCCTTGCCGTTGAAACTGCAAGACTTGAGAGTACATGATGTGGGCGGAATGCGTAG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGTCTATTAAGCGTGTTGTGAAATTTACCGGCTCAACCGGTGGCTTGCAGCGCGAACTGGTCGACTTGAGTATGCAGGAAGTAGGCGGAATTCATGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTGATAAACCTTTAGCAATAAACCAAAGTTTAACTAAGCCATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAGAAACCGGCATAAAGAGTGTTTTAGATCAATTCCCCTCAATAAA0.406780
d__BacteriaTGATAAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCTAGGGTTCGTCAAGTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAGAAACCGGCGTAAAGAGTGTTTTAGATCAATTCCCCTCAATAAA0.393443
d__BacteriaTGATAAACCTTTAGCAATAAACGAAAGTTTAACTGAGCTATACTAACTTTAGGGTTGGTTAATTTCATGCCAGCCACCACGGTCATACGATGAACCCAAGCTAATAGAGACTGGCGTAAAGAATGTTTTACATTATCCCTCAATAAAGCT0.333333
d__BacteriaTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAA0.270270
d__BacteriaTGATAAACCTTTAGCAATAAACCAAAGTTTAAGCCATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAGAAACCGGCATAAAGAGTGTTTTAGATCAATTCCCCTCAATAAAGCTA0.208333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATCTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGGATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.181818
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGCTAGCCTGAACCAGCCAAGTAGCGTGAAGGATGAAGGCTCTATGGGTCGTAAACTTCTTTTATATAAGAATAAAGTGCAGTATGTATACTGTTTTGTATGTATTATATGAATAAGGATCGGCTAACT0.177778
GCACTACAGTGCTATGGCCCTTCACTTTTTTCCTGGCGGACGAGCATCTGTGATCGATGCTCCCGGGAAGAGATTCCACCATCCTGGCCCTTGGGCCCTATCCAAAGTTGCCTTCTCTGCCAGAGTTCCAGGGAAGGCTATGTTTAATAG0.173913
d__BacteriaTGATAAACCTTTAGCAATAAACGAAAGTTTAACTAAACTATACTAACACCCAGCGTTGGTTAATTTCATGCCAGCCACCGCAGCCATACGATTAACCCAAGCTAATAGAACCCAGCTTAAAGAGTGTTTTAGATCTGTTCTCAATAAAGC0.166667

Annotations:

common ontology terms
term enrichment score
TermScore
biopsy0.965517
large intestine0.448276
biopsy site0.417112
ulcerative colitis0.286517
rectum0.269663
ireland0.236364
sigmoid colon0.210526
terminal ileum0.210526
LOWER IN ulcerative colitis0.185841
mucosa of stomach0.181818
crohn's disease0.166667
children0.150943
intestinal mucosa0.133333
LOWER IN crohn's disease0.125000
LOWER IN biopsy site0.122449
LOWER IN biopsy0.113208
helicobacter pylori infectious disease0.111111
colon0.105263
left colon0.105263
right colon0.100000
south korea0.086957
stomach0.076923
homo sapiens0.046847
human adult stage0.043478
LOWER IN luminal content0.042553
luminal content0.042553
severe0.042553
LOWER IN mild0.042553
mild0.042553
LOWER IN severe0.042553
helicobacter pylori0.042553
LOWER IN left colon0.040816
LOWER IN right colon0.040000
child0.039801
caecum0.037559
germany0.036697
LOWER IN rectum0.035714
pathogen0.034483
adult0.031228
united states of america0.029851
control0.029003
LOWER IN control0.018182
feces0.015385
LOWER IN feces0.015385
china0.010309
Fraction of dbbact annotations with this term covered by the query
TermScore
biopsy1.000000
large intestine1.000000
LOWER IN biopsy site0.750000
biopsy site0.750000
sigmoid colon0.500000
terminal ileum0.500000
children0.500000
LOWER IN luminal content0.500000
luminal content0.500000
severe0.500000
LOWER IN mild0.500000
mild0.500000
LOWER IN severe0.500000
mucosa of stomach0.500000
helicobacter pylori0.500000
LOWER IN biopsy0.375000
helicobacter pylori infectious disease0.333333
rectum0.272727
left colon0.250000
LOWER IN left colon0.250000
ulcerative colitis0.230769
LOWER IN ulcerative colitis0.230769
ireland0.200000
LOWER IN right colon0.200000
right colon0.200000
intestinal mucosa0.166667
crohn's disease0.142857
LOWER IN crohn's disease0.142857
LOWER IN rectum0.090909
colon0.086957
pathogen0.076923
south korea0.071429
stomach0.058824
germany0.031250
human adult stage0.027027
child0.025641
homo sapiens0.024221
caecum0.023810
adult0.016129
control0.015789
united states of america0.015444
LOWER IN control0.010526
feces0.008696
LOWER IN feces0.008696
china0.005405
Fraction of annotations for the query sequences containing the term
TermScore
biopsy0.933333
homo sapiens0.711111
adult0.488889
united states of america0.444444
ulcerative colitis0.377778
large intestine0.288889
ireland0.288889
biopsy site0.288889
rectum0.266667
crohn's disease0.200000
control0.177778
LOWER IN ulcerative colitis0.155556
sigmoid colon0.133333
terminal ileum0.133333
colon0.133333
LOWER IN crohn's disease0.111111
intestinal mucosa0.111111
human adult stage0.111111
china0.111111
south korea0.111111
mucosa of stomach0.111111
stomach0.111111
caecum0.088889
children0.088889
child0.088889
LOWER IN control0.066667
feces0.066667
LOWER IN biopsy site0.066667
LOWER IN biopsy0.066667
LOWER IN feces0.066667
left colon0.066667
right colon0.066667
helicobacter pylori infectious disease0.066667
germany0.044444
LOWER IN luminal content0.022222
luminal content0.022222
LOWER IN right colon0.022222
LOWER IN left colon0.022222
LOWER IN rectum0.022222
severe0.022222
LOWER IN mild0.022222
mild0.022222
LOWER IN severe0.022222
helicobacter pylori0.022222
pathogen0.022222
Number of experiments associating the term to the sequence
TermScore
biopsy8.000000
homo sapiens7.000000
united states of america4.000000
ulcerative colitis3.000000
adult3.000000
rectum3.000000
control3.000000
feces3.000000
LOWER IN biopsy site3.000000
LOWER IN biopsy3.000000
biopsy site3.000000
LOWER IN feces3.000000
LOWER IN ulcerative colitis3.000000
sigmoid colon2.000000
terminal ileum2.000000
colon2.000000
LOWER IN control2.000000
crohn's disease2.000000
LOWER IN crohn's disease2.000000
germany1.000000
large intestine1.000000
ireland1.000000
caecum1.000000
children1.000000
LOWER IN luminal content1.000000
luminal content1.000000
left colon1.000000
LOWER IN right colon1.000000
right colon1.000000
LOWER IN left colon1.000000
child1.000000
LOWER IN rectum1.000000
intestinal mucosa1.000000
human adult stage1.000000
china1.000000
severe1.000000
LOWER IN mild1.000000
mild1.000000
LOWER IN severe1.000000
south korea1.000000
mucosa of stomach1.000000
stomach1.000000
helicobacter pylori infectious disease1.000000
helicobacter pylori1.000000
pathogen1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
409amnon high in right colon compared to left colon in homo sapiens united states of america colon biopsy biopsy site 2018-11-22v41 / 1approvedNo
569amnonHelicobacter pylori pathogen (other homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori, pathogen, helicobacter pylori infectious disease)2019-12-16v31 / 1approvedNo
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v41 / 5approvedNo
569amnonhigh freq. in gastric biopsies of patients positive for h. pylori (dominant homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v31 / 5approvedNo
856amnon high in control compared to ulcerative colitis ulcerative colitis in rectum intestinal mucosa human adult stage adult china biopsy homo sapiens 2022-01-09v31 / 6approvedNo
569amnonhigh freq. in gastric biopsies of patients negative for h. pylori (dominant homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v31 / 9approvedNo
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v41 / 14approvedNo
409amnon high in left colon compared to right colon in homo sapiens united states of america colon biopsy biopsy site 2018-11-22v41 / 15approvedNo
409amnondominant homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v41 / 15approvedNo
19amnonhigh freq in biopsies of children (IBD study) (dominant rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v41 / 16approvedNo
51amnondominant homo sapiens, biopsy site, biopsy, united states of america2017-01-19v41 / 16approvedNo
944amnondominant large intestine, biopsy, adult, ireland, control2022-11-26v31 / 18approvedNo
944amnondominant ireland, adult, biopsy, large intestine, crohn's disease, crohn's disease2022-11-26v31 / 19approvedNo
409amnondominant homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v41 / 20approvedNo
944amnondominant ulcerative colitis, ulcerative colitis, large intestine, biopsy, adult, ireland2022-11-26v31 / 20approvedNo
944amnon high in crohn's disease crohn's disease compared to ulcerative colitis ulcerative colitis in large intestine biopsy adult ireland 2022-11-26v31 / 22approvedNo
856amnondominant human adult stage, china, intestinal mucosa, biopsy, adult, rectum, control, homo sapiens2022-01-09v31 / 23approvedNo
714amnondominant germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v31 / 25approvedNo
856amnondominant human adult stage, china, ulcerative colitis, intestinal mucosa, biopsy, adult, ulcerative colitis, rectum, homo sapiens2022-01-09v31 / 25approvedNo
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v41 / 26approvedNo
944amnoncommon crohn's disease, crohn's disease, large intestine, biopsy, adult, ireland2022-11-26v31 / 27approvedNo
856amnoncommon ulcerative colitis, ulcerative colitis, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v31 / 33approvedNo
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v41 / 34approvedNo
51amnoncommon homo sapiens, biopsy site, biopsy, united states of america2017-01-19v41 / 36approvedNo
944amnon high in ulcerative colitis ulcerative colitis compared to crohn's disease crohn's disease in ireland adult biopsy large intestine 2022-11-26v31 / 36approvedNo
51amnonhigher in stool compared to biopsies ( high in feces compared to biopsy site biopsy in homo sapiens united states of america )2017-01-19v41 / 37approvedNo
944amnoncommon ulcerative colitis, ulcerative colitis, large intestine, biopsy, adult, ireland2022-11-26v31 / 38approvedNo
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy biopsy site compared to feces luminal content in homo sapiens united states of america )2018-11-22v41 / 38approvedNo
944amnoncommon ireland, adult, biopsy, large intestine, ulcerative colitis, ulcerative colitis2022-11-26v31 / 38approvedNo
714amnoncommon germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v31 / 40approvedNo
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v41 / 40approvedNo
409amnonlower in colon biopsies compared to stool and luminal content ( high in feces luminal content compared to biopsy biopsy site in homo sapiens united states of america )2018-11-22v41 / 42approvedNo
856amnoncommon control, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v31 / 48approvedNo
944amnon high in crohn's disease crohn's disease compared to control in large intestine biopsy adult ireland 2022-11-26v31 / 54approvedNo
944amnoncommon control, ireland, adult, biopsy, large intestine2022-11-26v31 / 57approvedNo
944amnon high in ulcerative colitis ulcerative colitis compared to control in large intestine biopsy adult ireland 2022-11-26v31 / 60approvedNo
569amnoncommon in gastric biopsies of patients positive for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy, helicobacter pylori infectious disease)2019-12-16v31 / 77approvedNo
569amnoncommon in gastric biopsies of patients negative for h. pylori (common homo sapiens, south korea, mucosa of stomach, stomach, biopsy)2019-12-16v31 / 85approvedNo
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v41 / 97approvedNo
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v41 / 118approvedNo
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v41 / 118approvedNo
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v41 / 126approvedNo
944amnon high in control compared to ulcerative colitis ulcerative colitis in ireland adult biopsy large intestine 2022-11-26v31 / 199approvedNo
944amnon high in control compared to crohn's disease crohn's disease in ireland adult biopsy large intestine 2022-11-26v31 / 256approvedNo
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v41 / 459approvedNo

Problems / suggestions? Please email info AT dbbact DOT org