Summary for ontology term: biopsy site

Number of annotations with term: 16

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaCACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACACACAAT0.214286
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CloacibacteriumTACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGACTTATAAGTCAGTGGTGAAAGCCTGTCGCTTAACGATAGAACTGCCATTGATACTGTAAGTCTTGAGTATATTTGAGGTAGCTGGAATAAGTAG0.142857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGCGTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG0.142857
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.142857
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGAAGGCTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGGTCATCTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.142857
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGTCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.142857
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.142857
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACGAGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.071429
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCATG0.071429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCTTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTTAGCCTCCGAAACTGGAAGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.071429

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__FirmicutesTACGTAGATGGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGATCATAAGTTGCGTGTGAAATGCAGGGGCTCAACCCCTGAACTGCGCGCAAAACTGTGGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__ParvimonasTACGTATGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGTAGGCGGTCTATTAAGTCAGGTGTGAAAGCGTGAGGCTTAACCTCATTAAGCACTTGAAACTGATAGACTTGAGTGAAGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptoniphilaceae;g__PeptoniphilusTACGTAGGGGGCTAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTTCGCAGGCGGCAATGCAAGTCAGATGTAAAAGGCAAAGGCTCAACCTTTGTAAGCATCTGAAACTGTATAGCTTGAGAAGTGTAGAGGCAAGTGGAATTTTTAGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATACGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGTGGTCCTGCAAGTCAGTGGTGAAAAGCTGAGGCTCAACCTCAGCCTTGCCGTTGAAACTGCAAGACTTGAGAGTACATGATGTGGGCGGAATGCGTAG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCTGTCTATTAAGCGTGTTGTGAAATTTACCGGCTCAACCGGTGGCTTGCAGCGCGAACTGGTCGACTTGAGTATGCAGGAAGTAGGCGGAATTCATGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGCCCTGTAAGTCAGCGGTGAAATCTTCCAGCTCAACTGGGAAACTGCCGTTGATACTGCAGGGCTTGAATTGCCGGGAAGTAACTAGAATATGTAG0.222222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGG0.200000
d__Bacteria;p__FirmicutesTACGTATGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTGGCTTAAGCGCAGGGTTTAAGGCAATGGCTTAACTATTGTTCGCCTTGCGAACTGGGTCACTTGAGTACAGGAGAGGAAAGCGGAATTCCTAGT0.193548
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptoniphilaceae;g__PeptoniphilusTACGTAGGGGGCTAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTTCGCAGGCGGCAATGCAAGTCAGATGTAAAAGGCAAAGGCTCAACCTTTGTAAGCATCTGAAACTGTATAGCTTGAGAAGTGTAGAGGCAAGTGGAATTTTTAGT0.181818
d__BacteriaTACGGAAGGTCCGGGTGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACTGCCTGTCAAGCGTGCAGTGAAACGCCGCGGCCCAACCGCGGCCCTGCTGCGCGAACTGGCGGGCTTGAGTGGGCTGGAGGCACGCGGAATTCGTGG0.166667
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGGGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTTTTGTGAAATCTAGTGGCTTAACCACTAAACTGCTTAGGAAACTGATAGTCTAGAGTAGGGGAGAGGTAGATGGAATTCTTGG0.166667
d__BacteriaAACTAACGATCGCCTACTGGGGAGCAGAGTTTCTACCCAGAAGAGGAAACACAGCTGCTATATACAGTTGCGCAGGGCGTGCACTGCACAAGGGCCCCTCCCATCTCTTTTCATACTGCAGATTTGTATGTTGTGAATGAAATTGTCCAG0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__AnaerococcusTACGTATGGACCGAGCGTTGTCCGGAATCATTGGGCGTAAAGGGTACGTAGGCGGCCTAGTAAGTTAGAAGTGAAATAATATAGCTCAACTATATAAAGCTTTTAAAACTGTTAGGCTTGAGAGATGAAAGGGAAAGTGGAATTCCTAGT0.150000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCAGGTAAGCGTGTTGTGAAATGTACCGGCTCAACCGGTGAATTGCAGCGCGAACTGTCTGGCTTGAGTGCACGGTAAGCAGGCGGAATTCATGG0.146341
d__BacteriaCACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACACACAAT0.145833

Annotations:

common ontology terms
term enrichment score
TermScore
biopsy site0.780000
biopsy0.513158
LOWER IN biopsy site0.300000
LOWER IN biopsy0.250000
left colon0.214286
right colon0.193548
colon0.181818
ulcerative colitis0.150000
rectum0.122449
LOWER IN luminal content0.111111
luminal content0.111111
severe0.111111
LOWER IN mild0.111111
mild0.111111
LOWER IN severe0.111111
LOWER IN left colon0.100000
LOWER IN right colon0.095238
LOWER IN ulcerative colitis0.083333
LOWER IN rectum0.074074
child0.050000
united states of america0.024000
homo sapiens0.021898
LOWER IN feces0.018182
feces0.018182
adult0.011299
Fraction of dbbact annotations with this term covered by the query
TermScore
biopsy site0.750000
LOWER IN biopsy site0.750000
LOWER IN luminal content0.500000
luminal content0.500000
severe0.500000
LOWER IN mild0.500000
mild0.500000
LOWER IN severe0.500000
biopsy0.375000
LOWER IN biopsy0.375000
colon0.333333
left colon0.250000
LOWER IN left colon0.250000
LOWER IN right colon0.200000
right colon0.200000
ulcerative colitis0.125000
LOWER IN ulcerative colitis0.125000
LOWER IN rectum0.090909
rectum0.090909
child0.027778
united states of america0.012146
homo sapiens0.011070
LOWER IN feces0.009554
feces0.009554
adult0.005780
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
united states of america1.000000
biopsy site0.812500
biopsy0.812500
adult0.250000
child0.250000
LOWER IN feces0.187500
feces0.187500
LOWER IN biopsy site0.187500
LOWER IN biopsy0.187500
left colon0.187500
right colon0.187500
ulcerative colitis0.187500
rectum0.187500
colon0.125000
LOWER IN luminal content0.062500
luminal content0.062500
LOWER IN right colon0.062500
LOWER IN left colon0.062500
LOWER IN rectum0.062500
severe0.062500
LOWER IN mild0.062500
mild0.062500
LOWER IN severe0.062500
LOWER IN ulcerative colitis0.062500
Exp. ID User ID Description Date Region Flag Sequences
409amnon high in right colon compared to left colon in homo sapiens united states of america colon biopsy site biopsy 2018-11-22v4No1 / 1
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 5
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
409amnon high in left colon compared to right colon in homo sapiens united states of america colon biopsy site biopsy 2018-11-22v4No1 / 15
409amnondominant homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 15
51amnondominant homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 16
409amnondominant homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 20
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 26
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
51amnonhigher in stool compared to biopsies ( high in feces compared to biopsy site biopsy in homo sapiens united states of america )2017-01-19v4No1 / 37
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy site biopsy compared to feces luminal content in homo sapiens united states of america )2018-11-22v4No1 / 38
409amnonlower in colon biopsies compared to stool and luminal content ( high in feces luminal content compared to biopsy site biopsy in homo sapiens united states of america )2018-11-22v4No1 / 42
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126

Problems / suggestions? Please email info AT dbbact DOT org