Summary for ontology term: bird

Number of annotations with term: 94

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.010638
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.010638
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTGGTCGCGTCTGCTGTGAAAGGCTGGGGCTTAACCCTGGTTTTGCAGTGGGTACGGGCTAACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.010638
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.010638
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.010638
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__SphingobacteriaceaeTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCCTGTTAAGTCAGGGGTGAAAGACGGTAGCTCAACTATCGCAGTGCCCTTGATACTGATGGGCTTGAATAAACTAGAGGTAGGCGGAATGTGACA0.010638
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.010638
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.010638
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTATTAAGTCAGTGGTGAAAGACGGTGGCTCAACCATCGTTAGCCATTGAAACTGGTAGTCTTGAGTGCAGACAGGGATGCTGGAACTCGTGGT0.010638
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.010638

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAATCCCGAGGCTCAACCTCGGGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGTTAAGTCGGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTCGAAACTGGCGATCTTGAGTCCGGGAGAGGTGAGTGGAACTGCGAG0.500000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Chitinophagaceae;g__TaibaiellaTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGTGTAGGCGGGCTATTAAGTCTGGGGTGAAATCTCCGAGCTCAACTCGGAAACTGCCTTGGATACTATTAGCCTTGAATTATGTTGAGGTTGGCGGAATATAACA0.500000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGTGTAGGTGGTTGGGAAAGTCAATTGTGAAATCCCCGGGCTTAACTCGGGAACTGCTTTTGATACTGTCTGACTAGAATTCGGTAGAGGGAGGCGGAACTCCAGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Nakamurellaceae;g__NakamurellaTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTCTGTCGCGTCGAATGTGAAAACCCGGGGCTCAACCCCGGGCCTGCATTCGATACGGGCAGACTAGAGTTCGGTAGGGGAGTCTGGAATTCCTGG0.500000
d__BacteriaTACGGGTGGTGCAAGTGTTACTCCTCTTGACTCGGTGTAAAGGGTGCGTAGATTGAAAAGAAGGTTTTAACTTAACTGAGAATGATTTTTTTACCTCTTTTCTAGAGTTTGAAAGACGATCATGGAACTTCCTGCATTAGGGTTAAAATC0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhizobiaceae;g__KaistiaTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGATTGTTAAGTGAGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTTTCATACTGGCAATCTTGAGTCCGGGAGAGGTGAGTGGAACTCCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Acetobacteraceae;g__AcidocellaTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCGTACACAGTCAGAAGTGAAATTCCTGGGCTCAACCTGGGGACTGCTTTTGATACGTGTGTGCTAGAGTGAGGAAGAGGGTTGTGGAATTTCCAG0.500000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGTGGACGATTAAGTCAGAGGTGAAATCCTGCAGCTCAACTGTAGAATTGCCTTTGATACTGGTTGTCTTGAATCATTGTGAAGTGGTTAGAATATGTGG0.500000
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__ProsthecobacterTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGGGTGCGTAGGTGGCGTGGAAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATTGCATCCGATACTACCATGCTAGAGTACTGAAGAGGTGACTAGAATTCTCGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCCTTTAAGTCCATCTTAAAAGCGTGGGGCTCAACCCCATGAGGGGATGGAAACTGGAGAGCTGGAGTATCGGAGAGGAAAGCGGAATTCCTGGT0.224299
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGATGTGCATTGGAAACTGGAAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.211382
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGCGTGTGTAGACGGTTTAAGAAGTCTTGTGTCAAATGGTTGGGCTTAACCCAATCCCGCACAAGAAACTCTTATGACTAGAGTTTGGTAGAGGCAAGTGGAATTCCATG0.207547
d__BacteriaTACGTATGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCTCGGTAAGCCAGGTGTCAAAGCCCGGGGCTCAACCCCGGCCCGCACCTGGAACTGCCTTGCTTGAGTCTGGTAGGGGAAAGTGGAATTCCCAGT0.207547
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGACGGGATGGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGTCATCCTTGAGTGCGGCAGAGGCAGGCGGAATTCGTGG0.190476
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGTGGCTTGTCGCGTCTGTCGTGAAATTCCCGGGCTTAACTGGGGAAGTGCGGTGGGTACGGGCAGGCTTGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.190476
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGCCCTTTAAGTCAGCTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGGGGCTTGAGTACGGTCGCGGCATGCGGAATTCGTGG0.190476
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGTCCGTTAGGTCGGGAGTCAAATCCGGGGGCTCAACCCCCGCCCGCTCCCGATACCGGCGGACTTGAGTTTGGTAGGGGAAGGCGGAATTCCGAGT0.190476
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGATGCAAGTTGAATGTTAAAGCCAGGGGCTTAACCCCTGAGAGCGTTCAAAACTGCATTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.190476
d__BacteriaTACGTAGGTTGCAAGCGTTATCCGGAATCATTGGGCGTAAAGAGTGAGCAGGCGGCCCGGTAAGCCCGGGGTGAAATGCGGGGGCTCAACCCCCGCAGGTCCCGGGCACTGCCGGGCTAGGGTGCGGGAGAGGCGAGTGGAACTCCGCGT0.190476

Annotations:

common ontology terms
term enrichment score
TermScore
bird1.035636
centrocercus urophasianus0.298507
greater sage-grouse0.298507
state of wyoming0.298507
finch0.203390
bon portage island0.203390
captive0.198511
oceanodroma leucorhoa0.189655
seabird0.189655
galapagos islands0.184615
anser cygnoides0.175439
goose0.113208
swan goose0.113208
california condor0.113208
gymnogyps californianus0.113208
pet0.113208
state of idaho0.107143
burrow0.096154
canada0.092105
caecum0.091603
cloacal swab0.081633
takahe0.081633
porphyrio hochstetteri0.081633
canary0.081633
serinus canaria0.081633
fayetteville township0.081633
japanese quail0.081633
coturnix japonica0.081633
mexico0.081081
municipality of chongqing0.078431
sichuan white goose0.078431
state of arkansas0.078431
gizzard0.078431
age 70 days0.075472
qinghai province0.071429
feces0.070282
new zealand0.070175
cecal content0.065574
commonwealth of massachusetts0.061538
winter0.060606
brood patch0.060000
crop0.060000
male organism0.059701
uropygial gland0.058252
summer0.056338
mongolia0.055046
duodenum0.054795
china0.053908
cloaca0.049587
coats island0.041667
thick-billed murres0.041667
uria lomvia0.041667
deqing county0.041667
crested ibis0.041667
nipponia nippon0.041667
pygoscelis papua0.040816
gentoo penguin0.040816
geospiza difficilis0.040816
sharp-beaked ground finch0.040816
geospiza fuliginosa0.040816
small ground finch0.040816
green warbler-finch0.040816
certhidea olivacea0.040816
camarhynchus parvulus0.040816
small tree finch0.040816
geospiza fortis0.040816
medium ground finch0.040816
geospiza scandens0.040816
common cactus finch0.040816
strix varia0.040816
barred owl0.040816
red-tailed hawk0.040816
buteo jamaicensis0.040816
isla de salvora0.040816
age 8 days0.040816
larus michahellis0.040816
gull0.040816
himalayan griffon0.040816
gyps himalayensis0.040816
hirundo rustica0.040816
barn swallow0.040816
melopsittacus undulatus0.040816
parakeet0.040816
nymphicus hollandicus0.040816
cockatiel0.040816
greylag goose0.040816
LOWER IN gizzard0.040816
dalian city prefecture0.040000
anser0.038462
colon0.036810
state of colorado0.035714
LOWER IN winter0.035398
LOWER IN summer0.033898
LOWER IN duodenum0.033333
adult organism0.032787
zoological garden0.032258
united states of america0.029462
kingdom of spain0.029412
italy0.028986
LOWER IN caecum0.022472
Fraction of dbbact annotations with this term covered by the query
TermScore
bird1.142857
cloacal swab1.000000
coats island1.000000
thick-billed murres1.000000
uria lomvia1.000000
takahe1.000000
porphyrio hochstetteri1.000000
LOWER IN feed supplement diet1.000000
wild diet1.000000
LOWER IN wild diet1.000000
feed supplement diet1.000000
canary1.000000
serinus canaria1.000000
fayetteville township1.000000
japanese quail1.000000
coturnix japonica1.000000
LOWER IN low stress responsive1.000000
high stress responsive1.000000
LOWER IN high stress responsive1.000000
low stress responsive1.000000
deqing county1.000000
crested ibis1.000000
nipponia nippon1.000000
pygoscelis papua0.500000
gentoo penguin0.500000
municipality of chongqing0.500000
anser cygnoides0.500000
sichuan white goose0.500000
goose0.500000
LOWER IN yeast supplemented diet0.500000
LOWER IN yeast (food source)0.500000
yeast (food source)0.500000
yeast supplemented diet0.500000
finch0.500000
geospiza difficilis0.500000
sharp-beaked ground finch0.500000
geospiza fuliginosa0.500000
small ground finch0.500000
green warbler-finch0.500000
certhidea olivacea0.500000
camarhynchus parvulus0.500000
small tree finch0.500000
geospiza fortis0.500000
medium ground finch0.500000
geospiza scandens0.500000
common cactus finch0.500000
swan goose0.500000
oceanodroma leucorhoa0.500000
seabird0.500000
bon portage island0.500000
brood patch0.500000
LOWER IN brood patch0.500000
burrow0.500000
deep burrow0.500000
LOWER IN surface burrow0.500000
surface burrow0.500000
LOWER IN deep burrow0.500000
LOWER IN seabird0.500000
LOWER IN oceanodroma leucorhoa0.500000
LOWER IN burrow0.500000
strix varia0.500000
barred owl0.500000
red-tailed hawk0.500000
buteo jamaicensis0.500000
california condor0.500000
gymnogyps californianus0.500000
isla de salvora0.500000
age 8 days0.500000
larus michahellis0.500000
gull0.500000
himalayan griffon0.500000
gyps himalayensis0.500000
hirundo rustica0.500000
barn swallow0.500000
state of arkansas0.500000
melopsittacus undulatus0.500000
parakeet0.500000
pet0.500000
nymphicus hollandicus0.500000
cockatiel0.500000
greylag goose0.500000
centrocercus urophasianus0.500000
greater sage-grouse0.500000
state of wyoming0.500000
gizzard0.500000
crop0.500000
LOWER IN gizzard0.500000
LOWER IN crop0.500000
dalian city prefecture0.333333
age 70 days0.333333
galapagos islands0.333333
LOWER IN uropygial gland0.333333
uropygial gland0.333333
state of idaho0.333333
captive0.238095
qinghai province0.222222
mongolia0.200000
LOWER IN mongolia0.200000
new zealand0.200000
anser0.200000
Fraction of annotations for the query sequences containing the term
TermScore
bird0.946809
feces0.521277
united states of america0.319149
centrocercus urophasianus0.212766
greater sage-grouse0.212766
state of wyoming0.212766
captive0.170213
china0.159574
canada0.148936
caecum0.127660
galapagos islands0.127660
finch0.127660
bon portage island0.127660
oceanodroma leucorhoa0.117021
seabird0.117021
anser cygnoides0.106383
research facility0.085106
goose0.063830
swan goose0.063830
state of idaho0.063830
california condor0.063830
gymnogyps californianus0.063830
mexico0.063830
pet0.063830
burrow0.053191
soil0.053191
cloacal swab0.042553
municipality of chongqing0.042553
cecal content0.042553
age 70 days0.042553
sichuan white goose0.042553
winter0.042553
summer0.042553
takahe0.042553
porphyrio hochstetteri0.042553
new zealand0.042553
commonwealth of massachusetts0.042553
qinghai province0.042553
canary0.042553
serinus canaria0.042553
fayetteville township0.042553
state of arkansas0.042553
male organism0.042553
japanese quail0.042553
coturnix japonica0.042553
duodenum0.042553
gizzard0.042553
mongolia0.031915
brood patch0.031915
uropygial gland0.031915
cloaca0.031915
colon0.031915
crop0.031915
coats island0.021277
thick-billed murres0.021277
uria lomvia0.021277
dalian city prefecture0.021277
zoological garden0.021277
pygoscelis papua0.021277
gentoo penguin0.021277
geospiza difficilis0.021277
sharp-beaked ground finch0.021277
geospiza fuliginosa0.021277
small ground finch0.021277
green warbler-finch0.021277
certhidea olivacea0.021277
camarhynchus parvulus0.021277
small tree finch0.021277
geospiza fortis0.021277
medium ground finch0.021277
geospiza scandens0.021277
common cactus finch0.021277
LOWER IN winter0.021277
LOWER IN summer0.021277
strix varia0.021277
barred owl0.021277
red-tailed hawk0.021277
buteo jamaicensis0.021277
isla de salvora0.021277
kingdom of spain0.021277
age 8 days0.021277
larus michahellis0.021277
gull0.021277
himalayan griffon0.021277
gyps himalayensis0.021277
italy0.021277
state of colorado0.021277
hirundo rustica0.021277
barn swallow0.021277
melopsittacus undulatus0.021277
parakeet0.021277
nymphicus hollandicus0.021277
cockatiel0.021277
deqing county0.021277
crested ibis0.021277
nipponia nippon0.021277
adult organism0.021277
anser0.021277
greylag goose0.021277
LOWER IN caecum0.021277
Exp. ID User ID Description Date Region Flag Sequences
558amnon high in duodenum compared to gizzard in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 1
440amnoncommon galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v4No1 / 4
237amnon high in brood patch compared to uropygial gland in bird oceanodroma leucorhoa seabird canada bon portage island 2017-11-07v4No1 / 4
950amnondominant bird, uria lomvia, thick-billed murres, canada, coats island, feces, cloacal swab2022-12-07v4No1 / 5
913amnon high in control diet compared to yeast supplemented diet yeast (food source) in sichuan white goose age 70 days municipality of chongqing china goose cecal content bird anser cygnoides caecum research facility 2022-06-01v3No1 / 5
440amnoncommon galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 5
440amnoncommon galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 6
237amnonhigh freq. in burrow soil of seabird (dominant bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 6
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, crop2019-09-20v4No1 / 7
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
440amnondominant galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 8
417amnondominant anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 8
742amnondominant dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v3No1 / 9
626amnoncommon red-tailed hawk, buteo jamaicensis, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v1No1 / 9
645amnon high in feces compared to cloaca in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v4No1 / 9
417amnondominant anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 10
913amnon high in yeast (food source) yeast supplemented diet compared to control diet in sichuan white goose age 70 days municipality of chongqing china goose cecal content bird anser cygnoides caecum research facility 2022-06-01v3No1 / 11
302amnonhigh freq. in feces of canary pet birds (dominant bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 11
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, crop2019-09-20v4No1 / 11
913amnondominant sichuan white goose, age 70 days, municipality of chongqing, china, goose, cecal content, bird, anser cygnoides, caecum, research facility2022-06-01v3No1 / 12
440amnondominant galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 12
440amnondominant galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v4No1 / 12
381amnoncommon bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 12
161amnonhigh freq. in barn swallows in colorado (dominant state of colorado, hirundo rustica, feces, united states of america, barn swallow)2017-07-12v4No1 / 12
645amnondominant feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 12
237amnondominant bird, oceanodroma leucorhoa, seabird, canada, bon portage island, brood patch2017-11-07v4No1 / 14
626amnoncommon strix varia, barred owl, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v1No1 / 14
862amnondominant himalayan griffon, gyps himalayensis, china, qinghai province, bird, feces2022-01-20v4No1 / 14
302amnonhigh freq. in feces of Cockatiel pet birds (dominant bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 14
440amnondominant galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 15
986amnondominant feces, new zealand, bird, porphyrio hochstetteri, takahe2022-12-26v3No1 / 15
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
440amnondominant galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 16
645amnondominant cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 16
237amnondominant bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 17
381amnondominant bird, isla de salvora, kingdom of spain, age 8 days, feces, larus michahellis, gull2018-10-22v4No1 / 17
950amnoncommon cloacal swab, feces, coats island, canada, thick-billed murres, uria lomvia, bird2022-12-07v4No1 / 18
440amnondominant galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
1011amnondominant bird, feces, serinus canaria, canary, italy, captive2023-02-03v3No1 / 18
302amnonhigh freq. in feces of parakeet pet birds (dominant bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 18
1002amnondominant bird, coturnix japonica, japanese quail, research facility, male organism, caecum, united states of america, state of arkansas, fayetteville township2022-12-31v4No1 / 19
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, colon2019-09-20v4No1 / 19
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v4No1 / 19
237amnon high in uropygial gland compared to brood patch in bird oceanodroma leucorhoa seabird canada bon portage island 2017-11-07v4No1 / 20
626amnondominant red-tailed hawk, buteo jamaicensis, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v1No1 / 21
1007amnondominant bird, cloacal swab, adult organism, china, nipponia nippon, crested ibis, deqing county, captive2023-01-25v4No1 / 21
626amnondominant strix varia, barred owl, commonwealth of massachusetts, united states of america, captive, bird, feces2020-05-16v1No1 / 23
558amnondominant bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 23
558amnondominant caecum, bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming2019-09-20v4No1 / 26
862amnoncommon qinghai province, china, himalayan griffon, gyps himalayensis, bird, feces2022-01-19v4No1 / 28
1002amnon high in high stress responsive compared to low stress responsive in fayetteville township state of arkansas united states of america caecum male organism research facility japanese quail coturnix japonica bird 2022-12-31v4No1 / 35
986amnon high in feed supplement diet compared to wild diet in feces new zealand bird porphyrio hochstetteri takahe 2022-12-26v3No1 / 40
1011amnoncommon captive, italy, canary, serinus canaria, feces, bird2023-02-03v3No1 / 41
986amnoncommon takahe, porphyrio hochstetteri, bird, new zealand, feces2022-12-26v3No1 / 42
302amnoncommon in feces of parakeet pet birds (common bird, melopsittacus undulatus, parakeet, mexico, feces, pet)2018-03-05v4No1 / 44
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, duodenum2019-09-20v4No1 / 45
302amnoncommon in feces of canary pet birds (common bird, mexico, feces, pet, serinus canaria, canary)2018-03-05v4No1 / 47
558amnon high in gizzard compared to duodenum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 48
645amnoncommon feces, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 49
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
237amnoncommon bird, oceanodroma leucorhoa, seabird, canada, bon portage island, uropygial gland2017-11-07v4No1 / 58
302amnoncommon in feces of Cockatiel pet birds (common bird, mexico, feces, pet, nymphicus hollandicus, cockatiel)2018-03-05v4No1 / 63
558amnon high in duodenum compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 64
1002amnoncommon fayetteville township, state of arkansas, united states of america, caecum, male organism, research facility, japanese quail, coturnix japonica, bird2022-12-31v4No1 / 65
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, colon2019-09-20v4No1 / 66
417amnoncommon anser cygnoides, swan goose, bird, feces, mongolia, summer2018-12-01v4No1 / 68
558amnon high in crop compared to gizzard in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 69
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
742amnoncommon dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v3No1 / 70
645amnon high in cloaca compared to feces in state of idaho captive california condor gymnogyps californianus bird 2020-09-03v4No1 / 71
1002amnon high in low stress responsive compared to high stress responsive in bird coturnix japonica japanese quail research facility male organism caecum united states of america state of arkansas fayetteville township 2022-12-31v4No1 / 80
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
558amnoncommon bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming, gizzard2019-09-20v4No1 / 97
558amnon high in colon compared to caecum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 97
645amnoncommon cloaca, state of idaho, captive, california condor, gymnogyps californianus, bird2020-09-03v4No1 / 99
558amnon high in winter compared to summer in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 103
1007amnoncommon captive, deqing county, crested ibis, nipponia nippon, china, adult organism, cloacal swab, bird2023-01-25v4No1 / 112
417amnon high in mongolia summer compared to winter china in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 114
986amnon high in wild diet compared to feed supplement diet in takahe porphyrio hochstetteri bird new zealand feces 2022-12-26v3No1 / 118
417amnon high in winter china compared to mongolia summer in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 132
558amnoncommon caecum, bird, centrocercus urophasianus, greater sage-grouse, united states of america, state of wyoming2019-09-20v4No1 / 155
913amnoncommon municipality of chongqing, china, research facility, cecal content, caecum, age 70 days, bird, anser cygnoides, sichuan white goose, goose2022-06-01v3No1 / 206
161amnoncommon in barn swallows in colorado (common state of colorado, hirundo rustica, feces, united states of america, barn swallow)2017-07-12v4No1 / 245
558amnon high in summer compared to winter in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 274
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
558amnon high in caecum compared to colon in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 359
558amnon high in gizzard compared to crop in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 408
558amnon high in caecum compared to duodenum in bird centrocercus urophasianus greater sage-grouse united states of america state of wyoming 2019-09-20v4No1 / 488
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
237amnonhigher deep in burrow compared to burrow entrance ( high in deep burrow compared to surface burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 676
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656

Problems / suggestions? Please email info AT dbbact DOT org