Summary for ontology term: butterfly

Number of annotations with term: 67

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Orbales;f__Orbaceae;g__OrbusTACGGAGGGTGCGAGCGTTAATCGGAATGACTGGGCGTAAAGGGCATGTAGGCGGATGATTAAGTTAGGTGTGAAAGCCCCGAGCTCAACTTGGGAATTGCACTTAAAACTGGTCGTCTGGAGTATTGTAGAGGAAGGTAGAATTCCACG0.789916
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGATTTGTAAGTCAGCGGTGAAATCCTACAGCTTAACTGTAGAACTGCCGTTGATACTGCAAGTCTTGAATAGTATTGAAGTAGCCGGAATGTGTAG0.647059
TTCCAGCTCCAATAGCGTATACTAAAATTGTTGCGGTTAAAAAGCTCGTAGTTGCATTTGTGCGCCGCGCTGTCGGTGCACCGCATCCGCGGTGATACTGACACGTCTGCGGAGCATATCGTCGGTGAGCCGGCGGTAAAACGCCGGTTC0.516129
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Acetobacteraceae;g__AsaiaTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGTTTACACAGTCAGATGTGAAATTCCAGGGCTTAACCTTGGGGCTGCATTTGATACGTGTAGACTAGAGTGTGAGAGAGGGTTGTGGAATTCCCAG0.453782
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Acetobacteraceae;g__AsaiaTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGTTTATACAGTCAGATGTGAAATTCCAGGGCTTAACCTTGGGGCTGCATTTGATACGTGTAGACTAGAGTGTGAGAGAGGGTTGTGGAATTCCCAG0.449438
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bartonellaceae;g__BartonellaTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGATATTTAAGTCAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTGATACTGGATATCTAGAGTATGGAAGAGGTGAGTGGAATTCCGAG0.400000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTATCAAGTTGGATGTGAAATCCCTGGGCTCAACCTAGGAACTGCATCCAAAACTGATTGACTAGAGTATAGTAGAGGTTAGTGGAATTTCCTG0.357143
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACTTTTAAGTCAGCGGTGAAAGTTTGCGGCTCAACCGTAAAATTGCCGTTGAAACTGGAAGTCTTGAGTGTAAACGAAGTAGGCGGAATTCGTGG0.357143
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCGAGCGTTAATCGGAATGACTGGGCGTAAAGGGCATGTAGGCGGATAATTAAGTTAGATGTGAAATCCCCGAGCTCAACTTGGGAATTGCATTTAAAACTGGTTATCTGGAGTCTTGTAGAGGGAGGTAGAATTCCACG0.337349
d__BacteriaTTCCAGCTCCAATAGCGTATACTAAAATTGTTGCGGTTAAAAAGCTCGTAGTTGCATTTGTGCGCCGCGCTGTCGGTGCACCGCATCCGCGGTGATACTGACACGTTTGCGGAGCATATCGTCGGTGAGCCGGCGGTAAAACGCCGGTTC0.317073

Annotations:

common ontology terms
term enrichment score
TermScore
butterfly0.800000
heliconius erato0.279570
tropical and subtropical moist broadleaf forest biome0.279570
costa rica0.216433
panama0.196970
forest ecosystem0.141304
whole body0.108434
body proper0.102857
caligo atreus0.056338
yellow-edged giant owl butterfly0.056338
dulcedo polita0.056338
pierella helvina0.056338
red-washed satyr butterfly0.056338
caligo illioneus0.056338
illioneus giant owl butterfly0.056338
archaeoprepona demophon0.056338
banded king shoemaker butterfly0.056338
pseudodebis zimri0.056338
taygetis laches0.056338
cithaerias pireta0.056338
blushing phantom butterfly0.056338
cissia terrestris0.056338
caligo brasiliensis0.056338
brazilian owl butterfly0.056338
pareuptychia ocirrhoe0.056338
two-banded satyr butterfly0.056338
aphrissa boisduvalii0.056338
urbanus teleus0.056338
mechanitis polymnia0.056338
orange-spotted tiger clearwing butterfly0.056338
pyrisitia nise0.056338
mimosa yellow butterfly0.056338
heliconius cydno0.056338
cydno longwing butterfly0.056338
marpesia petreus0.056338
ruddy daggerwing butterfly0.056338
chlosyne gaudialis0.056338
anartia fatima0.056338
banded peacock butterfly0.056338
phoebis argante0.056338
apricot sulphur butterfly0.056338
arawacus togarna0.056338
adelpha cytherea0.056338
smooth-banded sister butterfly0.056338
marpesia merops0.056338
aeria eurimedia0.056338
eurema albula0.056338
ghost yellow butterfly0.056338
heliconius sara0.056338
sara longwing butterfly0.056338
caterpillar0.056338
frass0.056338
teneral adult0.056338
pupa0.054795
shelled egg0.051948
digestive system0.050967
larval stage0.042105
nectar feeding0.028986
LOWER IN fruit feeding0.028986
fruit feeding0.028986
LOWER IN nectar feeding0.028986
LOWER IN pupa0.028571
LOWER IN shelled egg0.027778
adult0.010030
feces0.005284
Fraction of dbbact annotations with this term covered by the query
TermScore
butterfly0.666667
caligo atreus0.500000
yellow-edged giant owl butterfly0.500000
dulcedo polita0.500000
pierella helvina0.500000
red-washed satyr butterfly0.500000
caligo illioneus0.500000
illioneus giant owl butterfly0.500000
archaeoprepona demophon0.500000
banded king shoemaker butterfly0.500000
pseudodebis zimri0.500000
taygetis laches0.500000
cithaerias pireta0.500000
blushing phantom butterfly0.500000
cissia terrestris0.500000
caligo brasiliensis0.500000
brazilian owl butterfly0.500000
pareuptychia ocirrhoe0.500000
two-banded satyr butterfly0.500000
aphrissa boisduvalii0.500000
urbanus teleus0.500000
mechanitis polymnia0.500000
orange-spotted tiger clearwing butterfly0.500000
pyrisitia nise0.500000
mimosa yellow butterfly0.500000
heliconius cydno0.500000
cydno longwing butterfly0.500000
marpesia petreus0.500000
ruddy daggerwing butterfly0.500000
chlosyne gaudialis0.500000
anartia fatima0.500000
banded peacock butterfly0.500000
phoebis argante0.500000
apricot sulphur butterfly0.500000
arawacus togarna0.500000
adelpha cytherea0.500000
smooth-banded sister butterfly0.500000
marpesia merops0.500000
aeria eurimedia0.500000
eurema albula0.500000
ghost yellow butterfly0.500000
heliconius sara0.500000
sara longwing butterfly0.500000
nectar feeding0.500000
LOWER IN fruit feeding0.500000
fruit feeding0.500000
LOWER IN nectar feeding0.500000
heliconius erato0.500000
tropical and subtropical moist broadleaf forest biome0.500000
caterpillar0.500000
frass0.500000
teneral adult0.500000
pupa0.333333
LOWER IN pupa0.333333
panama0.200000
shelled egg0.200000
LOWER IN shelled egg0.200000
costa rica0.125000
forest ecosystem0.111111
whole body0.090909
body proper0.083333
larval stage0.071429
digestive system0.026316
adult0.005376
feces0.002899
Fraction of annotations for the query sequences containing the term
TermScore
butterfly1.000000
costa rica0.805970
digestive system0.805970
heliconius erato0.194030
panama0.194030
tropical and subtropical moist broadleaf forest biome0.194030
forest ecosystem0.194030
whole body0.134328
body proper0.134328
adult0.074627
caligo atreus0.029851
yellow-edged giant owl butterfly0.029851
dulcedo polita0.029851
pierella helvina0.029851
red-washed satyr butterfly0.029851
caligo illioneus0.029851
illioneus giant owl butterfly0.029851
archaeoprepona demophon0.029851
banded king shoemaker butterfly0.029851
pseudodebis zimri0.029851
taygetis laches0.029851
cithaerias pireta0.029851
blushing phantom butterfly0.029851
cissia terrestris0.029851
caligo brasiliensis0.029851
brazilian owl butterfly0.029851
pareuptychia ocirrhoe0.029851
two-banded satyr butterfly0.029851
aphrissa boisduvalii0.029851
urbanus teleus0.029851
mechanitis polymnia0.029851
orange-spotted tiger clearwing butterfly0.029851
pyrisitia nise0.029851
mimosa yellow butterfly0.029851
heliconius cydno0.029851
cydno longwing butterfly0.029851
marpesia petreus0.029851
ruddy daggerwing butterfly0.029851
chlosyne gaudialis0.029851
anartia fatima0.029851
banded peacock butterfly0.029851
phoebis argante0.029851
apricot sulphur butterfly0.029851
arawacus togarna0.029851
adelpha cytherea0.029851
smooth-banded sister butterfly0.029851
marpesia merops0.029851
aeria eurimedia0.029851
eurema albula0.029851
ghost yellow butterfly0.029851
heliconius sara0.029851
sara longwing butterfly0.029851
shelled egg0.029851
feces0.029851
larval stage0.029851
caterpillar0.029851
frass0.029851
teneral adult0.029851
pupa0.029851
nectar feeding0.014925
LOWER IN fruit feeding0.014925
fruit feeding0.014925
LOWER IN nectar feeding0.014925
LOWER IN pupa0.014925
LOWER IN shelled egg0.014925
Exp. ID User ID Description Date Region Flag Sequences
501amnoncommon costa rica, butterfly, digestive system, aeria eurimedia2019-03-09v4No1 / 1
118amnondominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, shelled egg, forest ecosystem2017-04-11v4No1 / 2
501amnondominant costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v4No1 / 3
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, shelled egg, forest ecosystem2017-04-11v4No1 / 3
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, pupa, forest ecosystem2017-04-11v4No1 / 4
501amnondominant costa rica, butterfly, digestive system, pareuptychia ocirrhoe, two-banded satyr butterfly2019-03-08v4No1 / 5
501amnondominant costa rica, butterfly, digestive system, pyrisitia nise, mimosa yellow butterfly2019-03-08v4No1 / 5
501amnondominant costa rica, butterfly, digestive system, caligo illioneus, illioneus giant owl butterfly2019-03-08v4No1 / 6
501amnondominant costa rica, butterfly, digestive system, aphrissa boisduvalii2019-03-08v4No1 / 6
501amnoncommon costa rica, butterfly, digestive system, urbanus teleus2019-03-08v4No1 / 6
501amnoncommon costa rica, butterfly, digestive system, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v4No1 / 6
501amnoncommon costa rica, butterfly, digestive system, pyrisitia nise, mimosa yellow butterfly2019-03-08v4No1 / 6
501amnondominant costa rica, butterfly, digestive system, phoebis argante, apricot sulphur butterfly2019-03-09v4No1 / 6
501amnondominant costa rica, butterfly, digestive system, marpesia merops2019-03-09v4No1 / 6
501amnoncommon costa rica, butterfly, digestive system, eurema albula, ghost yellow butterfly2019-03-09v4No1 / 6
118amnoncommon in captive raised teneral adult butterfly (common butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, teneral adult, forest ecosystem)2017-04-11v4No1 / 6
118amnondominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, pupa, forest ecosystem2017-04-11v4No1 / 6
501amnoncommon costa rica, butterfly, digestive system, aphrissa boisduvalii2019-03-08v4No1 / 7
501amnondominant costa rica, butterfly, digestive system, adelpha cytherea, smooth-banded sister butterfly2019-03-09v4No1 / 7
501amnoncommon costa rica, butterfly, digestive system, marpesia merops2019-03-09v4No1 / 7
118amnondominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 7
501amnondominant costa rica, butterfly, digestive system, urbanus teleus2019-03-08v4No1 / 8
501amnoncommon costa rica, butterfly, digestive system, marpesia petreus, ruddy daggerwing butterfly2019-03-08v4No1 / 8
501amnondominant costa rica, butterfly, digestive system, marpesia petreus, ruddy daggerwing butterfly2019-03-08v4No1 / 8
501amnondominant costa rica, butterfly, digestive system, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 8
501amnondominant costa rica, butterfly, digestive system, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v4No1 / 9
501amnondominant costa rica, butterfly, digestive system, cithaerias pireta, blushing phantom butterfly2019-03-08v4No1 / 9
501amnondominant costa rica, butterfly, digestive system, mechanitis polymnia, orange-spotted tiger clearwing butterfly2019-03-08v4No1 / 9
501amnoncommon costa rica, butterfly, digestive system, phoebis argante, apricot sulphur butterfly2019-03-09v4No1 / 9
501amnondominant costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 9
501amnondominant costa rica, butterfly, digestive system, aeria eurimedia2019-03-09v4No1 / 9
118amnonhigh freq. in captive raised teneral adult butterfly (dominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, body proper, whole body, teneral adult, forest ecosystem)2017-04-11v4No1 / 9
501amnondominant costa rica, butterfly, digestive system, pierella helvina, red-washed satyr butterfly2019-03-08v4No1 / 10
501amnondominant costa rica, butterfly, digestive system, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 10
501amnoncommon costa rica, butterfly, digestive system, anartia fatima, banded peacock butterfly2019-03-09v4No1 / 10
501amnondominant costa rica, butterfly, digestive system, dulcedo polita2019-03-08v4No1 / 11
501amnondominant costa rica, butterfly, digestive system, pseudodebis zimri2019-03-08v4No1 / 11
501amnoncommon costa rica, butterfly, digestive system, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
501amnondominant costa rica, butterfly, digestive system, heliconius cydno, cydno longwing butterfly2019-03-08v4No1 / 11
501amnoncommon costa rica, butterfly, digestive system, adelpha cytherea, smooth-banded sister butterfly2019-03-09v4No1 / 11
501amnondominant costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 11
501amnoncommon costa rica, butterfly, digestive system, pierella helvina, red-washed satyr butterfly2019-03-08v4No1 / 12
501amnoncommon costa rica, butterfly, digestive system, caligo brasiliensis, brazilian owl butterfly2019-03-08v4No1 / 12
118amnoncommon butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, feces, larval stage, caterpillar, frass, forest ecosystem2017-04-11v4No1 / 12
118amnoncommon in captive reared butterfly (common butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, adult, body proper, whole body, forest ecosystem)2017-04-11v4No1 / 12
501amnoncommon costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v4No1 / 13
501amnondominant costa rica, butterfly, digestive system, taygetis laches2019-03-08v4No1 / 13
501amnondominant costa rica, butterfly, digestive system, cissia terrestris2019-03-08v4No1 / 13
501amnoncommon costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 13
501amnondominant costa rica, butterfly, caligo atreus, yellow-edged giant owl butterfly, digestive system2019-03-08v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, caligo illioneus, illioneus giant owl butterfly2019-03-08v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, pseudodebis zimri2019-03-08v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, cissia terrestris2019-03-08v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, pareuptychia ocirrhoe, two-banded satyr butterfly2019-03-08v4No1 / 14
501amnondominant costa rica, butterfly, digestive system, chlosyne gaudialis2019-03-09v4No1 / 14
118amnoncommon in wild butterfly (common butterfly, heliconius erato, panama, whole body, adult, body proper, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 14
118amnon high in adult compared to pupa shelled egg in butterfly heliconius erato panama tropical and subtropical moist broadleaf forest biome body proper whole body forest ecosystem 2017-04-11v4No1 / 14
501amnoncommon costa rica, butterfly, digestive system, taygetis laches2019-03-08v4No1 / 15
501amnoncommon costa rica, butterfly, digestive system, cithaerias pireta, blushing phantom butterfly2019-03-08v4No1 / 15
118amnonhigh freq. in wild butterfly (dominant butterfly, heliconius erato, panama, whole body, adult, body proper, tropical and subtropical moist broadleaf forest biome, forest ecosystem)2017-04-11v4No1 / 16
501amnoncommon costa rica, butterfly, digestive system, dulcedo polita2019-03-08v4No1 / 17
501amnoncommon costa rica, butterfly, digestive system, archaeoprepona demophon, banded king shoemaker butterfly2019-03-08v4No1 / 17
501amnoncommon costa rica, butterfly, digestive system, heliconius sara, sara longwing butterfly2019-03-09v4No1 / 17
118amnonhigh freq. in captive reared butterfly (dominant butterfly, heliconius erato, panama, tropical and subtropical moist broadleaf forest biome, adult, body proper, whole body, forest ecosystem)2017-04-11v4No1 / 19
501amnoncommon costa rica, butterfly, digestive system, arawacus togarna2019-03-09v4No1 / 21
501amnonhigher in nectar feeding butterflies compared to fruit feeding ( high in nectar feeding compared to fruit feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 64
501amnonlower in nectar feeding butterflies compared to fruit feeding ( high in fruit feeding compared to nectar feeding in costa rica butterfly digestive system )2019-03-09v4No1 / 116

Problems / suggestions? Please email info AT dbbact DOT org