Summary for ontology term: caloric restriction diet

Number of annotations with term: 10

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTTTTTTAAGTTAGAGGTGAAAGCTCGACGCTCAACGTCGAAATTGCCTCTGATACTGAGAGACTAGAGTGTAGTTGCGGAAGGCGGAATGTGTGG0.285714
d__Bacteria;p__Firmicutes;c__ClostridiaTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGCTGTCAAGTCAGATGTGAAATACCGGGGCTCAACTCCGGGGCTGCATTTGAAACTGATGGTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGTCGGAGAGGCAATCGGAATTCCGTG0.285714
d__BacteriaTACGTAGGTGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGATCGTTAAGTTGGACGTGAAATACCCCGGCTCAACTGGGGGGCGACGTCCAAAACTGGCGGACTAGAGTGCAGGAGAGGAAAGTAGAATTCCCAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGGCGGGATTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGACTGCATTTGAAACTGTAGTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCCGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGAGCTCAACTCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCAGCAAGTCAGAAGTGAAATCTCTGGGCTCAACCCAGAAACTGCTTTTGAAACTGTTGCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__IntestinimonasTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTACTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCCTG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGAGTAGGCGGGAAGTCAAGTCAGATGTGAAATGCCGCGGCTTAACTGCGGAACTGCATTTGAAACTGATTTTCTTGAGAGTCGGAGAGGCAATCGGAATTCCTAG0.285714
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.285714

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCGATGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTGCAGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGTTGAACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGACTGCAAGTTGGGTGTCAAATCTACCGGCTCAACCGGTAGCCGCACTCAAAACTGCAGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGATGCAAGTTGGGTGTTAAATCTACCGGCTCAACTGGTAGTCGCACTCAAAACTGCAGCTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCAGTGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGAACTGCTCTGGAAACTGTGCGGCTAGAGTACTGGAGGGGCAGGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACCATGGGCTCAACCTGTGGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGACGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAATACAAGTCGGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.200000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGAATTATTGGGTGTAAAGGGTGCGTAGGCGGTTTTATAAGTCAGTGGTGAAAGCCCAGAGCTTAACTCTGGTAAGCCATTGAAACTGTAGAACTTGAGTATGGTAGAGGCAAGTGGAATTTCTAGT0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTCTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAGACTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGTATCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCCGGACTGCATTGGAAACTGGTATGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGAATGCAAGTCAGATGTGAAATCCAGGGGCTTAACCCTTGAACTGCATTTGAAACTGTATTTCTTGAGTGTCGGAGAGGTTGACGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCATGATAAGTCTGATGTGAAAACCCAAGGCTCAACCATGGGACTGCATTGGAAACTGTCGTGCTGGAGTGTCGGAGAGGTGAGCGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTCTTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.222222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTGATTTAAGTCAGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGGGTTGCTTGAGTGTGTTTGAGGTAGGCGGAATGCGTGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTATGGTTCAAGCGTTATCCGGATTTACTGGGTGTAAAGAGTGAGTAGGCGGTTATGCAAGTCATATGTGAAATGTCGGGGCTCAACTCCGGCCTGCATAAGAAACTGTATAACTAGAGTGCAGGAGAGGCAAGCGGAATTCCTAGT0.222222
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGTGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTACCTTGAGTGCAGTAGAGGTAGGCGGAATTCGTGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTACAAGTCAGATGTGAAATTCCGGGGCTCAACTCCGGACCTGCATTTGAAACTGTAGTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.222222

Annotations:

common ontology terms
term enrichment score
TermScore
caloric restriction diet0.685714
LOWER IN caloric restriction diet0.533333
cron diet0.375000
ldlr-0.285714
age 50-70 years0.285714
overweight body mass index status0.250000
state of washington0.222222
obese body mass index status0.222222
LOWER IN cron diet0.166667
obesity0.166667
american diet0.153846
LOWER IN american diet0.153846
switzerland0.142857
LOWER IN normal diet0.133333
c57bl/6j0.133333
normal diet0.133333
high fat diet0.117647
high bmi0.111111
diet0.105263
mouse chow0.100000
c57bl/60.086957
control diet0.083333
LOWER IN control diet0.083333
mouse0.064516
mus musculus0.058824
germany0.058824
female0.029412
research facility0.026316
adult0.022684
feces0.018883
united states of america0.015979
homo sapiens0.014581
control0.010256
LOWER IN control0.010256
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN caloric restriction diet0.800000
caloric restriction diet0.800000
ldlr-0.500000
LOWER IN cron diet0.500000
cron diet0.500000
age 50-70 years0.500000
american diet0.333333
LOWER IN american diet0.333333
overweight body mass index status0.333333
state of washington0.250000
obese body mass index status0.250000
LOWER IN normal diet0.200000
normal diet0.200000
obesity0.142857
switzerland0.111111
c57bl/6j0.100000
high fat diet0.083333
high bmi0.076923
control diet0.071429
LOWER IN control diet0.071429
mouse chow0.066667
diet0.060606
c57bl/60.055556
mouse0.035088
germany0.034483
mus musculus0.031746
female0.015873
research facility0.013605
adult0.011561
feces0.009554
united states of america0.008097
homo sapiens0.007380
control0.005405
LOWER IN control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
feces0.800000
united states of america0.600000
caloric restriction diet0.600000
homo sapiens0.600000
adult0.600000
diet0.400000
LOWER IN caloric restriction diet0.400000
research facility0.400000
mus musculus0.400000
mouse0.400000
cron diet0.300000
high fat diet0.200000
c57bl/60.200000
state of washington0.200000
ldlr-0.200000
c57bl/6j0.200000
switzerland0.200000
mouse chow0.200000
female0.200000
obesity0.200000
obese body mass index status0.200000
germany0.200000
high bmi0.200000
overweight body mass index status0.200000
age 50-70 years0.200000
control0.100000
LOWER IN control0.100000
american diet0.100000
LOWER IN cron diet0.100000
LOWER IN american diet0.100000
LOWER IN normal diet0.100000
normal diet0.100000
control diet0.100000
LOWER IN control diet0.100000
Exp. ID User ID Description Date Region Flag Sequences
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in diet caloric restriction diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 5
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in control diet compared to caloric restriction diet in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 12
293amnondominant feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 18
814amnonlower after 2 months of caloric restriction diet ( high in control diet compared to caloric restriction diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 37
369amnonhigher in mice with 40% caloric restriction diet ( high in caloric restriction diet compared to normal diet in feces research facility mus musculus c57bl/6j switzerland mouse mouse chow )2018-09-06v4No1 / 58
814amnonhigher after 2 months of caloric restriction diet ( high in caloric restriction diet compared to control diet in feces homo sapiens female obesity adult obese body mass index status germany high bmi overweight body mass index status age 50-70 years )2021-06-30v4No1 / 58
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
369amnonlower in mice with 40% caloric restriction diet ( high in normal diet compared to caloric restriction diet in feces research facility mus musculus c57bl/6j switzerland mouse mouse chow )2018-09-06v4No1 / 180
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381

Problems / suggestions? Please email info AT dbbact DOT org