Summary for ontology term: canada

Number of annotations with term: 388

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__LoktanellaTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCAGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCAAG0.002976
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__FormosaTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGTGGATAATTAAGTCAGAGGTGAAATCTTGCAGCTCAACTGTAAAATTGCCTTTGATACTGGTTATCTTGAGTTATTATGAAGTAGTTAGAATATGTAG0.002976
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__BacillariophytaGACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGTTTAATAAGTCAACTGTTAAATCTTGAGGCTCAACTTCAAAATCGCAGTCGAAACTATTAGACTAGAGTATAGTAGAGGTAAAGGGAATTTCCAG0.002976
d__Bacteria;p__"Bacteroidetes"TACGGAGGGTGCAAGCGTTATCCGGAATTACTGGGTTTAAAGGGTGCGTAGGCGGTTTAATAAGTCAGAAGTGAAAAGTCCGAGCTCAACTGGGGCCTTGCTTTTGATACTGTTAGACTTGAATCAGGCTGAGGTTAGCGGAATGTGACA0.002976
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Hyphomonadaceae;g__HelleaTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGATTATTAAGTTAGGGGTGAAATCCCGGGGCTCAACCTCGGAACTGCCTCTAAAACTGGTAATCTAGAGATATGGAGAGGTAAGTGGAATTCCTAG0.002976
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__PolaribacterTACGGAGGGTCCGAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTCAATTAAGTCAGAGGTGAAATCCCATAGCTCAACTATGGAACTGCCTTTGATACTGGTTGACTTGAGTCATATGGAAGTAGATAGAATGTGTAG0.002976
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACTTTTAAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGGAAGTCTTGAGTTCGAGAGAGGTAAGTGGAATTCCAAG0.002976
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Gammaproteobacteria_incertae_sedis;g__EioneaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGTTAAGCGAGATGTGAAAGCCCAGGGCTCAACCTTGGAATTGCATTTCGAACTGGCAAGCTAGAGTACAGAAGAGGGTGGTGGAATTTCCAG0.002976
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__CryomorphaceaeTACGGAGGGTGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGACGTATAAGTCAGTGGTGAAATCCTGCAGCTTAACTGCAGAACTGCCATTGATACTGTACGTCTTGAATTCGGTCGAAGTGGGCGGAATGTGTAG0.002976
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Alteromonadales;f__Psychromonadaceae;g__PsychromonasTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTAATTAAGTCAGATGTGAAAGCCCAGGGCTCAACCTTGGAACTGCATTTGAAACTGGTTAACTAGAGTTTTGTAGAGGGTGGTAGAATTTCAGG0.002976

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.500000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Cyanobacteria;f__Family II;g__GpIIaTACGGGAGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTCCGCAGGCGGCCCTTCAAGTCTGCTGTTAAAAAGTGGAGCTTAACTCCATCATGGCAGTGGAAACTGTTGGGCTTGAGTGTGGTAGGGGCAGAGGGAATTCCCGG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTGGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATCAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Oceanospirillales;f__Halomonadaceae;g__CobetiaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTAAGTCAGCCAGGTGTGAAAGCCCCGGGCTCAACCTGGGAACGGCATCTGGAACTGCTTGGCTAGAGTGCAGGAGAGGAAGGTAGAATTCCCGG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.500000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CroceibacterTACGGAGGGTCCGAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGCCAGATAAGTCAGTGGTGAAATTCCGTGGCTCAACCACGGAACTGCCATTGATACTGTTTGGCTTGAATCAGTTCGAGGATGCCGGAATGTGTGG0.500000
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGATCAAAAAGTTAGATGTGAAATCCCTGGGCTCAACCCAGGAACTGCATTTAAAACTAGTGATCTAGAATTTGGTAGGGGCCAGTAGAATTTCCAG0.500000
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGATCAAAAAGTTAGATGTGAAATCCCTGGGCTCAACCCAGGAACTGCATTTAAAACTAGTGATCTAGAATTTGGTAGGGGTTAGTAGAATTTCCAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCACGTCTGCTGTGAAAATCCAAGGCTCAACCTTGGACTTGCAGTGGGTACGGGCAGGCTAGAGTGCGGTAGGGGAGATGGGAATTCCTGG0.500000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGTTTTTTAAGTCAGAGGTGAAATCCTGCAGCTCAACTGTAGCATTGCCTTTGATACTGAAAGACTTGAGTTATTGTGAAGTAGTTAGAATGTGTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Hyphomonadaceae;g__HelleaTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGATTATTAAGTTAGGGGTGAAATCCCGGGGCTCAACCTCGGAACTGCCTCTAAAACTGGTAATCTAGAGATATGGAGAGGTAAGTGGAATTCCTAG0.269565
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGATCAATAAGTAAGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTCTTAAACTGTTGGTCTTGAGTTCTGGAGAGGTGAGTGGAATTGCTAG0.251889
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__PolaribacterTACGGAGGGTCCGAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTCGATTAAGTCAGAGGTGAAATCCCATAGCTCAACTATGGAACTGCCTTTGATACTGGTTGACTTGAGTCATATGGAAGTAGATAGAATGTGTAG0.243309
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCTCTTTTACCCGGGATGATAATGACAGTACCGGGAGAATAAGCTCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.242634
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Cyanobacteria;f__Family VIII;g__GpVIIITACGGAGGATGCAAGCGTTATCCGGAATCATTGGGCGTAAAGCGTCCGCAGGTGGCTAGTCAAGTCTGCTGTTAAAGACAGAAGCTCAACTTCTGATAGGCAGTGGAAACTGGGTAGCTAGAGTATGGTAGGGGTTGAGGGAATTCCCAG0.235602
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__BacillariophytaGACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGCTCAATAAGTCAACTGTTAAATCTTGAAGCTCAACTTCGAAATCGCAGTCGAAACTATTGGACTAGAGTATAGTAGAGGTAAAGGGAATTTCCAG0.233766
d__Bacteria;p__"Bacteroidetes"TACGGAGGGTGCAAGCGTTATCCGGAATCACTGGGTTTAAAGGGTGCGTAGGCGGCCTGACAAGTCAGAGGTGAAATACACGAGCTTAACTGGTGAATTGCCTTTGAAACTGTCAAGCTAGAATTATGTTGAGGTTAGCGGAATGAGTCA0.223881
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__SulfitobacterTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGATCAGAAAGTATGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTCATAAACTCCTGGTCTTGAGTTCGAGAGAGGTGAGTGGAATTCCAAG0.213198
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGATTTATAAGTCAGTGGTGAAAGTTTGCGGCTCAACCGTAAAATTGCCATTGATACTGTAAGTCTTGAATAATAATGAAGTGGTTAGAATAAGTAG0.211082
d__BacteriaTACGGAAGGTGCAAGCGTTATCCGGAATCACTGGGTTTAAAGGGTGCGTAGGCTGTTTTGTAAGTCAGAAGTGAAAGATGCGGGCTTAACCTGCAAACTGCTTTTGAAACTGCAAGACTTGAAATAGGTTGAGGTTAGCGGAATGTGACA0.204188

Annotations:

common ontology terms
term enrichment score
TermScore
canada0.985621
province of ontario0.337570
province of british columbia0.302158
calvert island0.281481
alga0.259542
cambridge0.201646
rare charitable research reserve0.201646
grand river watershed0.201646
ocean0.200957
pacific ocean0.188509
luvisol0.145374
farm0.117073
cannabis sativa0.110092
male0.108947
age 8 weeks0.105691
captive0.099573
forested area0.097674
meadow ecosystem0.097674
solidago0.097674
apocynum0.097674
dipsacus fullonum0.097674
decomissioned agricultural field0.097674
epidermis0.096916
forest0.093458
fagus grandifolia0.093458
acer saccharum subsp. nigrum0.093458
acer saccharum0.093458
quercus rubra0.093458
quercus alba0.093458
quercus velutina0.093458
daucus carota0.093126
skin0.089370
province of alberta0.088670
african lion safari0.084906
depth 15-30cm0.084906
edmonton0.079208
canis latrans0.079208
equus caballus0.076759
horse0.076759
brunisol0.076190
zoological garden0.073733
male organism0.073394
caecum0.072790
depth 0-15cm0.071770
toronto zoo0.067308
depth 30-45cm0.067308
adult0.064802
ileum0.064103
adult organism0.062016
sus scrofa0.062016
pig0.062016
wild0.061688
age 6 weeks0.061135
c57bl/60.060748
ascending colon0.060000
toronto0.059113
taconic farms0.059091
bon portage island0.058252
mature forest0.058252
jackson laboratories0.055794
research facility0.054465
province of quebec0.054388
oceanodroma leucorhoa0.053659
seabird0.053659
saliva0.053524
soil0.050242
mouse0.050111
homo sapiens0.047472
mus musculus0.046607
vancouver0.046036
mastocarpus0.044832
water0.043433
root endosphere0.042453
bird0.041431
feces0.040651
sciurus carolinensis0.040404
pair of nares0.039911
sea water0.039630
barn0.039604
age 9 months0.039604
preston flats0.039604
old growth forest0.039604
quesnel lake0.039604
colon0.038835
hay0.038835
lake sediment0.038835
terminal ileum0.038095
right colon0.037383
cecal content0.036697
anatomical space0.034286
zea mays0.034188
agricultural field0.033058
nasal cavity0.030108
algonquin provincial park0.030000
peromyscus maniculatus0.030000
deer mice0.030000
salmonella enterica subsp. enterica serovar typhimurium0.030000
salmonellosis0.030000
mastocarpus alaskensis0.030000
saanich inlet0.030000
Fraction of dbbact annotations with this term covered by the query
TermScore
vancouver3.000000
canada1.000000
edmonton1.000000
canis latrans1.000000
ascending colon1.000000
descending colon1.000000
LOWER IN ascending colon1.000000
LOWER IN descending colon1.000000
spring1.000000
LOWER IN spring1.000000
sciurus carolinensis1.000000
province of alberta1.000000
LOWER IN cape cod canal1.000000
cape cod canal1.000000
LOWER IN vancouver1.000000
atherosclerosis1.000000
province of ontario0.800000
toronto0.666667
mastocarpus0.666667
province of quebec0.666667
algonquin provincial park0.500000
peromyscus maniculatus0.500000
deer mice0.500000
red alga0.500000
LOWER IN nereocystis0.500000
LOWER IN kelp0.500000
nereocystis0.500000
kelp0.500000
LOWER IN red alga0.500000
photic zone0.500000
forested area0.500000
LOWER IN salmonellosis0.500000
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonellosis0.500000
african lion safari0.500000
eastern gray squirrel0.500000
ammotragus lervia0.500000
barbary sheep0.500000
toronto zoo0.500000
rangifer tarandus0.500000
reindeer0.500000
camelus bactrianus0.500000
bactrian camel0.500000
macropus rufus0.500000
red kangaroo0.500000
pteropus giganteus0.500000
indian flying fox0.500000
canis lupus arctos0.500000
arctic wolf0.500000
eidolon helvum0.500000
fruit bat0.500000
province of british columbia0.500000
calvert island0.500000
gloiopeltis0.500000
gloiopeltis furcata0.500000
alga0.500000
glueweed0.500000
fucus0.500000
fucus distichus0.500000
rockweed0.500000
pseudolithophyllum0.500000
pseudolithophyllum neofarlowii0.500000
endocladia0.500000
endocladia muricata0.500000
turfweed0.500000
hildenbrandia0.500000
pyropia0.500000
pyropia perforata0.500000
purple laver0.500000
analipus0.500000
analipus japonicus0.500000
sea fir0.500000
acrosiphonia0.500000
acrosiphonia coalita0.500000
prionitis0.500000
prionitis sternbergii0.500000
neorhodomela0.500000
neorhodomela larix0.500000
red pine algae0.500000
phylospadix0.500000
surfgrass0.500000
ralfsia sp.4gws0.500000
ralfsia0.500000
corallina vancouveriensis0.500000
corallina0.500000
graceful coral seaweed0.500000
odonthalia floccosa0.500000
odonthalia0.500000
colpomenia0.500000
colpomenia sp. 1peregrina0.500000
antithamnionella floccosa0.500000
antithamnionella0.500000
polyneura latissima0.500000
polyneura0.500000
laminaria setchelli0.500000
laminaria0.500000
mazzaella splendens0.500000
mazzaella0.500000
plocamium violaceum0.500000
Fraction of annotations for the query sequences containing the term
TermScore
canada0.971649
pacific ocean0.229381
ocean0.216495
province of british columbia0.216495
province of ontario0.213918
calvert island0.195876
alga0.175258
skin0.170103
soil0.146907
research facility0.136598
cambridge0.126289
rare charitable research reserve0.126289
grand river watershed0.126289
farm0.123711
homo sapiens0.121134
adult0.108247
feces0.100515
captive0.090206
mus musculus0.087629
mouse0.087629
male0.085052
luvisol0.085052
zoological garden0.082474
c57bl/60.067010
age 8 weeks0.067010
cannabis sativa0.061856
epidermis0.056701
caecum0.054124
forested area0.054124
daucus carota0.054124
meadow ecosystem0.054124
solidago0.054124
apocynum0.054124
dipsacus fullonum0.054124
decomissioned agricultural field0.054124
forest0.051546
fagus grandifolia0.051546
acer saccharum subsp. nigrum0.051546
acer saccharum0.051546
quercus rubra0.051546
quercus alba0.051546
quercus velutina0.051546
wild0.048969
province of alberta0.046392
african lion safari0.046392
equus caballus0.046392
horse0.046392
depth 15-30cm0.046392
adult organism0.041237
edmonton0.041237
canis latrans0.041237
coyote0.041237
male organism0.041237
sus scrofa0.041237
pig0.041237
brunisol0.041237
saliva0.038660
ileum0.038660
depth 0-15cm0.038660
rhizosphere0.038660
water0.036082
age 6 weeks0.036082
toronto zoo0.036082
depth 30-45cm0.036082
jackson laboratories0.033505
taconic farms0.033505
control0.033505
toronto0.030928
anatomical space0.030928
ascending colon0.030928
bon portage island0.030928
mature forest0.030928
province of quebec0.028351
bird0.028351
oceanodroma leucorhoa0.028351
seabird0.028351
sea water0.025773
vancouver0.023196
mastocarpus0.023196
pair of nares0.023196
mouth0.023196
root endosphere0.023196
root0.023196
colon0.020619
right colon0.020619
terminal ileum0.020619
sciurus carolinensis0.020619
hay0.020619
barn0.020619
cecal content0.020619
age 9 months0.020619
zea mays0.020619
agricultural field0.020619
preston flats0.020619
old growth forest0.020619
lake sediment0.020619
sediment0.020619
quesnel lake0.020619
female0.018041
LOWER IN control0.018041
Exp. ID User ID Description Date Region Flag Sequences
384amnon high in asthma compared to control in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v4No1 / 1
265amnondominant water, canada, province of quebec, soilwater2017-12-11v4No1 / 2
265amnondominant soil, canada, province of quebec2017-12-11v4No1 / 3
842sheryoDominant in soil depth of 0-15cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 0-15cm, mature forest)2021-11-14v3No1 / 3
327amnonhigher in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in antibiotic compared to control in nasopharynx bos taurus canada cow )2018-04-30v4No1 / 4
237amnon high in brood patch compared to uropygial gland in canada bon portage island bird oceanodroma leucorhoa seabird 2017-11-07v4No1 / 4
507amnondominant lake sediment, sediment, canada, province of british columbia, quesnel lake, sediment depth 8-10cm2019-03-17v4No1 / 4
842sheryoDominant in soil depth of 0-15cm in an old growth forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 0-15cm, old growth forest)2021-11-14v3No1 / 5
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, decomissioned agricultural field)2021-11-14v3No1 / 5
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, decomissioned agricultural field)2021-11-14v3No1 / 5
507amnondominant lake sediment, sediment, canada, province of british columbia, quesnel lake, sediment depth 0-5cm2019-03-17v4No1 / 5
237amnonhigh freq. in burrow soil of seabird (dominant soil, canada, bon portage island, bird, oceanodroma leucorhoa, seabird, burrow)2017-11-07v4No1 / 6
384amnon high in control compared to asthma in farm hay saliva oral cavity equus caballus canada horse barn mouth 2018-10-23v4No1 / 6
842sheryoDominant in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (dominant soil, zea mays, canada, province of ontario, agricultural field, luvisol, cambridge, rare charitable research reserve, grand river watershed, preston flats, depth 0-15cm)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (dominant soil, zea mays, canada, province of ontario, agricultural field, luvisol, cambridge, rare charitable research reserve, grand river watershed, preston flats, depth 15-30cm)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 0-15cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, brunisol, mature forest)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 15-30cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, mature forest)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 6
868amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 6
565amnondominant farm, skin, equus caballus, horse, canada2019-11-21v3No1 / 7
565amnondominant skin, canis lupus familiaris, dog, canada2019-11-21v3No1 / 7
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, endocladia, endocladia muricata, turfweed2018-08-01v4No1 / 7
842sheryoDominant in soil depth of 30-45cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, brunisol, mature forest)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, mature forest)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in an old growth forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, old growth forest)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 15-30cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 30-45cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 7
717amnondominant homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 7
906amnon high in male organism compared to female organism in feces canada province of ontario sciurus carolinensis grey squirrel 2022-05-19v4No1 / 8
565amnondominant skin, felis catus, cat, canada2019-11-21v3No1 / 8
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 8
842sheryoDominant in soil depth of 15-30cm in an old growth forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, old growth forest)2021-11-14v3No1 / 8
842sheryoDominant in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 15-30cm, decomissioned agricultural field)2021-11-14v3No1 / 8
618amnondominant farm, rhizosphere, canada, cannabis sativa, early flowering stage2020-05-04v4No1 / 8
906amnondominant feces, canada, province of ontario, sciurus carolinensis, grey squirrel2022-05-19v4No1 / 9
565amnondominant zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 9
565amnondominant zoological garden, skin, equus przewalskii, captive, canada, toronto zoo, wild horse2019-11-21v3No1 / 9
565amnondominant zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 9
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, ralfsia sp.4gws, ralfsia2018-08-01v4No1 / 9
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, bossiella frondescems, bossiella2018-08-01v4No1 / 9
842sheryoDominant in soil depth of 15-30cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, brunisol, mature forest)2021-11-14v3No1 / 9
842sheryoDominant in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 30-45cm, decomissioned agricultural field)2021-11-14v3No1 / 9
868amnonhigher in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga positive fraction compared to iga negative fraction in feces homo sapiens adult canada province of alberta )2022-02-12v4No1 / 9
10amnon high in female compared to male in feces homo sapiens toronto 2016-10-27v4No1 / 10
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 10
565amnondominant zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 10
565amnondominant farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 10
565amnondominant zoological garden, skin, captive, canada, eidolon helvum, toronto zoo, fruit bat2019-11-21v3No1 / 10
618amnondominant farm, rhizosphere, canada, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 10
868amnonlower in iga positive compared to negative fraction in adults 1 month after fecal microbiome transfer ( high in iga negative fraction compared to iga positive fraction in feces homo sapiens adult canada province of alberta )2022-02-12v4No1 / 10
10amnon high in male compared to female in feces homo sapiens toronto 2016-10-27v4No1 / 11
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 11
898amnondominant jejunum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 11
898amnon high in duodenum jejunum compared to feces ascending colon descending colon in male canada wild adult organism edmonton canis latrans coyote 2022-04-19v4No1 / 11
169amnon high in autumn spring compared to summer in lake photic zone water fresh water canada depth (water) 0-100cm depth (water) 20-100cm 2017-07-24v4No1 / 11
565amnondominant skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 11
565amnondominant zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 11
565amnondominant zoological garden, skin, panthera leo, lion, captive, canada, toronto zoo2019-11-21v3No1 / 11
355amnondominant ocean, surface water, sea water, pacific ocean, canada, province of british columbia, calvert island2018-08-01v4No1 / 11
355amnonhigh freq. in rocks from low tide zone (dominant ocean, low tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 11
496amnondominant water, sea water, pacific ocean, canada, saanich inlet, depth (water) 200m2019-03-03v4No1 / 11
384amnondominant farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 11
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 12
898amnoncommon duodenum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 12
898amnondominant duodenum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 12
906amnon high in female organism compared to male organism in feces canada province of ontario sciurus carolinensis grey squirrel 2022-05-19v4No1 / 12
565amnondominant zoological garden, skin, acinonyx jubatus, cheetah, captive, canada, african lion safari2019-11-21v3No1 / 12
565amnondominant farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 12
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neorhodomela, neorhodomela larix, red pine algae2018-08-01v4No1 / 12
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, plocamium violaceum, plocamium2018-08-01v4No1 / 12
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, laminaria, laminaria yezoensis2018-08-01v4No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 12
717amnondominant homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 12
842sheryoDominant in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (dominant soil, zea mays, canada, province of ontario, agricultural field, luvisol, cambridge, rare charitable research reserve, grand river watershed, preston flats, depth 30-45cm)2021-11-14v3No1 / 12
618amnondominant farm, rhizosphere, canada, cannabis sativa, late flowering stage2020-05-04v4No1 / 12
673amnondominant research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 13
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, odonthalia floccosa, odonthalia2018-08-01v4No1 / 13
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, polyneura latissima, polyneura2018-08-01v4No1 / 13
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, saccharina groenlandica, saccharina2018-08-01v4No1 / 13
355amnon high in low tide zone compared to high tide zone in ocean pacific ocean canada province of british columbia calvert island alga endocladia endocladia muricata 2018-08-01v4No1 / 13
717amnondominant homo sapiens, axilla, skin, adult, canada, province of ontario, epidermis, armpit2028-05-22v3No1 / 13
611amnon high in male compared to female in research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 13
868amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 13
618amnondominant farm, canada, root endosphere, root, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 13
169amnon high in summer autumn compared to spring in lake photic zone water fresh water canada depth (water) 0-100cm depth (water) 20-100cm 2017-07-24v4No1 / 14
673amnondominant control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 14
565amnondominant zoological garden, skin, captive, canada, rangifer tarandus, african lion safari, reindeer2019-11-21v3No1 / 14
565amnondominant zoological garden, skin, captive, canada, elephas maximus, african lion safari, asian elephant2019-11-21v3No1 / 14
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, acrosiphonia, acrosiphonia coalita2018-08-01v4No1 / 14
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, codium, codium fragile2018-08-01v4No1 / 14
237amnondominant canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 14
384amnondominant farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 14
898amnoncommon jejunum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 15
327amnondominant nasopharynx, bos taurus, canada, cow2018-04-30v4No1 / 15
169amnon high in spring compared to summer in lake photic zone water fresh water canada depth (water) 0-100cm depth (water) 20-100cm 2017-07-24v4No1 / 15
673amnoncommon research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 15
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 15
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, colpomenia, colpomenia sp. 1peregrina2018-08-01v4No1 / 15
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, laminaria setchelli, laminaria2018-08-01v4No1 / 15
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, ptilota filicina, ptilota2018-08-01v4No1 / 15
470amnondominant feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 15
384amnondominant farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 15
496amnondominant water, sea water, pacific ocean, canada, saanich inlet, depth (water) 100m2019-03-03v4No1 / 15
618amnondominant farm, canada, root endosphere, root, cannabis sativa, late flowering stage2020-05-04v4No1 / 15
318amnondominant ocean, vancouver, pacific ocean, canada, mastocarpus, red alga2018-04-16v4No1 / 16
565amnondominant zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 16
565amnondominant zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 16
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neogastroclonium subarticulatum, neogastroclonium2018-08-01v4No1 / 16
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 16
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 17
898amnondominant male, canada, wild, anatomical space, ascending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 17
673amnondominant research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 17
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, egregia menziesii, egregia2018-08-01v4No1 / 17
355amnoncommon in rocks from high tide zone (dominant ocean, high tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 17
237amnondominant uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 17
611amnondominant research facility, caecum, mus musculus, mouse, cecal content, canada, age 9 months2020-04-21v4No1 / 17
852amnondominant homo sapiens, saliva, adult, canada, non-smoker2021-12-17v4No1 / 17
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 18
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 18
318amnondominant ocean, vancouver, pacific ocean, canada, nereocystis, kelp2018-04-16v4No1 / 18
898amnondominant feces, male, canada, wild, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 18
898amnondominant male, canada, wild, anatomical space, descending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 18
898amnondominant ileum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 18
565amnondominant zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 18
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 18
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, analipus, analipus japonicus, sea fir2018-08-01v4No1 / 18
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, antithamnionella floccosa, antithamnionella2018-08-01v4No1 / 18
355amnonhigh freq. in upright gametophyte of mastocarpus algae (dominant ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, upright gametophyte)2018-08-01v4No1 / 18
355amnonhigher in crustose sporophyte compared to upright gametophyte phase of mastocarpus algae ( high in crustose sporophyte compared to upright gametophyte in ocean pacific ocean canada province of british columbia calvert island mastocarpus alga mastocarpus alaskensis )2018-08-01v4No1 / 18
717amnon high in male male organism compared to female female organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 18
384amnondominant farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 18
537amnonhigh freq. in feces of captive grown deer mice feces (dominant feces, research facility, canada, province of ontario, algonquin provincial park, captive, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 19
898amnondominant caecum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 19
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, fucus, fucus distichus, rockweed2018-08-01v4No1 / 19
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, hildenbrandia2018-08-01v4No1 / 19
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, phylospadix, surfgrass2018-08-01v4No1 / 19
355amnondominant ocean, pacific ocean, ulva, canada, province of british columbia, calvert island, alga, ulva lactuca2018-08-01v4No1 / 19
455amnondominant feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 19
565amnondominant zoological garden, skin, captive, canada, camelus bactrianus, african lion safari, bactrian camel2019-11-21v3No1 / 20
565amnondominant zoological garden, skin, captive, canada, pteropus giganteus, african lion safari, indian flying fox2019-11-21v3No1 / 20
565amnondominant zoological garden, skin, ceratotherium simum, white rhinoceros, captive, canada, african lion safari2019-11-21v3No1 / 20
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 20
355amnonhigh freq. in crustose sporophyte of mastocarpus algae (dominant ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, crustose sporophyte)2018-08-01v4No1 / 20
237amnon high in uropygial gland compared to brood patch in canada bon portage island bird oceanodroma leucorhoa seabird 2017-11-07v4No1 / 20
33amnondominant homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 21
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, gloiopeltis, gloiopeltis furcata, alga, glueweed2018-08-01v4No1 / 21
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, prionitis, prionitis sternbergii2018-08-01v4No1 / 21
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, mazzaella splendens, mazzaella2018-08-01v4No1 / 21
355amnon high in low tide zone compared to high tide zone in ocean pacific ocean canada province of british columbia calvert island alga hildenbrandia hildenbrandia sp. 23gws 2018-08-01v4No1 / 21
717amnondominant homo sapiens, pair of nares, skin, adult, canada, province of ontario, epidermis, inner nostril2028-05-22v3No1 / 21
618amnondominant farm, seedling, canada, root endosphere, root, cannabis sativa, propagation stage2020-05-04v4No1 / 21
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 22
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 22
673amnondominant control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 22
611amnon high in ovariectomy ovariectomized female compared to control in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
611amnon high in control compared to ovariectomy ovariectomized female in female research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 22
265amnonhigh freq. in tree leaves (dominant leaf, canada, province of quebec, tree)2017-12-11v4No1 / 22
455amnondominant homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 22
10amnondominant feces, homo sapiens, toronto2016-10-27v4No1 / 23
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 23
169amnondominant lake, photic zone, water, fresh water, canada, depth (water) 0-100cm, depth (water) 20-100cm2017-07-24v4No1 / 23
717amnon high in female female organism compared to male male organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 23
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, epidermis, umbilicus, bellybutton2028-05-22v3No1 / 23
898amnoncommon ileum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 24
717amnondominant homo sapiens, skin, adult, canada, province of ontario, epidermis, umbilicus, bellybutton2028-05-22v3No1 / 24
618amnondominant farm, canada, root endosphere, root, cannabis sativa, early flowering stage2020-05-04v4No1 / 24
756amnondominant research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 24
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 25
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 25
717amnoncommon homo sapiens, axilla, skin, adult, canada, province of ontario, epidermis, armpit2028-05-22v3No1 / 25
565amnoncommon skin, felis catus, cat, canada2019-11-21v3No1 / 26
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 27
355amnondominant ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pseudolithophyllum, pseudolithophyllum neofarlowii2018-08-01v4No1 / 27
717amnoncommon homo sapiens, pair of nares, skin, adult, canada, province of ontario, epidermis, inner nostril2028-05-22v3No1 / 27
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 29
355amnon high in high tide zone compared to low tide zone in ocean pacific ocean canada province of british columbia calvert island alga hildenbrandia hildenbrandia sp. 23gws 2018-08-01v4No1 / 29
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 31
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 32
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, external nose, epidermis, outer nose2028-05-22v3No1 / 32
611amnon high in female compared to male in research facility caecum mus musculus mouse cecal content canada age 9 months 2020-04-21v4No1 / 33
842sheryoHigher in soil depth of 30-45cm compared to soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 30-45cm compared to depth 15-30cm in soil canada province of ontario daucus carota meadow ecosystem cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed brunisol decomissioned agricultural field )2021-11-14v3No1 / 38
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, saccharina groenlandica, saccharina2018-08-01v4No1 / 39
33amnoncommon homo sapiens, sputum, lung, bronchial epithelium, vancouver2016-12-06v4No1 / 40
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 41
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, laminaria setchelli, laminaria2018-08-01v4No1 / 42
898amnoncommon male, canada, wild, anatomical space, descending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 44
717amnoncommon homo sapiens, dorsum, skin, adult, canada, province of ontario, back, epidermis2028-05-22v3No1 / 44
618amnoncommon farm, seedling, canada, root endosphere, root, cannabis sativa, propagation stage2020-05-04v4No1 / 44
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in nasopharynx bos taurus canada cow )2018-04-30v4No1 / 45
611amnonhigher in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in nicotine dependence compared to control in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v4No1 / 45
898amnoncommon male, canada, wild, anatomical space, ascending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 47
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
898amnoncommon feces, male, canada, wild, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 50
327amnoncommon nasopharynx, bos taurus, canada, cow2018-04-30v4No1 / 50
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 51
653amnon high in saliva compared to tongue dermal layer of tongue in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 55
898amnoncommon caecum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 55
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
237amnoncommon canada, bon portage island, bird, oceanodroma leucorhoa, seabird, brood patch2017-11-07v4No1 / 57
565amnoncommon farm, skin, equus caballus, horse, canada2019-11-21v3No1 / 58
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, plantar part of pes, epidermis, bottom of foot2028-05-22v3No1 / 58
237amnoncommon uropygial gland, canada, bon portage island, bird, oceanodroma leucorhoa, seabird2017-11-07v4No1 / 58
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, laminaria, laminaria yezoensis2018-08-01v4No1 / 61
355amnonlower in rocks from low tide zone compared to high tide zone ( high in high tide zone compared to low tide zone in ocean rock pacific ocean canada province of british columbia calvert island )2018-08-01v4No1 / 62
355amnonhigh freq. in crustose sporophyte of mastocarpus algae (common ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, crustose sporophyte)2018-08-01v4No1 / 66
611amnonlower in feces of mice exposed to cigarette smoke for 6 months compared to controls ( high in control compared to nicotine dependence in research facility caecum mus musculus mouse cecal content canada age 9 months )2020-04-21v4No1 / 66
852amnoncommon homo sapiens, saliva, adult, canada, non-smoker2021-12-17v4No1 / 66
805amnon high in non-smoker compared to nicotine dependence smoker cigarette smoking in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 67
355amnon high in high tide zone compared to low tide zone in ocean pacific ocean canada province of british columbia calvert island alga endocladia endocladia muricata 2018-08-01v4No1 / 68
653amnon high in tongue dermal layer of tongue compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 72
355amnonhigher in rocks from low tide zone compared to high tide zone ( high in low tide zone compared to high tide zone in ocean rock pacific ocean canada province of british columbia calvert island )2018-08-01v4No1 / 74
898amnon high in feces ascending colon descending colon compared to duodenum jejunum in male canada wild adult organism edmonton canis latrans coyote 2022-04-19v4No1 / 78
565amnoncommon skin, canis lupus familiaris, dog, canada2019-11-21v3No1 / 83
565amnoncommon zoological garden, skin, captive, canada, eidolon helvum, toronto zoo, fruit bat2019-11-21v3No1 / 83
618amnon high in cbd yummy cannabis plant compared to cbd shark cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 83
496amnon high in depth (water) 200m compared to depth (water) 100m in water sea water pacific ocean canada saanich inlet 2019-03-03v4No1 / 84
318amnoncommon ocean, vancouver, pacific ocean, canada, nereocystis, kelp2018-04-16v4No1 / 86
355amnonlower in crustose sporophyte compared to upright gametophyte phase of mastocarpus algae ( high in upright gametophyte compared to crustose sporophyte in ocean pacific ocean canada province of british columbia calvert island mastocarpus alga mastocarpus alaskensis )2018-08-01v4No1 / 86
673amnon high in control compared to salmonella enterica subsp. enterica serovar typhimurium salmonellosis in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 88
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, fucus, fucus distichus, rockweed2018-08-01v4No1 / 90
318amnon high in nereocystis kelp compared to mastocarpus red alga in ocean vancouver pacific ocean canada 2018-04-16v4No1 / 94
355amnoncommon ocean, pacific ocean, ulva, canada, province of british columbia, calvert island, alga, ulva lactuca2018-08-01v4No1 / 94
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 96
565amnoncommon zoological garden, skin, captive, canada, rangifer tarandus, african lion safari, reindeer2019-11-21v3No1 / 96
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 30-45cm in soil canada province of ontario daucus carota meadow ecosystem cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed brunisol decomissioned agricultural field )2021-11-14v3No1 / 98
673amnoncommon research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 99
455amnoncommon homo sapiens, saliva, adult, canada, atherosclerosis2019-01-10v4No1 / 100
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 104
565amnoncommon skin, canada, sciurus carolinensis, eastern gray squirrel2019-11-21v3No1 / 104
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 108
565amnoncommon zoological garden, skin, captive, canada, pteropus giganteus, african lion safari, indian flying fox2019-11-21v3No1 / 109
538amnon high in jackson laboratories compared to taconic farms in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 110
565amnoncommon zoological garden, skin, equus przewalskii, captive, canada, toronto zoo, wild horse2019-11-21v3No1 / 112
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 119
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 120
537amnoncommon in feces of captive grown deer mice feces (common feces, research facility, canada, province of ontario, algonquin provincial park, captive, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 121
565amnoncommon zoological garden, skin, captive, canada, camelus bactrianus, african lion safari, bactrian camel2019-11-21v3No1 / 122
565amnoncommon zoological garden, skin, ceratotherium simum, white rhinoceros, captive, canada, african lion safari2019-11-21v3No1 / 122
565amnoncommon zoological garden, skin, acinonyx jubatus, cheetah, captive, canada, african lion safari2019-11-21v3No1 / 123
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
355amnoncommon in upright gametophyte of mastocarpus algae (common ocean, pacific ocean, canada, province of british columbia, calvert island, mastocarpus, alga, mastocarpus alaskensis, upright gametophyte)2018-08-01v4No1 / 129
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 130
384amnoncommon farm, hay, nasal cavity, pair of nares, equus caballus, canada, horse, barn2018-10-22v4No1 / 131
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 132
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
618amnon high in cbd shark cannabis plant compared to cbd yummy cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 139
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 140
209amnon high in vancouver pacific ocean compared to atlantic ocean cape cod canal in ocean sea water north america depth (water) 25cm 2017-10-15v4No1 / 144
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pyropia, pyropia perforata, purple laver2018-08-01v4No1 / 145
611amnoncommon research facility, caecum, mus musculus, mouse, cecal content, canada, age 9 months2020-04-21v4No1 / 145
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, pseudolithophyllum, pseudolithophyllum neofarlowii2018-08-01v4No1 / 146
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, hildenbrandia2018-08-01v4No1 / 146
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, gloiopeltis, gloiopeltis furcata, alga, glueweed2018-08-01v4No1 / 147
355amnoncommon in rocks from high tide zone (common ocean, high tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 148
565amnoncommon zoological garden, skin, captive, canada, elephas maximus, african lion safari, asian elephant2019-11-21v3No1 / 149
565amnoncommon zoological garden, skin, panthera leo, lion, captive, canada, toronto zoo2019-11-21v3No1 / 150
618amnon high in hash cannabis plant compared to cbd shark cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 152
538amnon high in jackson laboratories compared to taconic farms in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 154
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 154
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, mazzaella splendens, mazzaella2018-08-01v4No1 / 155
653amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 157
384amnon high in hay barn compared to pasture in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 161
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 163
906amnoncommon feces, canada, province of ontario, sciurus carolinensis, grey squirrel2022-05-19v4No1 / 165
209amnon high in atlantic ocean cape cod canal compared to vancouver pacific ocean in ocean sea water north america depth (water) 25cm 2017-10-15v4No1 / 166
538amnon high in jackson laboratories compared to taconic farms in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 172
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in an old growth forest in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in soil canada province of ontario forested area luvisol forest cambridge fagus grandifolia acer saccharum subsp. nigrum acer saccharum quercus rubra quercus alba quercus velutina rare charitable research reserve grand river watershed old growth forest )2021-11-14v3No1 / 173
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
384amnoncommon farm, pasture, nasal cavity, pair of nares, equus caballus, canada, horse2018-10-22v4No1 / 175
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, odonthalia floccosa, odonthalia2018-08-01v4No1 / 178
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 182
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, brunisol, mature forest)2021-11-14v3No1 / 182
842sheryoHigher in soil depth of 30-45cm compared to soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 30-45cm compared to depth 15-30cm in soil canada province of ontario daucus carota meadow ecosystem luvisol cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed decomissioned agricultural field )2021-11-14v3No1 / 185
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 186
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, phylospadix, surfgrass2018-08-01v4No1 / 191
618amnon high in cbd shark cannabis plant compared to hash cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 197
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, ralfsia sp.4gws, ralfsia2018-08-01v4No1 / 200
384amnoncommon farm, pasture, saliva, oral cavity, equus caballus, canada, horse, mouth2018-10-22v4No1 / 201
653amnon high in dentition supragingival plaque supragingival dental plaque compared to tongue dermal layer of tongue in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 205
565amnoncommon zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 205
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, early flowering stage2020-05-04v4No1 / 205
355amnoncommon in rocks from low tide zone (common ocean, low tide zone, rock, pacific ocean, canada, province of british columbia, calvert island)2018-08-01v4No1 / 206
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
265amnoncommon in tree leaves (common leaf, canada, province of quebec, tree)2017-12-11v4No1 / 226
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, brunisol, mature forest)2021-11-14v3No1 / 227
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
673amnon high in caecum ascending colon compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, ptilota filicina, ptilota2018-08-01v4No1 / 230
169amnoncommon lake, photic zone, water, fresh water, canada, depth (water) 0-100cm, depth (water) 20-100cm2017-07-24v4No1 / 234
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, antithamnionella floccosa, antithamnionella2018-08-01v4No1 / 235
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, endocladia, endocladia muricata, turfweed2018-08-01v4No1 / 237
384amnon high in pasture compared to hay barn in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 245
618amnon high in cbd yummy cannabis plant compared to hash cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 250
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 30-45cm in soil canada province of ontario daucus carota meadow ecosystem luvisol cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed decomissioned agricultural field )2021-11-14v3No1 / 253
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, colpomenia, colpomenia sp. 1peregrina2018-08-01v4No1 / 255
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, brunisol, mature forest)2021-11-14v3No1 / 261
384amnoncommon farm, hay, saliva, oral cavity, equus caballus, canada, horse, barn, mouth2018-10-22v4No1 / 274
355amnoncommon ocean, surface water, sea water, pacific ocean, canada, province of british columbia, calvert island2018-08-01v4No1 / 280
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, cryptosiphonia woodii, cryptosiphonia2018-08-01v4No1 / 281
384amnon high in hay barn compared to pasture in farm saliva equus caballus canada horse mouth 2018-10-22v4No1 / 283
496amnoncommon water, sea water, pacific ocean, canada, saanich inlet, depth (water) 200m2019-03-03v4No1 / 287
653amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 291
237amnonlower in burrow soil compared to bird ( high in bird oceanodroma leucorhoa seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
384amnon high in pasture compared to hay barn in farm nasal cavity pair of nares equus caballus canada horse 2018-10-22v4No1 / 304
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, polyneura latissima, polyneura2018-08-01v4No1 / 305
653amnon high in tongue dermal layer of tongue compared to dentition supragingival plaque supragingival dental plaque in homo sapiens adult toronto canada third decade human stage 2020-09-13v3No1 / 306
565amnoncommon zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 310
496amnon high in depth (water) 100m compared to depth (water) 200m in water sea water pacific ocean canada saanich inlet 2019-03-03v4No1 / 310
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, acrosiphonia, acrosiphonia coalita2018-08-01v4No1 / 311
565amnoncommon farm, skin, bos taurus, cow, canada2019-11-21v3No1 / 318
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 318
756amnoncommon research facility, caecum, gallus gallus, canada, chicken, broiler chicken, lethbridge, age 35 days2021-03-22v4No1 / 321
565amnoncommon farm, skin, canada, equus asinus africanus, donkey2019-11-21v3No1 / 335
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, prionitis, prionitis sternbergii2018-08-01v4No1 / 345
618amnoncommon farm, canada, root endosphere, root, cannabis sativa, late flowering stage2020-05-04v4No1 / 352
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neorhodomela, neorhodomela larix, red pine algae2018-08-01v4No1 / 364
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, old growth forest)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, mature forest)2021-11-14v3No1 / 393
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, bossiella frondescems, bossiella2018-08-01v4No1 / 399
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, corallina vancouveriensis, corallina, graceful coral seaweed2018-08-01v4No1 / 408
906amnon high in forested area compared to city in feces canada province of ontario sciurus carolinensis grey squirrel 2022-05-19v4No1 / 416
618amnon high in hash cannabis plant compared to cbd yummy cannabis plant in farm rhizosphere canada cannabis sativa flowering stage 2020-05-04v4No1 / 416
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, neogastroclonium subarticulatum, neogastroclonium2018-08-01v4No1 / 419
906amnon high in city compared to forested area in feces canada province of ontario sciurus carolinensis grey squirrel 2022-05-19v4No1 / 421
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in soil canada province of ontario daucus carota meadow ecosystem cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed brunisol decomissioned agricultural field )2021-11-14v3No1 / 432
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, mature forest)2021-11-14v3No1 / 433
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, codium, codium fragile2018-08-01v4No1 / 436
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, plocamium violaceum, plocamium2018-08-01v4No1 / 444
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 0-15cm, mature forest)2021-11-14v3No1 / 460
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, analipus, analipus japonicus, sea fir2018-08-01v4No1 / 461
496amnoncommon water, sea water, pacific ocean, canada, saanich inlet, depth (water) 100m2019-03-03v4No1 / 469
355amnoncommon ocean, pacific ocean, canada, province of british columbia, calvert island, alga, egregia menziesii, egregia2018-08-01v4No1 / 472
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, old growth forest)2021-11-14v3No1 / 507
618amnon high in root endosphere root compared to rhizosphere in farm canada cannabis sativa 2020-05-04v4No1 / 510
618amnoncommon farm, rhizosphere, canada, cannabis sativa, pre-vegetative stage2020-05-04v4No1 / 530
618amnon high in late flowering stage compared to early flowering stage in farm rhizosphere canada cannabis sativa 2020-05-04v4No1 / 533
318amnoncommon ocean, vancouver, pacific ocean, canada, mastocarpus, red alga2018-04-16v4No1 / 598
842sheryoHigher in soil depth 15-30cm compared soil depth of 0-15cm to in a zea mays agricultural field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in soil zea mays canada province of ontario agricultural field luvisol cambridge rare charitable research reserve grand river watershed preston flats )2021-11-14v3No1 / 598
842sheryoHigher in soil depth of 0-15cm compared soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in soil canada province of ontario daucus carota meadow ecosystem cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed brunisol decomissioned agricultural field )2021-11-14v3No1 / 601
384amnon high in saliva oral cavity mouth compared to nasal cavity pair of nares in farm equus caballus canada horse 2018-10-22v4No1 / 604
507amnoncommon lake sediment, sediment, canada, province of british columbia, quesnel lake, sediment depth 0-5cm2019-03-17v4No1 / 604
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil water soilwater in canada province of quebec )2017-12-11v4No1 / 610
237amnoncommon in burrow soil of seabird (common soil, canada, bon portage island, bird, oceanodroma leucorhoa, seabird, burrow)2017-11-07v4No1 / 638
507amnoncommon lake sediment, sediment, canada, province of british columbia, quesnel lake, sediment depth 8-10cm2019-03-17v4No1 / 651
842sheryoHigher in soil depth of 0-15cm compared to soil depth of 15-30cm in an old growth forest in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in soil canada province of ontario forested area luvisol forest cambridge fagus grandifolia acer saccharum subsp. nigrum acer saccharum quercus rubra quercus alba quercus velutina rare charitable research reserve grand river watershed old growth forest )2021-11-14v3No1 / 653
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
237amnonhigher deep in burrow compared to burrow entrance ( high in deep burrow compared to surface burrow in soil canada bon portage island bird oceanodroma leucorhoa seabird burrow )2017-11-07v4No1 / 676
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common soil, zea mays, canada, province of ontario, agricultural field, luvisol, cambridge, rare charitable research reserve, grand river watershed, preston flats, depth 30-45cm)2021-11-14v3No1 / 676
507amnon high in sediment depth 8-10cm compared to sediment depth 0-5cm in lake sediment sediment canada province of british columbia quesnel lake 2019-03-17v4No1 / 765
842sheryoCommoon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 30-45cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 768
384amnon high in nasal cavity pair of nares compared to saliva oral cavity mouth in farm equus caballus canada horse 2018-10-22v4No1 / 791
618amnoncommon farm, rhizosphere, canada, cannabis sativa, late flowering stage2020-05-04v4No1 / 819
318amnon high in mastocarpus red alga compared to nereocystis kelp in ocean vancouver pacific ocean canada 2018-04-16v4No1 / 827
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 0-15cm, old growth forest)2021-11-14v3No1 / 834
265amnoncommon water, canada, province of quebec, soilwater2017-12-11v4No1 / 841
618amnoncommon farm, rhizosphere, canada, cannabis sativa, early flowering stage2020-05-04v4No1 / 873
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 15-30cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 905
842sheryoHigher in soil depth of 0-15cm compared to soil depth 15-30cm in a zea mays agricultural field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in soil zea mays canada province of ontario agricultural field luvisol cambridge rare charitable research reserve grand river watershed preston flats )2021-11-14v3No1 / 924
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common soil, zea mays, canada, province of ontario, agricultural field, luvisol, cambridge, rare charitable research reserve, grand river watershed, preston flats, depth 15-30cm)2021-11-14v3No1 / 944
842sheryoCommon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 30-45cm, decomissioned agricultural field)2021-11-14v3No1 / 970
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 15-30cm, decomissioned agricultural field)2021-11-14v3No1 / 974
618amnon high in early flowering stage compared to late flowering stage in farm rhizosphere canada cannabis sativa 2020-05-04v4No1 / 1040
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in soil canada province of ontario daucus carota meadow ecosystem luvisol cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed decomissioned agricultural field )2021-11-14v3No1 / 1044
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 1082
265amnoncommon soil, canada, province of quebec2017-12-11v4No1 / 1090
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common soil, zea mays, canada, province of ontario, agricultural field, luvisol, cambridge, rare charitable research reserve, grand river watershed, preston flats, depth 0-15cm)2021-11-14v3No1 / 1147
507amnon high in sediment depth 0-5cm compared to sediment depth 8-10cm in lake sediment sediment canada province of british columbia quesnel lake 2019-03-17v4No1 / 1157
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in soil canada bon portage island bird oceanodroma leucorhoa seabird burrow )2017-11-07v4No1 / 1247
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, decomissioned agricultural field)2021-11-14v3No1 / 1281
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1681
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in soil canada province of ontario daucus carota meadow ecosystem luvisol cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed decomissioned agricultural field )2021-11-14v3No1 / 1723
507amnonlower in mine tailing contaminated sediment compared to uncontaminated control ( high in control compared to contaminated sediment in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1825
265amnon high in soil compared to water soilwater in canada province of quebec 2017-12-11v4No1 / 2715
618amnon high in rhizosphere compared to root endosphere root in farm canada cannabis sativa 2020-05-04v4No1 / 3134
265amnon high in water soilwater compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird oceanodroma leucorhoa seabird in canada bon portage island )2017-11-07v4No1 / 3656

Problems / suggestions? Please email info AT dbbact DOT org