Summary for ontology term: caucasian

Number of annotations with term: 14

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAAGCAGGCCTGCCTCGTTTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAA0.300000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCCGTGGTCAAGCCGCGACGTGGGTCGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.300000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__KingellaTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTCTGAAGAAGGCCTTCGGGTTGTAAAGGACTTTTGTTAGGGAAGAAAAGGATAATGTTAATACCATTATCTGCTGACGGTACCTAAAGAATAAGCACCGGC0.300000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTCGCCAGTGAAGCAGGCCTGTCCCTTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAACT0.300000
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae";g__LeptotrichiaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCAATTCTGTGTGCACGAAGAAGGTTTTCGGATTGTAAAGTGCTTTCAGCAGGGAAGAAGAAAGTGACGGTACCTGCAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGCG0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCTCATGGTCAAGCCGCAACAATGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGAGTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.200000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__LautropiaTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGTGTGATGAAGGCCTTCGGGTTGTAAAGCACTTTTGGCGGGAACGAAAAGGACTGTGCCAATACCACGGTTCGATGACGGTACCCGCAGAATAAGCACCGGC0.200000
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCACGCAGGCGGTAAGATAAGTCAGATGTGAAAGTTTTCAGCTTAACTGAGAAAGTGCATTTGAAACTATCCTACTTGAGTCTCGGAGAGGTAAGCGGAATTCCTAG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGGAAGCAAGTCAGACGTGAAAACTATGGGCTCAACCCATAACGTGCGTTTGAAACTGTTTTTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCGAG0.100000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaGTAAGAATATTCCGCAATGGGGGGAACCCTGACGGAGCGACGCCGCGTGAACGAAGAAGGCCGGAAGGTTGTAAAGTTCTTTTCTGTCCGAGGAATAAGTGTAGGAGGAAATGCCTGCATGGTGACGGTAGGGCAGGAATAAGCACCGGC0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACTGCCCTATGGGTTGTAAACTGCTTTTATGCGGGGATAAAGTGAGTTACGTGTAACTTATTGCAGGTACCGCATGAATAAGGACCGGCTAATT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGGATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGATGATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCTAAGAATATTCCGCAATGGACGGAAGTCTGACGGAGCGACGCCGCGTGGATGAAGAAGGCTGAAAAGTTGTAAAATCCTTTTGTTGATGAAGAATAAGGGTGAGAGGGAATGCTCATCTGATGACGGTAATCGACGAATAAGCCCCGGC0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCGACGCCGCGTGAGTGAAGAAGTATCTCGGTACGTAAAGCTCTATCAGCAGGGAAGAAAAAAGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGCACGGGACGAAAACCGAGCTTGAAAATATTGAGCTTGGGTGACGGTACCGAGCGAGGAAGCCACGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__PropionibacteriaceaeTGGGGAATATTGCACAATGGACGGAAGTCTGATGCAGCAACGCCGCGTGCGGGATGACGGCCTTCGGGTTGTAAACCGCTTTCATCCATGACGAAGCTTTTGTGACGGTAGTGGGTAAAGAAGCACCGGCTAACTACGTGCCAGCAGCCG0.333333
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__CapnocytophagaTGAGGAATATTGGACAATGGTCGGAAGACTGATCCAGCCATGCCGCGTGCAGGAAGACGGCCTTATGGGTTGTAAACTGCTTTTGCAGGGGAAGAATAAGGACTACGAGTAGTTTGATGACGGTACTCTGCGAATAAGCATCGGCTAACT0.333333
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATTCCGCGTGCAGGATGAAGGCCCTCGGGTTGTAAACTGCTTTTGTACAGAACGAAAAAGGCCTGGCTAATATCTGGGTCTCATGACGGTACTGTAAGAATAAGCACCGGC0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTGGGGAATCTTCCGCAATGGGCGCAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAGCTCTGTTGATGGGGACGAACGTGCGAAGGGTGAATAATCCTTTGCAATGACGGTACCTATCGAGGAAGCCACGG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__KingellaTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTCTGAAGAAGGCCTTCGGGTTGTAAAGGACTTTTGTTAGGGAAGAAAAGGATAATGTTAATACCATTATCTGCTGACGGTACCTAAAGAATAAGCACCGGC0.375000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGTTAGGGACGAAGCCACACCTTTTTTGGGTGTGGTGACGGTACCTTTGTTAAGAAGCACCGGCTAAC0.230769
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCGACGTCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCAGTGAGGAAGGCCTTGCCCGTGTGGTGGGGTTGACGGTAGCTGGGTTAATTGAAGCGCCGGCTA0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCCCGTGGTCAAGCCGCGACGTGGGTCGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.200000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTGAACCTCTTTCGCTCATGGTCAAGCCGCAACAATGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTACG0.181818
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTCGCCAGTGAAGCAGGCCTGTCCCTTGTGGGTGGGTTGACGGTAGCTGGATAAGAAGCGCCGGCTAACT0.173913
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinobaculumGACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGAAAGGCCCTTCCTTTTTTGGTTGGGTGCTCGAGTGGCGAACGGGTGAGTATTACGTGAGTAACCTGCCCTCAACTGTGGGATAAGCCTGGGAAACTGGGTCTAATACT0.166667
d__BacteriaTACGTAGGGAGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGATGGATAGGCAAGTTGGTTGTGAAATACCTCGGCTCAACTGAGGAACTGCAGCCAAAACTACAAATCTTGAGTACTGGAGGGGAAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGAGTGCATTGGAAACTGTTTTTCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGTGCAAGTCTGGAGTGAAAACCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGTATCTAGAGTGCTGGAGAGGCAAGTGGAATTCCTAG0.166667

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
caucasian0.750000
LOWER IN caucasian0.750000
LOWER IN asian0.666667
asian0.666667
european0.500000
burmese0.500000
LOWER IN european0.500000
6-year-old human stage0.500000
8-year-old human stage0.500000
9-year-old human stage0.500000
10-year-old human stage0.500000
11-year-old human stage0.500000
LOWER IN burmese0.500000
african american0.500000
LOWER IN african american0.500000
african0.500000
LOWER IN african0.500000
7-year-old human stage0.333333
hispanic0.333333
LOWER IN hispanic0.333333
state of nebraska0.250000
hispanic or latin american0.250000
LOWER IN hispanic or latin american0.250000
supragingival dental plaque0.142857
supragingival plaque0.100000
vagina0.090909
state of new york0.083333
pregnancy0.083333
dentition0.043478
child0.027778
female0.015873
united states of america0.012146
homo sapiens0.011070
adult0.005780
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
united states of america1.000000
caucasian0.642857
european0.571429
dentition0.571429
child0.571429
state of nebraska0.571429
supragingival plaque0.571429
supragingival dental plaque0.571429
6-year-old human stage0.571429
7-year-old human stage0.571429
8-year-old human stage0.571429
9-year-old human stage0.571429
10-year-old human stage0.571429
11-year-old human stage0.571429
LOWER IN caucasian0.357143
feces0.285714
adult0.285714
state of new york0.285714
LOWER IN european0.285714
LOWER IN asian0.142857
asian0.142857
african american0.142857
LOWER IN african american0.142857
female0.142857
pregnancy0.142857
vagina0.142857
burmese0.071429
LOWER IN burmese0.071429
hispanic or latin american0.071429
hispanic0.071429
LOWER IN hispanic or latin american0.071429
LOWER IN hispanic0.071429
african0.071429
LOWER IN african0.071429
Exp. ID User ID Description Date Region Flag Sequences
658amnon high in caucasian european compared to african american in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
658amnon high in caucasian european compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
658amnon high in african american compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
658amnon high in hispanic or latin american hispanic compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 23
658amnon high in caucasian european compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 30
528amnon high in african american african compared to caucasian in homo sapiens united states of america female pregnancy vagina 2019-07-14v1No1 / 34
528amnon high in caucasian compared to african american african in homo sapiens united states of america female pregnancy vagina 2019-07-14v1No1 / 38
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
658amnoncommon homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 82
658amnon high in asian burmese compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 212
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475

Problems / suggestions? Please email info AT dbbact DOT org