Summary for ontology term: cefoperazone

Number of annotations with term: 2

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACTTCTTCTCCTCTCTTTCTCCGGCTTTCTTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACTGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGGTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTCTGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGGGACTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCGAAACTGGCAGGCTTGAGTCTCGTAGAGGGAGGTAGAATTCCAGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGGAGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCCCCCGTCCCCTTGCAGTTGATCCTGGCTGTCTTGAGTACCTTCTCTGTTTTCTTCCTTCTTTT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Paenibacillaceae 1;g__PaenibacillusTACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTGTTTAAGTCTGGTGTATAATCCTGGGGCTCAACCCCGGGTCGCACTGGAAACTGGGCAGCTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTCCTTCTTCTCCTCTCTTTCTCCTTCTTTCTTTTTTTTCCCGGGAGCGTAGGTGGACCGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGTCTGGAGTGAAAACCTGGGGCTCAACCCCAGGACTGCTTTGGAAACTGTGCAGCTTGAGTATCGGAGGGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTCTGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGGAGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATCACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGCCTGAAGTGAAAGGCGGGGGCCCAACCCCCGGACTGCTTTGGGAACTGTACGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGCGCAAGTCTGGAGTGAAATCCCATGGCTTAACCATGGAACTGCTTTGGAAACTGTGCAGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTGTGGCTGGAGTGTCGGAGAGGCAGGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGCAACCTAAGCGCAGGGTTTAAGGCAATGGCTCAACCATTGTTCGCCCTGCGAACTGGGATGCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGTAAGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTTATCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCCATGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTGCGGCTGGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCTGTGCAAGTCTGGAGTGAAAGGCGGGGGCCCAACCCCCGGACTGCTCTGGAAACTGTAAAGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGGGGCAAGTCTGGAGTGAAAGGCCGGGGCCCAACCCCGGGACCGCTCTGGAAACTGCCCGGCTGGAGTGCGGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCATGGCAAGCCAGAAGTGAAAACCCGGGGCTTAACCCCGCGGATTGCTTTTGGAACTGTCAGGCTGGAGTGCAGGAGGGGCAGGCGGAATTCCTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCCTGGCAAGCCTGATGTGAAATACCGGGGCCCAACCCCGGGGCTGCATTGGGAACTGCCAGGCTGGAGTGCCGGAGAGGCAGGCGGAATTCCTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACTTCTTCTCCTCTCTTTCTCCGGCTTTCTTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACTGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGGTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGGAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTGGAGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCCCCCGTCCCCTTGCAGTTGATCCTGGCTGTCTTGAGTACCTTCTCTGTTTTCTTCCTTCTTTT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Paenibacillaceae 1;g__PaenibacillusTACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTGTTTAAGTCTGGTGTATAATCCTGGGGCTCAACCCCGGGTCGCACTGGAAACTGGGCAGCTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTCCTTCTTCTCCTCTCTTTCTCCTTCTTTCTTTTTTTTCCCGGGAGCGTAGGTGGACCGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SporomusaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGTGTAGGTGGATCTTTAAGTCGTGTGTCTAAGTGCGGTGCTCAACGCCGTATGGGCGCAGGAAACTGGGGATCTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGTGGATATTTAAGTGGGATGTGAAATACTCGGGCTTAACCTGGGTGCTGCATTCCAAACTGGATATCTAGAGTACAGGAGAGGAAAGTAGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGGATATTAAGTCTGTCTTAAAAGTTCGGGGCTCAACCCCGTGATGGGATGGAAACTAATATTCTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTCAAATTGCAGTTGCTACTGGCTGTCTTGAGTACCTTCTCTTTTTTCTTCCTTCTTTT0.500000

Annotations:

common ontology terms
term enrichment score
TermScore
cefoperazone0.500000
LOWER IN cefoperazone0.500000
c57bl/6j0.181818
antibiotic0.111111
LOWER IN antibiotic0.111111
mouse0.034483
mus musculus0.031250
research facility0.013514
LOWER IN control0.010695
control0.010695
united states of america0.008065
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
cefoperazone0.500000
LOWER IN cefoperazone0.500000
c57bl/6j0.100000
antibiotic0.062500
LOWER IN antibiotic0.062500
mouse0.017544
mus musculus0.015873
research facility0.006803
LOWER IN control0.005405
control0.005405
united states of america0.004049
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
united states of america1.000000
research facility1.000000
mus musculus1.000000
c57bl/6j1.000000
mouse1.000000
antibiotic0.500000
cefoperazone0.500000
LOWER IN control0.500000
control0.500000
LOWER IN antibiotic0.500000
LOWER IN cefoperazone0.500000

Problems / suggestions? Please email info AT dbbact DOT org