Summary for ontology term: central african republic

Number of annotations with term: 11

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__SolobacteriumTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCTGTTAAGTAAGTGGTTAAATTGTTGGGCTCAACCCAATCCAGCCACTTAAACTGGCAGGCTAGAGTATTGGAGAGGCAAGTGGAATTCCATGT0.200000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAACAAGTCTGAAGTGAAAGCCCGGGGCTCAACCGCGGGACTGCTTTGGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGCGGTTTCTTAAGCGCGGGGTGAAAGGCAGTGGCTTAACCACTGTTAGCCCTGCGAACTGGGAGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.100000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTGTCAAGTCAGCGGTCAAAAGTCGGGGCTCAACCCCGTGAAGCCGTTGAAACTGGCGGTCTTGAGTGAGCGAGAAGTAGGCGGAATGCGTGGT0.100000
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGTGTGTAGGCGGTTTATTAAGTCTAAGATAAAAGCCCGAGGCTTAACCTCGGTTCGTCTTAGAAACTGGTAGACTTGAGTGCAGTAGAGGCAAGTGGAATTTCTAGT0.100000
d__BacteriaTACGTAGGTAGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTAACAAGTTGGTAGTGAAATTCCGAAGCTTAACTTCGGCGCTACTACCAAGACTGTTGAACTTGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.100000
d__BacteriaAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.100000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGTTAAGCGTGTTGTGAAATGTCGTGGCTCAACCTGGGCATTGCAGCGCGAACTGGCAGACTTGAGTGCGCGGGAAGTAGGCGGAATTCGTCG0.100000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.666667
d__BacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTGTGTAGGCGGCTTTATAAGATAGCGGTGAAATACCTGGGCTTAACCTAGGAACTGCCGTTATTACTATAGAGCTAGAGTGATAGAGAGGATATTGGAATACCCAG0.666667
d__BacteriaTACGGAAGGTTCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACTTTTAAGTCAGCTGTGAAATCTGGCGGCTCAACCGTCAGACTGCAGTTGATACTGGAAGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTCAGGAAAGTCTGGAGTAAAAGGCTATGGCTCAACCATAGTGTGCTCTGGAAACTGTCTGACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATGGACAAGTCTGATGTGAAAGGCTGGGGCTCAACCCCGGGACTGCATTGGAAACTGCCCGTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.666667
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTATTAAGTCTGATGTGAAAGCCAATGGCCTAACCATTGAATTGCATTGGAAACTGGTAAACTAGAATACTGGAGAGGTAAGTGGAACTCCATG0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCGAGCGTTAATCGGAATCACTGGGCGTAAAGCGCACGTAGGCTGTTTTGTAAGTCAGAGGTGAAAGCCCACGGCTCAACCGTGGAACTGCCTTTGATACTGCTTGACTAGAATCCGGGAGAGGGTGGCGGAATTCCAGG0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGGATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.266667
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCGTTCTGAACTGGGTAACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.266667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGTACAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGAACTGCTTTGGAAACTGTACAGCTAGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGGCGGGCTGGTAAGTTGGAAGTGAAATCTAGGGGCTTAACCCCTAAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCCAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATACAAGTCAGGAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTATCCCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.222222
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGATAGTCAGTCAGGTGTGAAATCCTATGGCTTAACCATAGAACTGCATTTGAAACTACTATTCTAGAGTGTGGGAGAGGTAGGTGGAATTCTTGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAATCCACGGGCTTAACCCGTGAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.210526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATTGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.206897
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAATCCATGGGCTTAACCCGTGAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.190476

Annotations:

common ontology terms
term enrichment score
TermScore
central african republic0.734694
bangui0.560000
madagascar0.470588
stunted growth0.352941
age 2-5 years0.266667
LOWER IN antananarivo0.266667
antananarivo0.266667
LOWER IN bangui0.266667
LOWER IN madagascar0.235294
LOWER IN central african republic0.235294
duodenum0.145455
iga positive fraction0.125000
LOWER IN iga negative fraction0.125000
iga negative fraction0.125000
LOWER IN iga positive fraction0.125000
child0.105263
africa0.100000
stomach0.071429
homo sapiens0.014652
feces0.012592
Fraction of dbbact annotations with this term covered by the query
TermScore
central african republic0.666667
madagascar0.666667
age 2-5 years0.500000
bangui0.500000
LOWER IN antananarivo0.500000
antananarivo0.500000
LOWER IN bangui0.500000
stunted growth0.500000
LOWER IN madagascar0.333333
LOWER IN central african republic0.333333
iga positive fraction0.200000
LOWER IN iga negative fraction0.200000
iga negative fraction0.200000
LOWER IN iga positive fraction0.200000
duodenum0.090909
stomach0.058824
child0.055556
africa0.052632
homo sapiens0.007380
feces0.006369
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
child1.000000
africa1.000000
central african republic0.818182
bangui0.636364
feces0.545455
madagascar0.363636
duodenum0.363636
stunted growth0.272727
age 2-5 years0.181818
LOWER IN madagascar0.181818
LOWER IN antananarivo0.181818
antananarivo0.181818
LOWER IN central african republic0.181818
LOWER IN bangui0.181818
iga positive fraction0.090909
LOWER IN iga negative fraction0.090909
iga negative fraction0.090909
LOWER IN iga positive fraction0.090909
stomach0.090909
Exp. ID User ID Description Date Region Flag Sequences
425amnondominant feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 15
425amnondominant homo sapiens, stomach, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 23
425amnondominant homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 25
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens duodenum child africa 2018-12-08v4No1 / 33
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564

Problems / suggestions? Please email info AT dbbact DOT org