Summary for ontology term: cetartiodactyla

Number of annotations with term: 453

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.006652
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.006652
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.006652
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCTTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTATGACTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.006652
d__BacteriaTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTCTCAAAACTGTATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.006652
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTTATAAGTTAGAGGTGAAATTTCGGTGCTCAACACCGACACTGCCTCTAATACTGTAGGACTAGAGAGTAGTTGCGGTAGGCGGAATGTGTAG0.006652
d__Bacteria;p__FirmicutesTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGTTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAACTGCTTTGGATACTGATGGGCTTGAGTGCAGGAGAGGTAAGCGGAATTCCCGG0.006652
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTCAGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGCATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.006652
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XIIITACGTAGGGGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTTACCTAAGCAGGGGGTGAAAGGCAATGGCTCAACCATTGTTAGCCCCCTGAACTGGGCTACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.006652
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGTCAAGCCAGATGTGAAAGCCCGGGGCTTAACCCCGTGGATTGCATTTGGAACTGGCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTA0.006652

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTCAAAACTGTATCCCTTGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCACGTCAAGCCAGATGTGAAAGCCCGGGGCTTAACCCCGTGGATTGCATTTGGAACTGGCGAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTA0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGCGGCCTGGCAAGCCAGATGTGAAAGCCCGCGGCTCAACTGCGGGACTGCATTTGGAACTGTTAGGCTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAG0.250000
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAAAACAAGTTGGTTGTGAAATCCCTCGGCTTAACTGAGGAACTGCAACCAAAACTATTTTTCTTGAGTACTGGAGAGGAAAGTGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTCAGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTATCCCTTGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.250000
d__BacteriaTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGCACCGCAAGTCAGTTGTGAAACCCCTGAGCTCAACTCAGGGCTTGCAATTGAAACTGCGGAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGACCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGGTAAGTTAGAGGTGAAATTTTTAGGCTCAACCTAGACATTGCCTCTGATACTGCCGAGCTAGAGAGTAGTTGCTGTGGGCGGAATGTATGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTTGAAACTGTCGTTCTTGAGTACTGGAGAGGTTGACGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTCGGGGCTCAACCTCGAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.250000
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGCCCTCAAGTCAGACGTGAAAGCCATAGGCTCAACCTGTGAATTGCGTTTGAAACTGAGGGTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.250000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGAATATTGGGCAATGGGCGAAAGCCTGACCCAGCAACGCCGCGTGAAGGAAGAAGGTCTTCGGATTGTAAACTTCTTTTATGAGGGACGAAGGACGTGACGGTACCTCATGAATAAGCCACGGCTAACTACGTGCCAGCAGCCGCG0.259516
d__BacteriaTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTCAAAACTGTATCCCTTGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.235294
d__BacteriaTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTCAAAACTGCATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.232558
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCTGCAAGTCAGATGTGAAATCCCGGGGCTCAACCCCGGAACTGCATTTGAAACTGTAGCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.221465
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTCAGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTATCCCTTGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.198915
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGATATTAAGTCAGTCGTCAAAGCCTGTGGCTCAACCACAGCCCGCGATTGATACTGGTAACCTTGAGTGCGGATGAGGTGGATGGAATTCGTGGT0.197674
d__Archaea;p__"Euryarchaeota";c__Methanobacteria;o__Methanobacteriales;f__Methanobacteriaceae;g__MethanobrevibacterCACCGGCAGCTCTAGTGGTAGCAATTTTTATTGGGCCTAAAGCGTCCGTAGCCGGTTTAATAAGTCTCTGGTGAAATCCTGTAGCTTAACTGTGGGAATTGCTGGAGATACTATTAGACTTGAGACCGGGAGAGGTTAGAGGTACTCCCA0.191729
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGATGCCGCGTGGAGGAAGAAGGTTTTCGGATTGTAAACTCCTGTCTTAAAGGACGATAATGACGGTACTTTAGGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.189189
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.186317
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGAACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.184725

Annotations:

common ontology terms
term enrichment score
TermScore
rumen0.399762
sus scrofa0.333858
pig0.324857
bos taurus0.319109
ovis aries0.312849
sheep0.267686
farm0.221438
cow0.180723
research facility0.158326
ruminal fluid0.151020
china0.130145
feces0.125883
bos grunniens0.120332
wild0.113270
rumen liquid0.112500
yak0.112500
kenya0.110020
skin0.106409
caecum0.105389
female organism0.104599
age 6 weeks0.104283
ileum0.103363
zoological garden0.100358
western australia0.097928
united states of america0.093192
canada0.092352
lamb0.091223
holstein dairy cow0.091223
age 1 year0.089194
masai mara national park0.088531
colon0.085002
tibet autonomous region0.083391
italy0.082225
state of michigan0.072333
goat0.071821
capra hircus0.071821
captive0.070000
calve0.067086
deer0.067086
male organism0.066710
jejunum0.066528
tonsil0.062868
pregnancy0.061264
south africa0.060038
state of mississippi0.058212
duodenum0.057213
province of alberta0.056566
male0.055300
new zealand0.053537
shandong province0.053537
riwoqe county0.051613
ireland0.049689
control0.049011
juvenile stage0.047904
state of georgia0.047904
age 140 days0.046858
commonwealth of pennsylvania0.046784
australia0.045022
LOWER IN ileum0.041408
LOWER IN caecum0.038986
megaptera novaeangliae0.038585
humpback whale0.038585
LOWER IN jejunum0.038400
ascending colon0.037500
LOWER IN colon0.036923
LOWER IN rumen0.036923
cape buffalo0.034409
syncerus caffer caffer0.034409
reindeer0.034409
rangifer tarandus0.034409
dairy goat0.034115
alpine meadow0.034115
african lion safari0.034115
elaphurus davidianus0.034115
pere deer0.034115
dairy0.034115
holstein-friesian bull0.034115
age 2 months0.033827
age 30 days0.033543
rectum0.033172
mouth mucosa0.033149
shanxi province0.032990
qinghai province0.032720
female0.032362
LOWER IN control0.032106
tibetan plateau0.031936
diet0.031633
french republic0.031088
belgium0.030948
united kingdom0.030683
oral cavity0.030612
giraffa camelopardalis0.030281
impala0.030205
aepyceros melampus0.030205
obsolete_juvenile stage0.030019
omasum0.029979
germany0.028674
adult organism0.028319
gauteng province0.026144
giraffe0.026030
Fraction of dbbact annotations with this term covered by the query
TermScore
rumen1.043478
ovis aries1.000000
sheep1.000000
bos taurus1.000000
rumen liquid1.000000
ruminal fluid1.000000
bos grunniens1.000000
cow1.000000
yak1.000000
damara sheep1.000000
gauteng province1.000000
meatmaster sheep1.000000
LOWER IN damara sheep1.000000
LOWER IN meatmaster sheep1.000000
riwoqe county1.000000
kazakhstan1.000000
pig0.937500
sus scrofa0.937500
goat0.833333
capra hircus0.833333
lamb0.750000
giraffe0.750000
tursiops truncatus0.750000
tibet autonomous region0.750000
giraffa camelopardalis0.750000
holstein dairy cow0.750000
LOWER IN omasum0.750000
LOWER IN ruminant reticulum0.750000
age 140 days0.666667
eland0.666667
tragelaphus oryx0.666667
impala0.666667
aepyceros melampus0.666667
cape buffalo0.666667
syncerus caffer caffer0.666667
reindeer0.666667
rangifer tarandus0.666667
bottlenosed dolphin0.666667
calve0.666667
wild boar0.666667
delphinus delphis0.666667
abomasum0.666667
deer0.666667
megaptera novaeangliae0.666667
humpback whale0.666667
restricted feed0.666667
jejunum0.571429
LOWER IN jejunum0.571429
duroc pig0.500000
thomson's gazelle0.500000
eudorcas thomsonii0.500000
masai mara national park0.500000
kenya0.500000
cattle0.500000
kirk's dik-dik0.500000
madoqua kirkii0.500000
giraffa tippelskirchi0.500000
tsessebe0.500000
damaliscus lunatus0.500000
warthog0.500000
phacochoerus africanus0.500000
LOWER IN cattle0.500000
LOWER IN tsessebe0.500000
LOWER IN damaliscus lunatus0.500000
LOWER IN woodland0.500000
LOWER IN yamalo-nenets autonomous okrug0.500000
woodland0.500000
yamalo-nenets autonomous okrug0.500000
mikura-jima0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
tibetan pig0.500000
tibetan swine0.500000
low selenium0.500000
LOWER IN low selenium0.500000
LOWER IN acidosis0.500000
LOWER IN subacute rumen acidosis0.500000
dairy goat0.500000
subacute rumen acidosis0.500000
acidosis0.500000
LOWER IN 5-6 hours0.500000
1-2 hours0.500000
5-6 hours0.500000
LOWER IN 1-2 hours0.500000
sus scrofa domesticus0.500000
short beaked common dolphin0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
pygmy hippopotamus0.500000
hexaprotodon liberiensis0.500000
hippopotamus amphibius0.500000
lama guanicoe0.500000
mouflon0.500000
ovis aries musimon0.500000
camel0.500000
camelus dromedarius0.500000
LOWER IN fresh clover diet0.500000
clover hay diet0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.381898
research facility0.322296
rumen0.247241
united states of america0.238411
china0.222958
sus scrofa0.203091
pig0.196468
bos taurus0.189845
ovis aries0.185430
sheep0.154525
farm0.152318
cow0.099338
skin0.097130
ruminal fluid0.081678
wild0.075055
italy0.075055
caecum0.072848
canada0.070640
bos grunniens0.064018
female organism0.064018
age 6 weeks0.061810
kenya0.061810
zoological garden0.061810
ileum0.059603
rumen liquid0.059603
yak0.059603
age 1 year0.057395
western australia0.057395
australia0.057395
colon0.050773
control0.050773
lamb0.048565
masai mara national park0.048565
holstein dairy cow0.048565
captive0.046358
tibet autonomous region0.044150
state of michigan0.044150
male0.039735
goat0.037528
capra hircus0.037528
male organism0.037528
jejunum0.035320
calve0.035320
deer0.035320
south africa0.035320
pregnancy0.035320
tonsil0.035320
new zealand0.030905
duodenum0.030905
province of alberta0.030905
shandong province0.030905
state of mississippi0.030905
germany0.026490
juvenile stage0.026490
state of georgia0.026490
riwoqe county0.026490
commonwealth of pennsylvania0.026490
ireland0.026490
age 140 days0.024283
LOWER IN control0.024283
united kingdom0.024283
LOWER IN ileum0.022075
adult0.022075
LOWER IN caecum0.022075
female0.022075
LOWER IN jejunum0.019868
LOWER IN colon0.019868
LOWER IN rumen0.019868
mouth mucosa0.019868
oral cavity0.019868
ascending colon0.019868
megaptera novaeangliae0.019868
humpback whale0.019868
french republic0.019868
qinghai province0.017660
cape buffalo0.017660
syncerus caffer caffer0.017660
reindeer0.017660
rangifer tarandus0.017660
dairy goat0.017660
shanxi province0.017660
diet0.017660
tibetan plateau0.017660
alpine meadow0.017660
african lion safari0.017660
elaphurus davidianus0.017660
pere deer0.017660
adult organism0.017660
belgium0.017660
age 2 months0.017660
rectum0.017660
age 30 days0.017660
obsolete_juvenile stage0.017660
dairy0.017660
holstein-friesian bull0.017660
impala0.015453
aepyceros melampus0.015453
giraffa camelopardalis0.015453
omasum0.015453
LOWER IN duodenum0.013245
Exp. ID User ID Description Date Region Flag Sequences
157amnonhigh in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in control low selenium compared to selenium in nasal cavity bos taurus calve united states of america juvenile organism pair of nares )2017-07-04v4No1 / 1
491amnonlower in lambs fed linseed oil supplemented diet compared to control diet ( high in control diet compared to linseed oil food product in ovis aries sheep lamb child rumen ireland farm age 100 days )2019-02-26v4No1 / 1
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to duodenum jejunum caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
525amnoncow mitochondrial dna (other bos taurus, mitochondrion, cow)2019-07-10v4No1 / 1
439amnonpresent only in abomasum in yak rumen ( high in abomasum compared to omasum ruminant reticulum in bos grunniens yak rumen farm china )2018-12-31v4No1 / 2
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, omasum2018-08-29v4No1 / 2
592amnondominant united states of america, feces, commonwealth of pennsylvania, wild, sheep, ovis aries2020-02-18v1No1 / 2
561amnondominant bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 3
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-29v4No1 / 3
327amnonhigher in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in antibiotic compared to control in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 4
329amnondominant ovis aries, sheep, kingdom of norway, rumen2018-05-13v4No1 / 4
931amnondominant riwoqe county, china, ruminal fluid, yak, tibet autonomous region, bos grunniens, rumen2022-08-25v3No1 / 4
491amnonhigher in lambs fed linseed oil supplemented diet compared to control diet ( high in diet linseed oil food product compared to control diet in ovis aries sheep lamb child rumen ireland farm age 100 days )2019-02-26v4No1 / 4
79amnondominant skin, united states of america, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 4
666amnondominant cow, bos taurus, italy, feces2020-09-25v3No1 / 5
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, rumen, research facility2022-05-18v3No1 / 5
79amnondominant peponocephala electra, skin, united states of america2017-03-03v4No1 / 5
88amnonhigher in younger cape buffalo feces ( high in age young age compared to old age in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 5
649amnondominant jejunum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 6
49amnonincreases during sample storage in giraffe feces (other giraffa camelopardalis, feces)2017-01-19v4No1 / 6
910amnondominant age 140 days, holstein dairy cow, calve, germany, bos taurus, rumen, juvenile stage, research facility2022-05-20v1No1 / 6
929amnondominant damara sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v3No1 / 6
931amnondominant riwoqe county, china, yak, tibet autonomous region, bos grunniens, ileum, colon, caecum, feces2022-08-25v3No1 / 6
700amnon high in tylosin phosphate antibiotic compared to control in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 6
592amnondominant feces, united states of america, bos taurus, cow, farm, commonwealth of pennsylvania2020-02-18v1No1 / 6
275amnonlower in fall 2010 compared to summer 2013 in whale skin ( high in summer compared to autumn in megaptera novaeangliae humpback whale antarctica antarctic peninsula skin )2018-01-16v4No1 / 6
781amnondominant cattle, bos taurus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 7
666amnondominant sheep, ovis aries, italy, feces2020-09-25v3No1 / 7
551amnondominant egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 7
666amnondominant alpaca, vicugna pacos, italy, feces2020-09-25v3No1 / 7
454amnondominant feces, elaphurus davidianus, pere deer, deer, captive, china2019-01-10v4No1 / 7
79amnondominant skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 7
406amnondominant feces, south africa, antidorcas marsupialis, springbok2018-11-21v4No1 / 7
406amnondominant feces, south africa, aepyceros melampus, impala2018-11-21v4No1 / 7
889amnondominant reindeer, rangifer tarandus, ruminal fluid, siberia, russia, rumen2022-04-01v3No1 / 8
666amnoncommon european hare, lepus europaeus, lama guanicoe, italy, feces2020-09-25v3No1 / 8
666amnondominant mouflon, ovis aries musimon, italy, feces2020-09-25v3No1 / 8
687amnondominant shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 8
454amnondominant feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v4No1 / 8
929amnondominant meatmaster sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v3No1 / 8
701amnondominant municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 8
940amnondominant feces, rectal swab, rectum, bos taurus, farm, kazakhstan, cow2022-11-25v3No1 / 8
88amnondominant syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v4No1 / 8
735amnondominant control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 8
406amnondominant feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 8
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, abomasum, research facility2022-05-18v3No1 / 8
518amnondominant bos taurus, cow, feces, united states of america, state of georgia, post-weaning, angus steer2019-06-11v4No1 / 8
649amnondominant ileum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 9
781amnondominant eland, tragelaphus oryx, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 9
781amnondominant impala, aepyceros melampus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 9
666amnondominant goat, capra hircus, italy, feces2020-09-25v3No1 / 9
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, colon, research facility2022-05-18v3No1 / 9
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, ileum, research facility2022-05-18v3No1 / 9
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, jejunum, research facility2022-05-18v3No1 / 9
910amnondominant age 140 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 9
687amnondominant chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 9
466amnondominant feces, bos taurus, cow, farm, united states of america, state of georgia2019-01-14v4No1 / 9
406amnondominant feces, zoological garden, french republic, aepyceros melampus, impala2018-11-21v4No1 / 9
863amnondominant forest musk deer, moschus berezovskii, qilian county, china, deer, captive, farm, feces2022-01-28v4No1 / 9
521amnonhigh freq. in weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 9
649amnondominant duodenum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 10
781amnondominant tsessebe, damaliscus lunatus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 10
890amnoncommon pacific ocean, mikura-jima, japan, wild, feces, bottlenosed dolphin, tursiops truncatus2022-04-03v3No1 / 10
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, research facility, feces2022-05-18v3No1 / 10
910amnondominant age 70 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 10
565amnondominant skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 10
687amnon high in chinese bohai black beef cattle compared to chinese luxi yellow beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 10
256amnondominant sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
700amnon high in caecum compared to colon in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 10
700amnon high in tylosin phosphate antibiotic compared to control in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 10
78amnondominant nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 10
79amnondominant skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 10
79amnondominant skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
79amnondominant skin, united states of america, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 10
735amnondominant restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 10
406amnondominant feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 10
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, caecum, research facility2022-05-18v3No1 / 10
781amnondominant cape buffalo, syncerus caffer caffer, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 11
787amnondominant control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 11
565amnondominant skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 11
702amnondominant state of north carolina, united states of america, feces, sheep, ovis aries2028-04-02v4No1 / 11
388amnondominant pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 11
737amnondominant ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 11
406amnondominant feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 11
863amnondominant xinglong mountain national nature reserve, alpine musk deer, moschus chrysogaster, yuzhong county, china, deer, captive, farm, feces2022-01-28v4No1 / 11
657amnondominant research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 12
27amnondominant bos grunniens, rumen, china2016-12-05v4No1 / 12
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
565amnondominant skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 12
914amnondominant yak, qinghai province, tibet autonomous region, bos grunniens, feces2022-06-26v3No1 / 12
82amnonhigh freq. in dairy cow rumen fluid (dominant bos taurus, sweden, rumen)2017-03-05v4No1 / 12
649amnondominant colon, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 13
781amnondominant thomson's gazelle, eudorcas thomsonii, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 13
890amnondominant mikura-jima, japan, wild, bottlenosed dolphin, pacific ocean, tursiops truncatus, feces2022-04-03v3No1 / 13
785amnondominant state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 13
157amnonhigh freq. in naers of weened calves (dominant nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 13
666amnondominant short beaked common dolphin, delphinus delphis, rectal swab, feces, italy2020-09-25v3No1 / 13
666amnondominant pygmy hippopotamus, hexaprotodon liberiensis, italy, feces2020-09-25v3No1 / 13
666amnondominant common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v3No1 / 13
673amnondominant salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 13
931amnondominant riwoqe county, china, yak, tibet autonomous region, bos grunniens, jejunum, duodenum2022-08-25v3No1 / 13
111amnondominant caecum, mongolian sheep, ovis aries, rectum, ileum, colon, china2017-04-09v4No1 / 13
389amnondominant pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 13
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
748amnondominant jersey cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 13
399amnondominant feces, united states of america, zoological garden, state of tennessee, ovis aries, sheep2018-11-16v4No1 / 13
748amnondominant holstein dairy cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 13
781amnondominant giraffe, giraffa tippelskirchi, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 14
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility china qinghai province rumen liquid rumen age < 1 year lamb sheep ovis aries )2020-09-13v4No1 / 14
673amnondominant control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 14
565amnondominant skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 14
687amnondominant holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 14
209amnonhigh freq. in whale blow condensate (dominant north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 14
79amnondominant skin, united states of america, stenella longirostris, spinner dolphin2017-03-03v4No1 / 14
388amnondominant pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 14
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 14
748amnondominant jersey cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 14
759amnondominant state of alabama, united states of america, feces, wild, wild boar, sus scrofa2021-04-04v4No1 / 14
406amnondominant feces, zoological garden, united states of america, giraffa camelopardalis, giraffe2018-11-21v4No1 / 14
781amnondominant kirk's dik-dik, madoqua kirkii, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 15
787amnoncommon in high grain diet induced subacute acidosis (dominant acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 15
327amnondominant bos taurus, cow, nasopharynx, canada2018-04-30v4No1 / 15
905amnondominant western australia, sheep, age 1 year, australia, ovis aries, duodenum, research facility2022-05-18v3No1 / 15
910amnondominant holstein dairy cow, age 42 days, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 15
673amnoncommon salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 15
687amnondominant chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 15
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
79amnondominant skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 15
79amnoncommon skin, united states of america, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
666amnondominant pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 16
49amnondominant giraffa camelopardalis, feces2017-01-19v4No1 / 16
816amnondominant late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 16
491amnondominant ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 16
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
79amnondominant skin, united states of america, stenella attenuata2017-03-03v4No1 / 16
83amnondominant bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 16
748amnondominant holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 16
688amnondominant nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 17
673amnondominant caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 17
816amnondominant early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 17
649amnon high in jejunum duodenum compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 18
781amnondominant warthog, phacochoerus africanus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 18
666amnondominant wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 18
666amnondominant lama guanicoe, italy, feces2020-09-25v3No1 / 18
561amnon high in winter withered grass diet compared to spring green stage diet in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 18
565amnondominant skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 18
466amnonhigh freq. in cow feces left in field for 30-60 days (dominant feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v4No1 / 18
700amnondominant belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 18
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 18
79amnondominant skin, united states of america, lagenorhynchus acutus2017-03-03v4No1 / 18
79amnondominant skin, united states of america, physeter catodon2017-03-03v4No1 / 18
739amnondominant age 5 years, goat, capra hircus, creole goat, research facility, ruminal fluid, rumen, argentina2021-01-30v4No1 / 18
111amnondominant rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 18
256amnondominant sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 19
261amnondominant bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 19
275amnondominant megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v4No1 / 19
439amnondominant bos grunniens, yak, rumen, farm, china2018-12-31v4No1 / 20
565amnondominant skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 20
79amnondominant skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 20
666amnondominant zoological garden, hippopotamus amphibius, italy, feces2020-09-25v3No1 / 21
759amnondominant state of vermont, farm, pig, united states of america, feces, sus scrofa2021-04-04v4No1 / 21
666amnondominant european hare, lepus europaeus, lama guanicoe, italy, feces2020-09-25v3No1 / 22
673amnondominant caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 22
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
314amnondominant caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 23
79amnoncommon skin, united states of america, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
673amnoncommon control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 25
673amnon high in salmonellosis salmonella enterica subsp. enterica serovar typhimurium compared to control in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 25
700amnon high in control compared to antibiotic tylosin phosphate in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 25
785amnoncommon state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 26
157amnonlow in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in selenium compared to control low selenium in nasal cavity bos taurus calve united states of america juvenile organism pair of nares )2017-07-04v4No1 / 26
275amnoncommon megaptera novaeangliae, humpback whale, antarctica, antarctic peninsula, skin2018-01-16v4No1 / 26
673amnon high in salmonellosis salmonella enterica subsp. enterica serovar typhimurium compared to control in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to bos taurus farm in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
863amnon high in spring compared to winter in xinglong mountain national nature reserve alpine musk deer moschus chrysogaster yuzhong county china deer captive farm feces 2022-01-28v4No1 / 29
79amnoncommon skin, united states of america, physeter catodon2017-03-03v4No1 / 30
673amnon high in ileum compared to caecum ascending colon in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 31
79amnoncommon skin, united states of america, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 31
905amnon high in jejunum compared to ileum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 32
687amnon high in chinese luxi yellow beef cattle compared to chinese bohai black beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 34
79amnoncommon skin, united states of america, stenella longirostris, spinner dolphin2017-03-03v4No1 / 34
561amnon high in spring green stage diet compared to withered grass diet winter in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 35
79amnoncommon skin, united states of america, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
79amnondominant skin, united states of america, delphinus delphis2017-03-03v4No1 / 36
649amnoncommon jejunum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 38
688amnon high in male organism male compared to female female organism in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 39
687amnon high in high milk yield compared to low milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 40
700amnon high in control compared to tylosin phosphate antibiotic in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 40
79amnoncommon peponocephala electra, skin, united states of america2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, lagenorhynchus acutus2017-03-03v4No1 / 40
79amnoncommon skin, united states of america, stenella attenuata2017-03-03v4No1 / 40
83amnonhigher in rumen liquids compared to solids in normal diet cows ( high in rumen liquid compared to rumen solids in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 40
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
79amnoncommon skin, united states of america, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
275amnonhigher in fall 2010 compared to summer 2013 in whale skin ( high in autumn compared to summer in megaptera novaeangliae humpback whale antarctica antarctic peninsula skin )2018-01-16v4No1 / 42
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
649amnoncommon duodenum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 45
327amnonlower in nasopharynx of antibiotics treated cows compared to cows without antibiotic injection ( high in control compared to antibiotic in bos taurus cow nasopharynx canada )2018-04-30v4No1 / 45
666amnoncommon short beaked common dolphin, delphinus delphis, rectal swab, feces, italy2020-09-25v3No1 / 48
327amnoncommon bos taurus, cow, nasopharynx, canada2018-04-30v4No1 / 50
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 50
439amnoncommon bos grunniens, yak, rumen, farm, china2018-12-31v4No1 / 52
649amnoncommon ileum, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 55
700amnon high in colon compared to caecum in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 59
905amnon high in ileum compared to jejunum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 61
657amnonpostively correlated with age ( high in older age age compared to younger age in research facility china qinghai province rumen liquid rumen age < 1 year lamb sheep ovis aries )2020-09-13v4No1 / 65
735amnon high in restricted feed compared to control in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 65
83amnonhigher in rumen solids compared to liquid in normal diet cows ( high in rumen solids compared to rumen liquid in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 67
914amnon high in control compared to diarrhea in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v3No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
666amnoncommon pygmy hippopotamus, hexaprotodon liberiensis, italy, feces2020-09-25v3No1 / 76
666amnoncommon common bottlenose dolphin, rectal swab, tursiops truncatus, italy, feces2020-09-25v3No1 / 76
905amnon high in abomasum compared to rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 78
83amnonhigher in earlier timepoint (yonger age) in cow rumen normal diet ( high in 605 days age compared to 660 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 80
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
406amnonlower in captive white rhinoceros compared to wild ( high in wild south africa compared to captive french republic in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v4No1 / 80
816amnon high in early pregnancy compared to late pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 83
261amnondiet dependent in cow rumen ( high in diet corn diet 40mdgs diet compared to 27cds diet 55cs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 83
406amnonhigher in captive bovidae compared to wild ( high in zoological garden compared to wild in feces bovidae )2018-11-21v4No1 / 84
209amnon high in atlantic ocean compared to pacific ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 86
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 88
914amnon high in diarrhea compared to control in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v3No1 / 88
79amnoncommon skin, united states of america, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
649amnon high in ileum compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 92
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in capra hircus goat china research facility ruminal fluid rumen shanxi province dairy goat )2021-05-23v3No1 / 96
565amnoncommon skin, canada, captive, zoological garden, rangifer tarandus, reindeer, african lion safari2019-11-21v3No1 / 96
673amnoncommon caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 99
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 101
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 104
491amnoncommon ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 105
79amnoncommon skin, united states of america, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
466amnonlower in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in unshaded sunlight compared to shaded in feces bos taurus cow farm united states of america state of georgia late timepoints 30-60 days )2019-01-14v4No1 / 112
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
735amnon high in control compared to restricted feed in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 112
863amnon high in winter compared to spring in xinglong mountain national nature reserve alpine musk deer moschus chrysogaster yuzhong county china deer captive farm feces 2022-01-28v4No1 / 112
79amnoncommon skin, united states of america, delphinus delphis2017-03-03v4No1 / 113
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 113
905amnoncommon jejunum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 114
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
565amnoncommon skin, canada, captive, zoological garden, african lion safari, camelus bactrianus, bactrian camel2019-11-21v3No1 / 122
649amnoncommon colon, lamb, age 6 weeks, research facility, new zealand, ovis aries, sheep2020-09-07v3No1 / 128
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
551amnon high in fresh clover diet compared to clover hay diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 136
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 136
905amnoncommon ileum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 137
666amnoncommon zoological garden, hippopotamus amphibius, italy, feces2020-09-25v3No1 / 146
889amnon high in woodland yamalo-nenets autonomous okrug compared to nenets autonomous okrug in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v3No1 / 151
673amnoncommon caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
314amnon high in tibetan pig tibetan swine compared to sus scrofa pig in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 157
209amnoncommon in whale blow condensate (common north america, megaptera novaeangliae, humpback whale, respiratory airway, exhaled air condensate, whale blow)2017-10-15v4No1 / 161
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
910amnoncommon age 70 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 191
88amnondifferent between herds in cape buffalo feces ( high in herd lower sabie herd compared to croc bridge herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 194
905amnoncommon duodenum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 200
910amnoncommon age 42 days, holstein dairy cow, calve, germany, bos taurus, mouth mucosa, oral cavity, juvenile stage, research facility2022-05-20v1No1 / 202
889amnon high in winter compared to summer in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v3No1 / 205
565amnoncommon skin, canada, ammotragus lervia, barbary sheep, zoological garden, captive, african lion safari2019-11-21v3No1 / 205
863amnoncommon qilian county, farm, captive, china, forest musk deer, moschus berezovskii, deer, feces2022-01-28v4No1 / 206
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 207
88amnondifferent between herds in cape buffalo feces ( high in herd croc bridge herd compared to lower sabie herd in syncerus caffer caffer cape buffalo feces south africa )2017-03-08v4No1 / 208
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
209amnon high in pacific ocean compared to atlantic ocean in north america megaptera novaeangliae humpback whale respiratory airway exhaled air condensate whale blow 2017-10-15v4No1 / 219
466amnoncommon in cow feces left in field for 30-60 days (common feces, bos taurus, cow, farm, united states of america, state of georgia, late timepoints, 30-60 days)2019-01-14v4No1 / 221
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in sus scrofa pig gastrointestinal system united kingdom )2017-11-26v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
929amnon high in meatmaster sheep compared to damara sheep in age 7 months gauteng province sheep rumen liquid south africa ovis aries rumen research facility 2022-08-16v3No1 / 231
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
78amnoncommon nanger granti, kenya, feces, tropical grassland biome, gazelle2017-03-01v4No1 / 234
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 239
910amnoncommon mouth mucosa, oral cavity, age 140 days, holstein dairy cow, calve, germany, bos taurus, juvenile stage, research facility2022-05-20v1No1 / 245
889amnon high in nenets autonomous okrug compared to woodland yamalo-nenets autonomous okrug in tundra reindeer rangifer tarandus ruminal fluid siberia russia rumen 2022-04-01v3No1 / 247
781amnoncommon kirk's dik-dik, madoqua kirkii, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 248
83amnonhigher in later timepoint (older age) in cow rumen normal diet ( high in age 660 days compared to 605 days in bos taurus rumen holstein-friesian bull ireland )2017-03-05v4No1 / 248
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
561amnon high in grass growth diet summer compared to spring green stage diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 256
759amnon high in state of vermont farm pig compared to state of alabama wild wild boar in united states of america feces sus scrofa 2021-04-04v4No1 / 258
49amnoncommon giraffa camelopardalis, feces2017-01-19v4No1 / 264
905amnon high in rumen compared to abomasum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 264
261amnoncommon bos taurus, cow, rumen, united states of america, state of nebraska2017-12-10v4No1 / 266
78amnonhigher in younger gazelles ( high in age young age compared to old age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 268
759amnon high in state of alabama wild wild boar compared to state of vermont farm pig in united states of america feces sus scrofa 2021-04-04v4No1 / 268
931amnoncommon jejunum, duodenum, riwoqe county, china, yak, tibet autonomous region, bos grunniens2022-08-25v3No1 / 270
78amnonhigher in older gazelles ( high in age old age compared to young age in nanger granti kenya feces tropical grassland biome gazelle )2017-03-01v4No1 / 273
910amnon high in age 70 days compared to age 140 days in holstein dairy cow calve germany bos taurus mouth mucosa oral cavity juvenile stage research facility 2022-05-20v1No1 / 276
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to wild south africa in feces bovidae ceratotherium simum white rhinoceros )2018-11-21v4No1 / 277
688amnoncommon nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 278
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
863amnoncommon farm, yuzhong county, xinglong mountain national nature reserve, moschus chrysogaster, alpine musk deer, china, deer, captive, feces2022-01-28v4No1 / 290
551amnon high in diet clover hay diet compared to fresh clover diet in egypt camel camelus dromedarius rumen adult 2019-08-27v3No1 / 291
561amnon high in grass growth diet summer compared to withered grass diet winter in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 294
111amnon high in rumen ruminant reticulum omasum compared to rectum ileum caecum colon in mongolian sheep ovis aries china 2017-04-09v4No1 / 294
649amnon high in jejunum duodenum compared to colon in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 295
737amnoncommon ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 295
78amnon high in male compared to female in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 301
910amnon high in age 140 days compared to age 70 days in holstein dairy cow calve germany bos taurus mouth mucosa oral cavity juvenile stage research facility 2022-05-20v1No1 / 302
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
748amnon high in jersey cow compared to holstein dairy cow in united states of america state of mississippi research facility female organism feces bos taurus cow 2021-03-10v4No1 / 308
565amnoncommon skin, canada, zoological garden, captive, african lion safari, giraffa camelopardalis, giraffe2019-11-21v3No1 / 310
816amnon high in late pregnancy compared to early pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 312
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
565amnoncommon skin, canada, farm, bos taurus, cow2019-11-21v3No1 / 318
687amnon high in chinese laoshan milk goat goat capra hircus compared to chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 318
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
406amnonlower in captive bovidae compared to wild ( high in wild compared to zoological garden in feces bovidae )2018-11-21v4No1 / 319
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 325
759amnoncommon state of vermont, farm, pig, united states of america, feces, sus scrofa2021-04-04v4No1 / 328
111amnoncommon caecum, mongolian sheep, ovis aries, rectum, ileum, colon, china2017-04-09v4No1 / 330
649amnon high in ileum compared to colon in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 338
816amnoncommon late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 340
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
781amnon high in cape buffalo syncerus caffer caffer compared to cattle bos taurus in masai mara national park kenya wild feces 2021-04-28v4No1 / 349
940amnoncommon cow, kazakhstan, farm, bos taurus, rectum, rectal swab, feces2022-11-25v3No1 / 355
561amnon high in winter withered grass diet compared to grass growth diet summer in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 357
209amnonhigher in whale blow condensate compared to ocean water ( high in whale blow exhaled air condensate respiratory airway megaptera novaeangliae humpback whale compared to sea water ocean depth (water) 25cm in north america )2017-10-15v4No1 / 359
363amnon high in rumen ruminant reticulum omasum compared to caecum colon rectum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 360
759amnoncommon state of alabama, united states of america, feces, wild, wild boar, sus scrofa2021-04-04v4No1 / 362
551amnoncommon egypt, camel, camelus dromedarius, rumen, adult2019-08-27v3No1 / 370
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 374
687amnon high in low milk yield compared to high milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 375
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
739amnoncommon age 5 years, goat, capra hircus, creole goat, research facility, ruminal fluid, rumen, argentina2021-01-30v4No1 / 392
561amnon high in spring green stage diet compared to summer grass growth diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 397
781amnoncommon giraffe, giraffa tippelskirchi, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 400
905amnoncommon feces, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 401
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
748amnon high in holstein dairy cow compared to jersey cow in united states of america state of mississippi research facility female organism feces bos taurus cow 2021-03-10v4No1 / 407
905amnoncommon caecum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 417
781amnoncommon thomson's gazelle, eudorcas thomsonii, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 425
687amnoncommon chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 429
929amnoncommon meatmaster sheep, age 7 months, gauteng province, sheep, rumen liquid, south africa, ovis aries, rumen, research facility2022-08-16v3No1 / 432
466amnonhigher in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in shaded compared to unshaded sunlight in feces bos taurus cow farm united states of america state of georgia late timepoints 30-60 days )2019-01-14v4No1 / 432
666amnoncommon lama guanicoe, italy, feces2020-09-25v3No1 / 437
702amnoncommon state of north carolina, united states of america, feces, sheep, ovis aries2028-04-02v4No1 / 450
399amnoncommon feces, united states of america, zoological garden, state of tennessee, ovis aries, sheep2018-11-16v4No1 / 451
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
781amnon high in impala aepyceros melampus compared to tsessebe damaliscus lunatus in masai mara national park kenya wild feces 2021-04-28v4No1 / 460
905amnoncommon abomasum, age 1 year, western australia, research facility, australia, ovis aries, sheep2022-05-18v3No1 / 460
787amnoncommon in high grain diet induced subacute acidosis (common acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 463
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
406amnoncommon feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 467
889amnoncommon siberia, russia, reindeer, rangifer tarandus, rumen, ruminal fluid2022-04-01v3No1 / 469
406amnoncommon feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 477
454amnoncommon feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v4No1 / 480
666amnoncommon cow, bos taurus, italy, feces2020-09-25v3No1 / 482
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
518amnoncommon bos taurus, cow, feces, united states of america, state of georgia, post-weaning, angus steer2019-06-11v4No1 / 498
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 504
329amnoncommon ovis aries, sheep, kingdom of norway, rumen2018-05-13v4No1 / 506
454amnoncommon feces, elaphurus davidianus, pere deer, deer, captive, china2019-01-10v4No1 / 509
781amnoncommon impala, aepyceros melampus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 510
910amnoncommon rumen, age 140 days, holstein dairy cow, calve, germany, bos taurus, juvenile stage, research facility2022-05-20v1No1 / 510
748amnoncommon jersey cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 516
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 517
905amnoncommon colon, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 523
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
666amnoncommon alpaca, vicugna pacos, italy, feces2020-09-25v3No1 / 546
781amnoncommon cape buffalo, syncerus caffer caffer, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 557
209amnonlower in whale blow condensate compared to ocean water ( high in sea water ocean depth (water) 25cm compared to megaptera novaeangliae humpback whale respiratory airway whale blow exhaled air condensate in north america )2017-10-15v4No1 / 560
905amnon high in jejunum ileum compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 563
781amnoncommon warthog, phacochoerus africanus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 564
914amnoncommon tibet autonomous region, qinghai province, bos grunniens, yak, feces2022-06-26v3No1 / 575
748amnoncommon holstein dairy cow, united states of america, state of mississippi, research facility, female organism, feces, bos taurus, cow2021-03-10v4No1 / 577
406amnoncommon feces, zoological garden, united states of america, giraffa camelopardalis, giraffe2018-11-21v4No1 / 581
931amnoncommon ileum, colon, caecum, feces, riwoqe county, china, yak, tibet autonomous region, bos grunniens2022-08-25v3No1 / 587
687amnoncommon holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 593
905amnoncommon rumen, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 597
781amnon high in tsessebe damaliscus lunatus compared to impala aepyceros melampus in masai mara national park kenya wild feces 2021-04-28v4No1 / 599
748amnon high in jersey cow compared to holstein dairy cow in ruminal fluid rumen united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 603
518amnonhigher in end of experiment (older steers) ( high in days 14-28 compared to days 1-2 in bos taurus cow feces united states of america state of georgia post-weaning angus steer )2019-06-11v4No1 / 609
748amnoncommon holstein dairy cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 614
781amnoncommon tsessebe, damaliscus lunatus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 622
931amnon high in jejunum duodenum compared to ruminal fluid rumen in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 622
931amnoncommon ruminal fluid, rumen, riwoqe county, china, yak, tibet autonomous region, bos grunniens2022-08-25v3No1 / 626
748amnoncommon jersey cow, ruminal fluid, rumen, united states of america, state of mississippi, research facility, female organism, bos taurus, cow2021-03-10v4No1 / 632
592amnoncommon feces, united states of america, bos taurus, cow, farm, commonwealth of pennsylvania2020-02-18v1No1 / 633
748amnon high in holstein dairy cow compared to jersey cow in ruminal fluid rumen united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 638
781amnon high in cattle bos taurus compared to cape buffalo syncerus caffer caffer in masai mara national park kenya wild feces 2021-04-28v4No1 / 642
406amnoncommon feces, south africa, aepyceros melampus, impala2018-11-21v4No1 / 643
889amnon high in summer compared to winter in reindeer rangifer tarandus ruminal fluid siberia russia rumen tundra 2022-04-01v3No1 / 647
929amnon high in damara sheep compared to meatmaster sheep in age 7 months gauteng province sheep rumen liquid south africa ovis aries rumen research facility 2022-08-16v3No1 / 648
666amnoncommon mouflon, ovis aries musimon, italy, feces2020-09-25v3No1 / 649
406amnoncommon feces, zoological garden, french republic, aepyceros melampus, impala2018-11-21v4No1 / 661
781amnoncommon cattle, bos taurus, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 662
466amnonhigher in cow feces left in field for 30-60 days compared to initial feces ( high in late timepoints 30-60 days compared to early timepoints 0-2 days in feces bos taurus cow farm united states of america state of georgia )2019-01-14v4No1 / 662
781amnoncommon eland, tragelaphus oryx, masai mara national park, kenya, wild, feces2021-04-28v4No1 / 666
561amnoncommon bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 670
666amnoncommon goat, capra hircus, italy, feces2020-09-25v3No1 / 674
565amnoncommon skin, canada, zoological garden, captive, tragelaphus oryx, eland, toronto zoo2019-11-21v3No1 / 674
406amnoncommon feces, south africa, antidorcas marsupialis, springbok2018-11-21v4No1 / 678
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
666amnoncommon sheep, ovis aries, italy, feces2020-09-25v3No1 / 688
787amnoncommon control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 700
929amnoncommon age 7 months, damara sheep, gauteng province, south africa, research facility, rumen, rumen liquid, sheep, ovis aries2022-08-16v3No1 / 706
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
83amnoncommon bos taurus, rumen, holstein-friesian bull, ireland2017-03-05v4No1 / 757
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
157amnoncommon in naers of weened calves (common nasal cavity, bos taurus, calve, united states of america, juvenile organism, pair of nares)2017-07-04v4No1 / 766
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 780
466amnoncommon feces, bos taurus, cow, farm, united states of america, state of georgia2019-01-14v4No1 / 783
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
78amnon high in female compared to male in nanger granti kenya feces tropical grassland biome gazelle 2017-03-01v4No1 / 811
592amnoncommon united states of america, feces, commonwealth of pennsylvania, wild, sheep, ovis aries2020-02-18v1No1 / 828
88amnoncommon syncerus caffer caffer, cape buffalo, feces, south africa2017-03-08v4No1 / 891
649amnon high in colon compared to ileum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 897
701amnoncommon municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 953
931amnon high in jejunum duodenum compared to ileum feces colon caecum in tibet autonomous region riwoqe county china yak bos grunniens 2022-08-25v3No1 / 970
193amnonhigher in nares of people working in dairy farms ( high in bos taurus farm compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
687amnon high in chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus compared to chinese laoshan milk goat goat capra hircus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 1022
83amnon high in diet control normal diet compared to restricted diet in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1023
687amnoncommon chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1039
406amnoncommon feces, zoological garden, hippotragus niger, sable antelope, french republic2018-11-21v4No1 / 1075
905amnon high in ileum jejunum compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 1092
454amnon high in wild compared to captive in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 1094
687amnoncommon shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1147
910amnon high in mouth mucosa oral cavity compared to rumen in research facility germany juvenile stage age 140 days holstein dairy cow calve bos taurus 2022-05-20v1No1 / 1194
649amnon high in colon compared to jejunum duodenum in lamb age 6 weeks research facility new zealand ovis aries sheep 2020-09-07v3No1 / 1261
454amnon high in winter compared to summer in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 1304
863amnon high in yuzhong county xinglong mountain national nature reserve moschus chrysogaster alpine musk deer compared to moschus berezovskii qilian county forest musk deer in china deer captive farm feces 2022-01-28v4No1 / 1311
82amnoncommon in dairy cow rumen fluid (common bos taurus, sweden, rumen)2017-03-05v4No1 / 1322
466amnonlower in cow feces left in field for 30-60 days compared to initial feces ( high in early timepoints 0-2 days compared to late timepoints 30-60 days in feces bos taurus cow farm united states of america state of georgia )2019-01-14v4No1 / 1329
454amnon high in captive compared to wild in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1374
863amnon high in qilian county moschus berezovskii forest musk deer compared to xinglong mountain national nature reserve yuzhong county moschus chrysogaster alpine musk deer in china deer captive farm feces 2022-01-28v4No1 / 1604
83amnon high in restricted feed diet compared to control normal feed in bos taurus rumen holstein-friesian bull ireland 2017-03-05v4No1 / 1735
910amnon high in rumen compared to mouth mucosa oral cavity in age 140 days holstein dairy cow calve germany bos taurus juvenile stage research facility 2022-05-20v1No1 / 1744
931amnon high in ileum feces colon caecum compared to ruminal fluid rumen in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 1870
931amnon high in ileum feces colon caecum compared to jejunum duodenum in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 2008
905amnon high in abomasum rumen compared to jejunum ileum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 2033
931amnon high in ruminal fluid rumen compared to jejunum duodenum in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 2088
905amnon high in feces colon caecum compared to ileum jejunum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 2246
905amnon high in feces caecum colon compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 2270
748amnon high in feces compared to ruminal fluid rumen in united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 2467
931amnon high in ruminal fluid rumen compared to ileum feces colon caecum in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 2519
748amnon high in ruminal fluid rumen compared to feces in united states of america state of mississippi research facility female organism bos taurus cow 2021-03-10v4No1 / 2716
905amnon high in abomasum rumen compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 2737

Problems / suggestions? Please email info AT dbbact DOT org