Summary for ontology term: child

Number of annotations with term: 280

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.025926
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AbiotrophiaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGTGTAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAATTCCATG0.022222
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.018519
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATAGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.018519
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAACTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGGCTGGAACTCCTGG0.018519
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAGCTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.018519
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.014815
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.014815
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTGGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGGTTTTGCAGTGGGTACGGGCTAACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.014815
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.014815

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTATGGCAAGTCTGATGTGAAAGGCCAGGGCTCAACCCTGGGACTGCATTGGAAACTGTCGAACTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCAAGGCAAGCCAGAAGTGAAAACCCGGGGCTCAACCGCGGGATTGCTTTTGGAACTGTCATGCTAGAGTGCAGGAGGGGTGAGCGGAATTCCTAG0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTCATTGGGTTTAAAGGGAGCGTAGGCCGTGGATTAAGCGTGTTGTGAAATGTAGGCGCTCAACGTCTGACTTGCAGCGCGAACTGGTCCACTTGAGTGTGCGCGACGCAGGCGGAATTCGTGG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCCTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTAAGCCGCCGAAACTGGAGGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGATTAAGTCAGCTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGTTGTCTTGAGTGCACGCAGGGATGTTGGAATTCATGG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTGGATTAAGCGTGTTGTGAAATGCAGGTGCTCAACGTCTGCACTGCAGCGCGAACTGGTCCACTTGAGTGTGCACAACGCAGGCGGAATTCGTCG0.250000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTATCTTACCAGAAAGGGACGG0.213628
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACAGTAGAGACGGTACCTAACCAGAAAGCCACGGC0.200980
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGTGCTAGAGTAACTGTTAGCGCCTTGACGGTATCTAACCAGAAAGCCACGGC0.199074
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTGTATGGGGATAAAGTTAGGGACGTGTCCCTATTTGCAGGTACCATACGAATAAGGACCGGCTAATT0.197044
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTCTGAAGAAGGCCTTCGGGTTGTAAAGGACTTTTGTCAGGGAAGAAAAGGGCGGGGTTAATACCCCTGTCTGATGACGGTACCTGAAGAATAAGCACCGGC0.196185
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTTAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG0.191781
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__HaemophilusTGGGGAATATTGCGCAATGGGGGCAACCCTGACGCAGCCATGCCGCGTGAATGAAGAAGGCCTTCGGGTTGTAAAGTTCTTTCGGTAGCGAGGAAGGCATTTAGTTTAATAGACTAGGTGATTGACGTTAACTACAGAAGAAGCACCGGC0.179104
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAACTCTGTTGTTAGAGAAGAACAGCGCATAGAGTAACTGTTATGCGTGTGACGGTATCTAACCAGAAAGCCACGGC0.177143
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAAAGTCTGATCCAGCAATTCTGTGTGCACGATGACGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAAAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.176944
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGTCAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAAAGGGACGG0.175299

Annotations:

common ontology terms
term enrichment score
TermScore
child1.001975
homo sapiens0.220435
2-year-old human stage0.216561
saliva0.184948
obsolete_juvenile stage0.176471
supragingival plaque0.150000
7-year-old human stage0.134831
feces0.130969
supragingival dental plaque0.127601
1-year-old human stage0.117073
sweden0.116583
dentition0.115461
6-year-old human stage0.113924
8-year-old human stage0.113924
9-year-old human stage0.113924
10-year-old human stage0.113924
11-year-old human stage0.113924
age 1-3 years0.113924
state of nebraska0.102273
control0.095713
rural community0.094987
age 5-13 years0.093023
perth0.090909
2-5 year-old child stage0.087912
municipality of umea0.084967
LOWER IN control0.084711
LOWER IN child0.081505
10-15-years-old human0.080537
chuquisaca department0.078947
age 5-10 years0.074199
oral cavity0.074074
bolivia0.073171
ulcerative colitis0.072848
recurrent otitis media0.072848
gambia0.068966
infant0.067141
age 7-14 years0.066667
nigeria0.065574
shanghai proper0.064516
united states of america0.062577
4-year-old human stage0.062284
central african republic0.061329
middle ear0.061329
africa0.060606
istanbul0.060403
age 13-15 years0.060403
turkey0.058632
14-year-old human stage0.058632
13-year-old human stage0.056962
crohn's disease0.056738
madagascar0.054795
indonesia0.054054
municipality of yogyakarta0.054054
bangui0.047619
type i diabetes mellitus0.047619
australia0.046512
mouth0.042553
LOWER IN 2-year-old human stage0.041783
age 1-7 years0.041522
puerto rico0.041096
stunted growth0.041096
antananarivo0.041096
food allergy0.041096
age 4-10 years0.041096
hangzhou city prefecture0.041096
age 6-14 years0.041096
kebbi state0.041096
kingdom of spain0.040816
adult0.039735
amsterdam0.039474
duodenum0.039216
macaca mulatta0.037975
kingdom of the netherlands0.037975
LOWER IN adult0.035320
nasopharynx0.035294
autistic disorder0.034783
18-month-old human stage0.034483
burmese0.034483
LOWER IN type i diabetes mellitus0.034483
pemba island0.034483
6-12 year-old child stage0.034188
asian0.033898
caucasian0.033333
european0.033333
tanzania0.033333
subgingival plaque0.032967
monkey0.032967
LOWER IN infant0.032680
fasting0.032258
israel0.031414
dental plaque0.030303
italy0.030000
south korea0.029412
china0.028547
LOWER IN crohn's disease0.028470
jordan0.028169
atlanta0.028169
3-year-old human stage0.027778
azerbaijan0.027778
daycare0.027778
Fraction of dbbact annotations with this term covered by the query
TermScore
crohn's disease4.000000
LOWER IN crohn's disease4.000000
child1.055556
2-year-old human stage1.000000
4-year-old human stage1.000000
LOWER IN 4-year-old human stage1.000000
bordeaux1.000000
jordan1.000000
glasgow1.000000
schistosomiasis1.000000
urinary schistosomiasis1.000000
LOWER IN schistosomiasis1.000000
LOWER IN urinary schistosomiasis1.000000
atlanta1.000000
gambia1.000000
LOWER IN 2-year-old human stage0.833333
7-year-old human stage0.666667
age 1-7 years0.666667
LOWER IN age 1-7 years0.666667
central african republic0.666667
madagascar0.666667
autistic disorder0.666667
LOWER IN autistic disorder0.666667
age 5-13 years0.666667
age 5-10 years0.666667
10-15-years-old human0.666667
middle ear0.666667
municipality of umea0.500000
5-year-old human stage0.500000
18-month-old human stage0.500000
3-year-old human stage0.500000
LOWER IN 18-month-old human stage0.500000
LOWER IN 3-year-old human stage0.500000
LOWER IN 5-year-old human stage0.500000
burmese0.500000
6-year-old human stage0.500000
8-year-old human stage0.500000
9-year-old human stage0.500000
10-year-old human stage0.500000
11-year-old human stage0.500000
LOWER IN burmese0.500000
ulcerative colitis0.500000
acute severe colitis0.500000
before antibiotics0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
puerto rico0.500000
LOWER IN age 12-23 years0.500000
age 12-23 years0.500000
induced periodontitis0.500000
periodontitis0.500000
LOWER IN induced periodontitis0.500000
LOWER IN stunted growth0.500000
stunted growth0.500000
bangui0.500000
LOWER IN antananarivo0.500000
antananarivo0.500000
LOWER IN bangui0.500000
age 7-14 years0.500000
autism0.500000
LOWER IN autism0.500000
obsolete_juvenile stage0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
quito0.500000
age 2-5 years0.500000
milk allergy0.500000
LOWER IN sesame allergy0.500000
food allergy0.500000
age 4-10 years0.500000
sesame allergy0.500000
LOWER IN milk allergy0.500000
istanbul0.500000
dental caries0.500000
LOWER IN dental caries0.500000
LOWER IN age 8-12 years0.500000
age 8-12 years0.500000
LOWER IN type i diabetes mellitus0.500000
type i diabetes mellitus0.500000
azerbaijan0.500000
type 1 diabetes mellitus0.500000
hangzhou city prefecture0.500000
age 6-14 years0.500000
LOWER IN type 1 diabetes mellitus0.500000
LOWER IN braces0.500000
LOWER IN teeth braces0.500000
age 13-15 years0.500000
braces0.500000
teeth braces0.500000
diet without sweets0.500000
LOWER IN diet containing sweets0.500000
diet containing sweets0.500000
LOWER IN diet without sweets0.500000
LOWER IN age 13-15 years0.500000
age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
daycare0.500000
Fraction of annotations for the query sequences containing the term
TermScore
child0.953571
homo sapiens0.907143
feces0.457143
saliva0.235714
united states of america0.221429
2-year-old human stage0.121429
control0.107143
obsolete_juvenile stage0.107143
sweden0.103571
dentition0.103571
supragingival plaque0.100000
supragingival dental plaque0.082143
LOWER IN control0.078571
china0.078571
7-year-old human stage0.075000
1-year-old human stage0.075000
africa0.071429
state of nebraska0.064286
6-year-old human stage0.064286
8-year-old human stage0.064286
9-year-old human stage0.064286
10-year-old human stage0.064286
11-year-old human stage0.064286
age 1-3 years0.064286
rural community0.064286
2-5 year-old child stage0.050000
age 5-13 years0.050000
oral cavity0.050000
australia0.050000
perth0.050000
municipality of umea0.046429
LOWER IN child0.046429
10-15-years-old human0.042857
bolivia0.042857
chuquisaca department0.042857
infant0.039286
ulcerative colitis0.039286
age 5-10 years0.039286
recurrent otitis media0.039286
shanghai proper0.035714
age 7-14 years0.035714
nigeria0.035714
kingdom of spain0.035714
gambia0.035714
adult0.032143
4-year-old human stage0.032143
central african republic0.032143
turkey0.032143
istanbul0.032143
age 13-15 years0.032143
13-year-old human stage0.032143
14-year-old human stage0.032143
middle ear0.032143
LOWER IN adult0.028571
madagascar0.028571
mouth0.028571
crohn's disease0.028571
indonesia0.028571
municipality of yogyakarta0.028571
bangui0.025000
duodenum0.025000
type i diabetes mellitus0.025000
LOWER IN 2-year-old human stage0.021429
research facility0.021429
macaca mulatta0.021429
puerto rico0.021429
subgingival plaque0.021429
monkey0.021429
age 1-7 years0.021429
stunted growth0.021429
antananarivo0.021429
germany0.021429
italy0.021429
israel0.021429
food allergy0.021429
age 4-10 years0.021429
hangzhou city prefecture0.021429
age 6-14 years0.021429
nasopharynx0.021429
kingdom of the netherlands0.021429
amsterdam0.021429
kebbi state0.021429
18-month-old human stage0.017857
LOWER IN infant0.017857
asian0.017857
burmese0.017857
caucasian0.017857
european0.017857
dental plaque0.017857
6-12 year-old child stage0.017857
autistic disorder0.017857
fasting0.017857
south korea0.017857
LOWER IN type i diabetes mellitus0.017857
tanzania0.017857
pemba island0.017857
3-year-old human stage0.014286
african american0.014286
hispanic or latin american0.014286
hispanic0.014286
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child nigeria obsolete_juvenile stage 2018-08-30v4No1 / 1
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 2-year-old human stage 3-month-old human stage 12-month-old human stage in homo sapiens saliva child sweden )2020-03-18v3No1 / 1
491amnonlower in lambs fed linseed oil supplemented diet compared to control diet ( high in control diet compared to linseed oil food product in farm rumen ovis aries child ireland sheep lamb age 100 days )2019-02-26v4No1 / 1
425amnonhigher in kids with stunted growth compared to non-stunted ( high in stunted growth compared to control in feces homo sapiens child africa )2018-12-08v4No1 / 2
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child azerbaijan obsolete_juvenile stage 2018-08-30v4No1 / 2
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 2
598amnonhigher in kids that eat sweets ( high in diet containing sweets compared to diet without sweets in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 3
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in feces homo sapiens child colombia medellin metropolitan area daycare 1-5-years-old human )2019-02-12v4No1 / 3
555amnon high in autistic disorder autism compared to control in homo sapiens dentition child shanghai proper supragingival plaque age 7-14 years china 2019-09-10v3No1 / 4
491amnonhigher in lambs fed linseed oil supplemented diet compared to control diet ( high in diet linseed oil food product compared to control diet in farm rumen ovis aries child ireland sheep lamb age 100 days )2019-02-26v4No1 / 4
285amnonlower in individuals with muc5ac ( high in muc5ac deficient compared to muc5ac in homo sapiens united states of america middle ear acute transudative otitis media child state of washington obsolete_juvenile stage )2018-01-27v4No1 / 4
564amnon high in autistic disorder compared to control in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 5
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v4No1 / 5
598amnon high in male compared to female in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage 2020-03-25v3No1 / 5
598amnon high in female compared to male in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage 2020-03-25v3No1 / 5
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 5
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in feces homo sapiens child colombia medellin metropolitan area daycare 1-5-years-old human )2019-02-12v4No1 / 6
605amnoncommon control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
892amnon high in 4-year-old human stage compared to 2-year-old human stage in homo sapiens united states of america saliva child 2022-04-07v4No1 / 7
679amnondominant homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 7
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child azerbaijan obsolete_juvenile stage 2018-08-30v4No1 / 7
825amnon high in control compared to type i diabetes mellitus type 1 diabetes mellitus in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v3No1 / 7
605amnoncommon external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 7
730amnon high in crohn's disease compared to control in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v1No1 / 7
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 8
517amnondominant homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 8
658amnon high in caucasian european compared to african american in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
658amnon high in caucasian european compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
711amnondominant homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 9
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 9
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in feces homo sapiens child tanzania age 1-3 years pemba island 2-year-old human stage 1-year-old human stage 2021-01-25v3No1 / 9
605amnondominant control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 10
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to braces teeth braces in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 11
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child nigeria obsolete_juvenile stage 2018-08-30v4No1 / 12
596amnondominant homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 12
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 12
555amnon high in autistic disorder autism compared to control in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v3No1 / 13
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v3No1 / 13
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnondominant external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnon high in middle ear fluid compared to middle ear rinse in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 13
468amnonlower in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in lower respiratory tract disease compared to control in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 13
517amnondominant homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 13
564amnon high in control compared to autistic disorder in feces homo sapiens child italy 2-5 year-old child stage 2019-11-18v3No1 / 14
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child sudan obsolete_juvenile stage 2018-08-30v4No1 / 14
596amnondominant homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 14
605amnoncommon nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
605amnondominant nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, united states of america, middle ear, acute transudative otitis media, child, state of washington, obsolete_juvenile stage)2018-01-27v4No1 / 14
658amnon high in african american compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
658amnon high in hispanic or latin american hispanic compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
892amnon high in 2-year-old human stage compared to 4-year-old human stage in homo sapiens united states of america saliva child 2022-04-07v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 15
425amnondominant feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 15
425amnondominant feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 15
596amnondominant homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 15
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 15
517amnondominant feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 15
659amnondominant feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
365amnondominant feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 16
598amnondominant homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 16
491amnondominant farm, rumen, ovis aries, child, ireland, sheep, lamb, age 100 days2019-02-26v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
872amnondominant feces, homo sapiens, child, gambia, age 1-2 years2022-02-26v1No1 / 16
872amnondominant feces, homo sapiens, child, gambia, 2-year-old human stage2022-02-26v1No1 / 16
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 17
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 17
892amnondominant homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v4No1 / 17
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 17
365amnondominant feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 17
598amnonhigher in kids that do no eat sweets ( high in diet without sweets compared to diet containing sweets in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 17
730amnondominant feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 18
892amnondominant homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v4No1 / 18
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in feces homo sapiens child africa )2018-12-08v4No1 / 18
555amnondominant homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 18
564amnondominant feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in feces homo sapiens united states of america child )2018-11-22v4No1 / 18
542amnondominant research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 19
555amnon high in control compared to autistic disorder autism in homo sapiens dentition child shanghai proper supragingival plaque age 7-14 years china 2019-09-10v3No1 / 19
555amnondominant homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 19
797amnondominant feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 19
62amnondominant feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 19
679amnondominant homo sapiens, tonsil, fasting, child, palatine tonsil, south korea, age 5-10 years2028-03-02v3No1 / 19
704amnondominant homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 19
482amnondominant feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 19
736amnondominant feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 19
285amnoncommon in effluent from middle ear (common homo sapiens, united states of america, middle ear, acute transudative otitis media, child, state of washington, obsolete_juvenile stage)2018-01-27v4No1 / 19
892amnondominant homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 4-year-old human stage2022-04-07v4No1 / 20
564amnondominant feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 20
704amnon high in periodontitis compared to control in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 20
723amnoncommon feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 20
730amnondominant feces, homo sapiens, child, kingdom of the netherlands, amsterdam, crohn's disease2021-01-05v1No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
658amnon high in hispanic or latin american hispanic compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in feces homo sapiens child jordan obsolete_juvenile stage 2018-08-30v4No1 / 21
825amnondominant feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 21
596amnoncommon homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, supragingival dental plaque, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 22
425amnondominant homo sapiens, duodenum, child, africa, madagascar, stunted growth, antananarivo2018-12-08v4No1 / 22
797amnondominant feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 22
736amnon high in child age 1-3 years 2-year-old human stage 1-year-old human stage compared to female adult in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
509amnondominant feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 22
658amnondominant homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 23
892amnondominant homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 2-year-old human stage2022-04-07v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 23
425amnondominant homo sapiens, stomach, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 23
704amnondominant homo sapiens, saliva, child, turkey, istanbul, 10-15-years-old human2028-04-02v3No1 / 23
509amnondominant feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 23
704amnonnegatively correlated with age ( high in age 5-10 years compared to 10-15-years-old human in homo sapiens saliva child turkey istanbul )2028-04-02v3No1 / 24
365amnondominant feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 24
723amnondominant feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 24
605amnon high in middle ear rinse compared to middle ear fluid in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 24
872amnondominant feces, homo sapiens, infant, child, gambia, under-1-year-old human stage, age 6-12 months2022-02-26v1No1 / 24
895amnondominant feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v4No1 / 25
425amnondominant homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
62amnondominant feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 26
723amnondominant feces, homo sapiens, infant, child, indonesia, municipality of yogyakarta, age 0-6 months2021-01-02v3No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 26
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 27
695amnondominant feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 27
605amnon high in control compared to recurrent otitis media in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 27
562amnondominant feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 28
704amnonpositively correlated with age ( high in 10-15-years-old human compared to age 5-10 years in homo sapiens saliva child turkey istanbul )2028-04-02v3No1 / 28
365amnondominant feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 28
825amnondominant feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 28
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 28
658amnon high in african american compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 29
704amnon high in control compared to dental caries in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 29
658amnon high in caucasian european compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
695amnondominant feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 30
723amnoncommon feces, homo sapiens, child, indonesia, municipality of yogyakarta, 2-5 year-old child stage2021-01-02v3No1 / 30
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens duodenum child africa 2018-12-08v4No1 / 33
509amnon high in schistosomiasis urinary schistosomiasis compared to control in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v4No1 / 34
596amnoncommon homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 35
509amnon high in control compared to schistosomiasis urinary schistosomiasis in feces homo sapiens child nigeria kebbi state rural community 10-15-years-old human 2019-03-18v4No1 / 35
596amnoncommon homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
711amnoncommon homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 37
723amnon high in infant age 0-6 months compared to 2-5 year-old child stage in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 37
679amnoncommon homo sapiens, saliva, fasting, child, south korea, age 5-10 years2028-03-02v3No1 / 38
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 38
872amnoncommon feces, homo sapiens, infant, child, gambia, under-1-year-old human stage, age 6-12 months2022-02-26v1No1 / 39
892amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
542amnoncommon research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 41
679amnon high in tonsil palatine tonsil compared to saliva in homo sapiens fasting child south korea age 5-10 years 2028-03-02v3No1 / 41
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
872amnoncommon feces, homo sapiens, child, gambia, age 1-2 years2022-02-26v1No1 / 41
564amnoncommon feces, homo sapiens, autistic disorder, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 42
892amnoncommon homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 4-year-old human stage2022-04-07v4No1 / 43
555amnon high in control compared to autistic disorder autism in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v3No1 / 43
365amnoncommon feces, homo sapiens, child, sudan, obsolete_juvenile stage2018-08-30v4No1 / 44
517amnoncommon homo sapiens, mouth mucosa, child, bolivia, chuquisaca department, rural community, age 5-13 years, mouth2019-05-29v4No1 / 44
797amnoncommon feces, homo sapiens, child, germany, formula fed, 2-year-old human stage2021-06-13v3No1 / 46
482amnoncommon feces, homo sapiens, child, colombia, medellin metropolitan area, daycare, 1-5-years-old human2019-02-12v4No1 / 47
892amnoncommon homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 2-year-old human stage2022-04-07v4No1 / 48
736amnoncommon feces, homo sapiens, child, tanzania, age 1-3 years, pemba island, 2-year-old human stage, 1-year-old human stage2021-01-25v3No1 / 49
797amnoncommon feces, homo sapiens, child, germany, breast fed, 2-year-old human stage2021-06-13v3No1 / 50
564amnoncommon feces, homo sapiens, control, child, italy, 2-5 year-old child stage2019-11-18v3No1 / 50
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 50
730amnoncommon feces, homo sapiens, child, kingdom of the netherlands, amsterdam, crohn's disease2021-01-05v1No1 / 51
797amnon high in infant 12-month-old human stage compared to child 2-year-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 52
598amnonhigher in mouthwash of students compared to teachers ( high in child age 13-15 years 13-year-old human stage 14-year-old human stage compared to adult in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 52
730amnon high in control compared to crohn's disease in feces homo sapiens child kingdom of the netherlands amsterdam 2021-01-05v1No1 / 52
892amnon high in supragingival plaque dental plaque supragingival dental plaque compared to saliva in homo sapiens united states of america child 4-year-old human stage 2022-04-07v4No1 / 53
892amnoncommon homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v4No1 / 57
596amnoncommon homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 57
892amnoncommon homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v4No1 / 59
596amnoncommon homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 59
872amnon high in infant under-1-year-old human stage age 6-12 months compared to 1-year-old human stage in feces homo sapiens child gambia 2022-02-26v1No1 / 63
679amnoncommon homo sapiens, tonsil, fasting, child, palatine tonsil, south korea, age 5-10 years2028-03-02v3No1 / 64
695amnon high in sesame allergy compared to milk allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 64
895amnoncommon feces, homo sapiens, child, french republic, cystic fibrosis, bordeaux, 6-12 year-old child stage2022-04-16v4No1 / 65
365amnoncommon feces, homo sapiens, child, nigeria, obsolete_juvenile stage2018-08-30v4No1 / 66
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
872amnoncommon feces, homo sapiens, child, gambia, 2-year-old human stage2022-02-26v1No1 / 68
425amnoncommon feces, homo sapiens, child, africa, madagascar, antananarivo2018-12-08v4No1 / 73
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 79
777amnon high in infant 3-month-old human stage compared to child 18-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
425amnoncommon feces, homo sapiens, child, africa, central african republic, bangui2018-12-08v4No1 / 79
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in braces teeth braces compared to control in homo sapiens saliva oral cavity child kingdom of spain age 13-15 years 13-year-old human stage 14-year-old human stage )2020-03-25v3No1 / 79
736amnon high in female adult compared to child age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens tanzania pemba island 2021-01-25v3No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
777amnon high in 3-year-old human stage compared to 5-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 81
658amnoncommon homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 82
562amnoncommon feces, child, ecuador, age 5-13 years, quito2019-11-05v4No1 / 82
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 83
777amnon high in 18-month-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 83
804amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 85
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child 2-5 year-old child stage in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
711amnon high in child age 8-12 years compared to adult in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 88
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 92
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
723amnonhigher in children age 2-4 years compared to mothers ( high in child 2-5 year-old child stage compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
555amnoncommon homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 96
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
730amnoncommon feces, homo sapiens, control, child, kingdom of the netherlands, amsterdam2021-01-05v1No1 / 97
658amnoncommon homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, supragingival dental plaque, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 98
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
704amnon high in dental caries compared to control in homo sapiens saliva child turkey istanbul age 5-10 years 10-15-years-old human 2028-04-02v3No1 / 102
425amnon high in madagascar antananarivo compared to central african republic bangui in homo sapiens duodenum child africa 2018-12-08v4No1 / 103
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, 10-15-years-old human2028-04-02v3No1 / 105
491amnoncommon farm, rumen, ovis aries, child, ireland, sheep, lamb, age 100 days2019-02-26v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
892amnon high in saliva compared to supragingival plaque dental plaque supragingival dental plaque in homo sapiens united states of america child 4-year-old human stage 2022-04-07v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in feces homo sapiens child israel food allergy age 4-10 years 2028-03-27v4No1 / 107
704amnoncommon homo sapiens, saliva, child, turkey, istanbul, age 5-10 years2028-04-02v3No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
425amnoncommon homo sapiens, stomach, child, africa, stunted growth2018-12-08v4No1 / 111
555amnoncommon homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 112
517amnoncommon feces, homo sapiens, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 113
658amnon high in asian burmese compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
777amnon high in 5-year-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
517amnoncommon homo sapiens, arm, skin, forearm, child, bolivia, chuquisaca department, rural community, age 5-13 years2019-05-29v4No1 / 121
425amnoncommon homo sapiens, duodenum, child, africa, madagascar, antananarivo2018-12-08v4No1 / 123
598amnoncommon homo sapiens, saliva, oral cavity, child, kingdom of spain, age 13-15 years, 13-year-old human stage, 14-year-old human stage2020-03-25v3No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, duodenum, child, africa, central african republic, bangui, stunted growth2018-12-08v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
797amnon high in child 2-year-old human stage compared to infant 12-month-old human stage in feces homo sapiens germany formula fed 2021-06-13v3No1 / 139
62amnon high in egypt compared to united states of america in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 144
509amnoncommon feces, homo sapiens, child, nigeria, kebbi state, rural community, schistosomiasis, urinary schistosomiasis, 10-15-years-old human2019-03-18v4No1 / 146
509amnoncommon feces, homo sapiens, control, child, nigeria, kebbi state, rural community, 10-15-years-old human2019-03-18v4No1 / 147
605amnon high in recurrent otitis media compared to control in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 149
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 157
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 162
658amnon high in asian burmese compared to african american in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 166
892amnon high in child 4-year-old human stage compared to adult organism human adult stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 180
777amnon high in 3-year-old human stage compared to 18-month-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
555amnon high in dentition supragingival plaque compared to saliva in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
872amnon high in 1-year-old human stage compared to infant under-1-year-old human stage age 6-12 months in feces homo sapiens child gambia 2022-02-26v1No1 / 188
555amnon high in saliva compared to dentition supragingival plaque in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 205
658amnon high in asian burmese compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 212
892amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 216
10amnonpositively correlated with age (6-35) ( high in adult compared to child in feces homo sapiens toronto )2016-10-27v4No1 / 228
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to child age 13-15 years 13-year-old human stage 14-year-old human stage in homo sapiens saliva oral cavity kingdom of spain )2020-03-25v3No1 / 232
872amnon high in 1-year-old human stage compared to 2-year-old human stage in feces homo sapiens child gambia 2022-02-26v1No1 / 233
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 242
425amnon high in madagascar antananarivo compared to central african republic bangui in feces homo sapiens child africa 2018-12-08v4No1 / 248
892amnon high in adult human adult stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 275
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
596amnon high in age 1-7 years 2-5 year-old child stage compared to under-1-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 288
723amnon high in 2-5 year-old child stage compared to infant age 0-6 months in feces homo sapiens child indonesia municipality of yogyakarta 2021-01-02v3No1 / 305
542amnon high in adult age 12-23 years compared to child age 1-7 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 337
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
425amnon high in duodenum compared to feces in homo sapiens child africa 2018-12-08v4No1 / 622
872amnon high in 2-year-old human stage compared to 1-year-old human stage in feces homo sapiens child gambia 2022-02-26v1No1 / 704
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
517amnon high in arm skin forearm compared to feces in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 836
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org