Summary for ontology term: child

Number of annotations with term: 302

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.031034
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCTCGTAGGTGGTGTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCACGACTAGAGTGCTGTAGGGGTAACTGGAATTCCTG0.027586
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATAGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.027586
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AbiotrophiaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGTGTAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAATTCCATG0.027586
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAACTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGGCTGGAACTCCTGG0.027586
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGCTGGTCGCGTCTGCCGTGAAATCCTCTGGCTCAGCTGGGGGCGTGCGGTGGGTACGGGCTGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.027586
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.024138
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGTGTAACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.024138
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGAGGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.024138
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.020690

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.428571
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.357143
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.357143
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.357143
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.357143
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Leptotrichiaceae"TACGTATGTCGCAAGCGTTATCCGGAATTATTGGGCATAAAGGGCATCTAGGCGGATATACAAGTCAGGGGTGAAAACTTAGGGCTCAACTCAAAGCTTGCCTTTGAAACTGTATATCTAGAGTGCTGGAGAGGTGGACGGAACTACACG0.357143
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTCATTGGGTTTAAAGGGAGCGTAGGCCGTGGATTAAGCGTGTTGTGAAATGTAGGCGCTCAACGTCTGACTTGCAGCGCGAACTGGTCCACTTGAGTGTGCGCGACGCAGGCGGAATTCGTGG0.285714
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__PeptostreptococcusTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTCCTTCAAGTCGGTGGTTAAAGGCTACGGCTCAACCGTAGTAAGCCGCCGAAACTGGAGGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCCAGT0.285714
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGATTAAGTCAGCTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGTTGTCTTGAGTGCACGCAGGGATGTTGGAATTCATGG0.285714

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTATCTTACCAGAAAGGGACGG0.212329
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACAGTAGAGACGGTACCTAACCAGAAAGCCACGGC0.200000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTCTGAAGAAGGCCTTCGGGTTGTAAAGGACTTTTGTCAGGGAAGAAAAGGGCGGGGTTAATACCCCTGTCTGATGACGGTACCTGAAGAATAAGCACCGGC0.198020
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGTGCTAGAGTAACTGTTAGCGCCTTGACGGTATCTAACCAGAAAGCCACGGC0.195745
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTGTATGGGGATAAAGTTAGGGACGTGTCCCTATTTGCAGGTACCATACGAATAAGGACCGGCTAATT0.195455
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTTAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG0.189873
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGTTAAGTCAGCGGTGAAATCTAGAGGCTCAACCTCGAAACTGCCGTTGAAACTGGCGAACTTGAGTGTAGATGAGGTAGGCGGAATTCGTGG0.187990
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__NeisseriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGGGCGCAGACGGTTACTTAAGCAGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCTGAACTGGGTGACTAGAGTGTGTCAGAGGGAGGTAGAATTCCACG0.187919
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__HaemophilusTGGGGAATATTGCGCAATGGGGGCAACCCTGACGCAGCCATGCCGCGTGAATGAAGAAGGCCTTCGGGTTGTAAAGTTCTTTCGGTAGCGAGGAAGGCATTTAGTTTAATAGACTAGGTGATTGACGTTAACTACAGAAGAAGCACCGGC0.181102
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAACTCTGTTGTTAGAGAAGAACAGCGCATAGAGTAACTGTTATGCGTGTGACGGTATCTAACCAGAAAGCCACGGC0.180371

Annotations:

common ontology terms
term enrichment score
TermScore
child0.996431
2-year-old human stage0.220017
homo sapiens0.218865
supragingival plaque0.217411
saliva0.201986
supragingival dental plaque0.200222
obsolete_juvenile stage0.165746
7-year-old human stage0.152905
dentition0.141454
8-year-old human stage0.135802
1-year-old human stage0.119543
feces0.119514
4-year-old human stage0.112500
sweden0.108614
10-year-old human stage0.106509
11-year-old human stage0.106509
9-year-old human stage0.106509
6-year-old human stage0.106509
age 1-3 years0.106509
no dental caries0.100629
state of nebraska0.096257
control0.095610
2-5 year-old child stage0.093132
LOWER IN child0.091429
age 5-13 years0.086687
rural community0.085919
perth0.084848
LOWER IN control0.084438
municipality of umea0.079268
10-15-years-old human0.075000
chuquisaca department0.073620
infant0.072684
age 5-10 years0.069074
oral cavity0.068796
bolivia0.068571
recurrent otitis media0.067901
united states of america0.067178
ulcerative colitis0.065137
age 7-14 years0.062112
gambia0.062112
nigeria0.061162
shanghai proper0.060241
central african republic0.057052
middle ear0.057052
africa0.056980
istanbul0.056250
age 13-15 years0.056250
turkey0.054711
14-year-old human stage0.054711
13-year-old human stage0.053254
madagascar0.050955
indonesia0.050314
municipality of yogyakarta0.050314
crohn's disease0.048485
bangui0.044304
type i diabetes mellitus0.044304
LOWER IN infant0.041543
australia0.041176
adult0.040984
mouth0.039801
kingdom of spain0.039062
LOWER IN 4-year-old human stage0.038961
age 1-7 years0.038585
LOWER IN 2-year-old human stage0.038511
stunted growth0.038217
antananarivo0.038217
age 4-10 years0.038217
age 6-14 years0.038217
hangzhou city prefecture0.038217
kebbi state0.038217
food allergy0.037500
LOWER IN adult0.036885
puerto rico0.036810
LOWER IN 1-year-old human stage0.036474
amsterdam0.036145
duodenum0.035623
macaca mulatta0.034884
china0.034563
kingdom of the netherlands0.034286
nasopharynx0.033149
autistic disorder0.032310
18-month-old human stage0.032051
burmese0.032051
LOWER IN type i diabetes mellitus0.032051
pemba island0.032051
asian0.031546
6-12 year-old child stage0.031546
european0.031056
caucasian0.031056
subgingival plaque0.030612
monkey0.030612
tanzania0.030581
fasting0.030120
israel0.029703
italy0.027650
dental plaque0.027624
south korea0.026882
3-year-old human stage0.025806
jordan0.025806
azerbaijan0.025806
Fraction of dbbact annotations with this term covered by the query
TermScore
child1.051282
7-year-old human stage1.000000
8-year-old human stage1.000000
4-year-old human stage1.000000
LOWER IN 4-year-old human stage1.000000
no dental caries1.000000
orenburg1.000000
2-year-old human stage0.875000
age 1-7 years0.666667
LOWER IN age 1-7 years0.666667
central african republic0.666667
madagascar0.666667
autistic disorder0.666667
LOWER IN autistic disorder0.666667
age 5-13 years0.666667
age 5-10 years0.666667
LOWER IN dental caries0.666667
dental caries0.666667
10-15-years-old human0.666667
middle ear0.666667
supragingival dental plaque0.625000
LOWER IN 2-year-old human stage0.625000
supragingival plaque0.545455
5-year-old human stage0.500000
municipality of umea0.500000
18-month-old human stage0.500000
3-year-old human stage0.500000
LOWER IN 18-month-old human stage0.500000
LOWER IN 3-year-old human stage0.500000
LOWER IN 5-year-old human stage0.500000
10-year-old human stage0.500000
11-year-old human stage0.500000
9-year-old human stage0.500000
6-year-old human stage0.500000
burmese0.500000
LOWER IN burmese0.500000
acute severe colitis0.500000
LOWER IN doxycycline0.500000
LOWER IN amoxicillin0.500000
bordeaux0.500000
LOWER IN age 12-23 years0.500000
age 12-23 years0.500000
induced periodontitis0.500000
LOWER IN induced periodontitis0.500000
LOWER IN stunted growth0.500000
stunted growth0.500000
bangui0.500000
LOWER IN antananarivo0.500000
antananarivo0.500000
LOWER IN bangui0.500000
age 7-14 years0.500000
autism0.500000
LOWER IN autism0.500000
obsolete_juvenile stage0.500000
age 3-60.500000
age 8-120.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
quito0.500000
age 2-5 years0.500000
LOWER IN sesame allergy0.500000
milk allergy0.500000
age 4-10 years0.500000
LOWER IN milk allergy0.500000
sesame allergy0.500000
istanbul0.500000
LOWER IN age 8-12 years0.500000
age 8-12 years0.500000
jordan0.500000
LOWER IN type i diabetes mellitus0.500000
type i diabetes mellitus0.500000
azerbaijan0.500000
type 1 diabetes mellitus0.500000
age 6-14 years0.500000
hangzhou city prefecture0.500000
LOWER IN type 1 diabetes mellitus0.500000
glasgow0.500000
LOWER IN teeth braces0.500000
LOWER IN braces0.500000
age 13-15 years0.500000
teeth braces0.500000
braces0.500000
diet without sweets0.500000
LOWER IN diet containing sweets0.500000
diet containing sweets0.500000
LOWER IN diet without sweets0.500000
LOWER IN age 13-15 years0.500000
age 0-6 months0.500000
indonesia0.500000
municipality of yogyakarta0.500000
daycare0.500000
1-5-years-old human0.500000
LOWER IN trichuriasis0.500000
trichuriasis0.500000
LOWER IN age 0-6 months0.500000
age 1-3 years0.500000
perth0.500000
recurrent otitis media0.500000
LOWER IN recurrent otitis media0.500000
middle ear fluid0.500000
Fraction of annotations for the query sequences containing the term
TermScore
child0.947020
homo sapiens0.900662
feces0.423841
united states of america0.258278
saliva0.248344
supragingival plaque0.135762
2-year-old human stage0.125828
dentition0.119205
supragingival dental plaque0.119205
control0.102649
obsolete_juvenile stage0.099338
sweden0.096026
china0.086093
7-year-old human stage0.082781
1-year-old human stage0.076159
LOWER IN control0.076159
8-year-old human stage0.072848
africa0.066225
10-year-old human stage0.059603
11-year-old human stage0.059603
9-year-old human stage0.059603
6-year-old human stage0.059603
state of nebraska0.059603
4-year-old human stage0.059603
age 1-3 years0.059603
rural community0.059603
LOWER IN child0.052980
2-5 year-old child stage0.052980
no dental caries0.052980
age 5-13 years0.046358
oral cavity0.046358
australia0.046358
perth0.046358
municipality of umea0.043046
infant0.043046
10-15-years-old human0.039735
bolivia0.039735
chuquisaca department0.039735
ulcerative colitis0.036424
age 5-10 years0.036424
recurrent otitis media0.036424
adult0.033113
shanghai proper0.033113
age 7-14 years0.033113
nigeria0.033113
kingdom of spain0.033113
gambia0.033113
LOWER IN adult0.029801
central african republic0.029801
istanbul0.029801
turkey0.029801
14-year-old human stage0.029801
13-year-old human stage0.029801
age 13-15 years0.029801
middle ear0.029801
madagascar0.026490
mouth0.026490
crohn's disease0.026490
indonesia0.026490
municipality of yogyakarta0.026490
LOWER IN infant0.023179
bangui0.023179
duodenum0.023179
type i diabetes mellitus0.023179
LOWER IN 4-year-old human stage0.019868
LOWER IN 1-year-old human stage0.019868
LOWER IN 2-year-old human stage0.019868
subgingival plaque0.019868
monkey0.019868
macaca mulatta0.019868
research facility0.019868
puerto rico0.019868
age 1-7 years0.019868
stunted growth0.019868
antananarivo0.019868
germany0.019868
italy0.019868
food allergy0.019868
age 4-10 years0.019868
israel0.019868
age 6-14 years0.019868
hangzhou city prefecture0.019868
nasopharynx0.019868
amsterdam0.019868
kingdom of the netherlands0.019868
kebbi state0.019868
18-month-old human stage0.016556
asian0.016556
burmese0.016556
european0.016556
caucasian0.016556
dental plaque0.016556
6-12 year-old child stage0.016556
autistic disorder0.016556
south korea0.016556
fasting0.016556
LOWER IN type i diabetes mellitus0.016556
tanzania0.016556
pemba island0.016556
3-year-old human stage0.013245
Exp. ID User ID Description Date Region Flag Sequences
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 1
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 12-month-old human stage 3-month-old human stage 2-year-old human stage in homo sapiens sweden saliva child )2020-03-18v3No1 / 1
491amnonlower in lambs fed linseed oil supplemented diet compared to control diet ( high in control diet compared to linseed oil food product in ovis aries sheep lamb child rumen ireland farm age 100 days )2019-02-26v4No1 / 1
425amnonhigher in kids with stunted growth compared to non-stunted ( high in stunted growth compared to control in homo sapiens feces africa child )2018-12-08v4No1 / 2
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v4No1 / 2
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 2
598amnonhigher in kids that eat sweets ( high in diet containing sweets compared to diet without sweets in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 3
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 3
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years dentition supragingival plaque china 2019-09-10v3No1 / 4
491amnonhigher in lambs fed linseed oil supplemented diet compared to control diet ( high in diet linseed oil food product compared to control diet in ovis aries sheep lamb child rumen ireland farm age 100 days )2019-02-26v4No1 / 4
285amnonlower in individuals with muc5ac ( high in muc5ac deficient compared to muc5ac in homo sapiens child obsolete_juvenile stage middle ear acute transudative otitis media united states of america state of washington )2018-01-27v4No1 / 4
564amnon high in autistic disorder compared to control in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v3No1 / 5
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 5
598amnon high in male compared to female in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v3No1 / 5
598amnon high in female compared to male in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens 2020-03-25v3No1 / 5
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 5
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 6
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v3No1 / 6
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v3No1 / 6
892amnon high in 4-year-old human stage compared to 2-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v4No1 / 7
679amnondominant saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v3No1 / 7
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces child obsolete_juvenile stage azerbaijan 2018-08-30v4No1 / 7
825amnon high in control compared to type 1 diabetes mellitus type i diabetes mellitus in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 7
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v3No1 / 7
730amnon high in crohn's disease compared to control in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v1No1 / 7
365amnon high in type i diabetes mellitus diabetes mellitus compared to control in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 8
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 8
658amnon high in european caucasian compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 9
658amnon high in caucasian european compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v3No1 / 9
711amnondominant age 8-12 years, child, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 9
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v3No1 / 9
736amnon high in parasitic helminthiasis infectious disease helminthiasis compared to control in 2-year-old human stage 1-year-old human stage age 1-3 years child tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 9
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, control2020-04-07v3No1 / 10
598amnonlower in mouthwash of kids with braces compared to no braces ( high in control compared to teeth braces braces in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 11
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage nigeria 2018-08-30v4No1 / 12
596amnondominant 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 12
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear rinse2020-04-07v3No1 / 12
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 13
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 13
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, middle ear, middle ear fluid2020-04-07v3No1 / 13
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, child, age 1-3 years, perth, recurrent otitis media, external acoustic meatus, ear canal2020-04-07v3No1 / 13
605amnon high in middle ear fluid compared to middle ear rinse in 2-year-old human stage 1-year-old human stage australia child age 1-3 years perth recurrent otitis media middle ear 2020-04-07v3No1 / 13
468amnonlower in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in lower respiratory tract disease compared to control in homo sapiens united states of america child trachea tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 13
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 13
564amnon high in control compared to autistic disorder in 2-5 year-old child stage homo sapiens child italy feces 2019-11-18v3No1 / 14
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces child obsolete_juvenile stage sudan 2018-08-30v4No1 / 14
596amnondominant 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v3No1 / 14
596amnondominant 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 14
596amnondominant 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 14
605amnoncommon 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 14
605amnondominant 2-year-old human stage, 1-year-old human stage, australia, nasopharynx, child, age 1-3 years, perth, recurrent otitis media2020-04-07v3No1 / 14
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 14
658amnon high in african american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 15
658amnon high in hispanic hispanic or latin american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 15
892amnon high in 2-year-old human stage compared to 4-year-old human stage in child saliva united states of america homo sapiens 2022-04-07v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 15
425amnondominant homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 15
926amnondominant 2-5 year-old child stage, orenburg, supragingival dental plaque, supragingival plaque, russia, child, homo sapiens2022-07-28v3No1 / 15
596amnondominant 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 15
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 15
517amnondominant feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 15
659amnondominant ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 16
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v4No1 / 16
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 16
598amnondominant 14-year-old human stage, 13-year-old human stage, child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 16
491amnondominant ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
872amnondominant age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v1No1 / 16
872amnondominant 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v1No1 / 16
777amnondominant 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 17
777amnondominant 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 17
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 17
892amnondominant 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 17
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 17
922amnondominant no dental caries, 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v4No1 / 17
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 17
598amnonhigher in kids that do no eat sweets ( high in diet without sweets compared to diet containing sweets in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 17
730amnondominant control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 17
777amnondominant 18-month-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
777amnondominant 5-year-old human stage, child, municipality of umea, sweden, saliva, homo sapiens2021-04-26v3No1 / 18
892amnondominant 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 18
425amnonlower in kids with stunted growth compared to non-stunted ( high in control compared to stunted growth in homo sapiens feces africa child )2018-12-08v4No1 / 18
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 18
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v3No1 / 18
922amnondominant no dental caries, 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-07-25v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens child united states of america feces )2018-11-22v4No1 / 18
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 19
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years dentition supragingival plaque china 2019-09-10v3No1 / 19
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 19
797amnondominant 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v3No1 / 19
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 19
679amnondominant south korea, age 5-10 years, child, fasting, palatine tonsil, tonsil, homo sapiens2028-03-02v3No1 / 19
924amnondominant 8-year-old human stage, 7-year-old human stage, china, supragingival dental plaque, supragingival plaque, guangzhou city prefecture, child2022-07-27v3No1 / 19
704amnondominant istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v3No1 / 19
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 19
736amnondominant 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 19
285amnoncommon in effluent from middle ear (common homo sapiens, child, obsolete_juvenile stage, middle ear, acute transudative otitis media, united states of america, state of washington)2018-01-27v4No1 / 19
892amnondominant 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v4No1 / 20
564amnondominant 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v3No1 / 20
922amnondominant no dental caries, 4-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v4No1 / 20
704amnon high in periodontitis compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 20
723amnoncommon infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v3No1 / 20
730amnondominant crohn's disease, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
658amnon high in hispanic hispanic or latin american compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage state of nebraska united states of america supragingival plaque supragingival dental plaque dentition child homo sapiens 2020-09-17v3No1 / 21
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 21
365amnon high in control compared to type i diabetes mellitus diabetes mellitus in homo sapiens feces jordan child obsolete_juvenile stage 2018-08-30v4No1 / 21
825amnondominant age 6-14 years, hangzhou city prefecture, china, child, control, homo sapiens, feces2021-08-12v3No1 / 21
596amnoncommon 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 21
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 22
425amnondominant homo sapiens, africa, child, duodenum, antananarivo, madagascar, stunted growth2018-12-08v4No1 / 22
797amnondominant 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v3No1 / 22
924amnon high in control compared to dental caries dental caries in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v3No1 / 22
736amnon high in 2-year-old human stage 1-year-old human stage age 1-3 years child compared to female adult in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 22
395amnondominant homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 22
297amnondominant adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 22
658amnondominant 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 23
892amnondominant 2-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 23
425amnondominant homo sapiens, africa, child, stunted growth, stomach, central african republic, bangui2018-12-08v4No1 / 23
922amnondominant no dental caries, 2-year-old human stage, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v4No1 / 23
704amnondominant 10-15-years-old human, istanbul, turkey, child, saliva, homo sapiens2028-04-02v3No1 / 23
509amnondominant 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 23
704amnonnegatively correlated with age ( high in age 5-10 years compared to 10-15-years-old human in istanbul turkey child saliva homo sapiens )2028-04-02v3No1 / 24
365amnondominant homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 24
723amnondominant 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v3No1 / 24
605amnon high in middle ear rinse compared to middle ear fluid in 2-year-old human stage 1-year-old human stage australia child age 1-3 years perth recurrent otitis media middle ear 2020-04-07v3No1 / 24
872amnondominant age 6-12 months, under-1-year-old human stage, gambia, child, infant, homo sapiens, feces2022-02-26v1No1 / 24
895amnondominant 6-12 year-old child stage, bordeaux, cystic fibrosis, french republic, child, homo sapiens, feces2022-04-16v4No1 / 25
425amnondominant homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 25
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
62amnondominant homo sapiens, feces, obsolete_juvenile stage, child, united states of america2017-02-13v4No1 / 26
723amnondominant infant, homo sapiens, indonesia, municipality of yogyakarta, feces, child, age 0-6 months2021-01-02v3No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america biopsy biopsy site rectum )2018-11-22v4No1 / 26
659amnoncommon ulcerative colitis, acute severe colitis, homo sapiens, child, feces2020-09-19v4No1 / 27
438amnondominant 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
924amnon high in dental caries dental caries compared to control in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v3No1 / 27
695amnondominant milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 27
605amnon high in control compared to recurrent otitis media in 2-year-old human stage 1-year-old human stage australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 27
562amnondominant feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 28
704amnonpositively correlated with age ( high in 10-15-years-old human compared to age 5-10 years in istanbul turkey child saliva homo sapiens )2028-04-02v3No1 / 28
365amnondominant homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 28
825amnondominant type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 28
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 28
658amnon high in african american compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 29
704amnon high in control compared to dental caries in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 29
658amnon high in european caucasian compared to asian burmese in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 30
438amnondominant 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
695amnondominant sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 30
723amnoncommon 2-5 year-old child stage, homo sapiens, indonesia, municipality of yogyakarta, feces, child2021-01-02v3No1 / 30
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens africa child duodenum 2018-12-08v4No1 / 33
509amnon high in urinary schistosomiasis schistosomiasis compared to control in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v4No1 / 34
596amnoncommon 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v3No1 / 35
509amnon high in control compared to urinary schistosomiasis schistosomiasis in 10-15-years-old human feces homo sapiens nigeria kebbi state rural community child 2019-03-18v4No1 / 35
596amnoncommon 12-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, child, trachea, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
711amnoncommon age 8-12 years, child, state of colorado, united states of america, mouth, oral cavity, homo sapiens2028-05-21v4No1 / 37
723amnon high in age 0-6 months infant compared to 2-5 year-old child stage in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 37
679amnoncommon saliva, south korea, age 5-10 years, child, fasting, homo sapiens2028-03-02v3No1 / 38
297amnon high in control compared to crohn's disease ulcerative colitis in adolescent stage immature stage homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
872amnoncommon age 6-12 months, under-1-year-old human stage, infant, gambia, child, homo sapiens, feces2022-02-26v1No1 / 39
892amnon high in 1-year-old human stage infant compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v4No1 / 40
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No1 / 40
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 41
679amnon high in tonsil palatine tonsil compared to saliva in south korea age 5-10 years child fasting homo sapiens 2028-03-02v3No1 / 41
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in dentition supragingival plaque supragingival dental plaque no dental caries united states of america homo sapiens 2022-07-25v4No1 / 41
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in saliva no dental caries united states of america homo sapiens 2022-07-25v4No1 / 41
825amnoncommon type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 41
872amnoncommon age 1-2 years, gambia, child, homo sapiens, feces2022-02-26v1No1 / 41
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, autistic disorder2019-11-18v3No1 / 42
922amnoncommon 4-year-old human stage, no dental caries, supragingival dental plaque, supragingival plaque, child, dentition, united states of america, homo sapiens2022-07-25v4No1 / 42
892amnoncommon 4-year-old human stage, supragingival dental plaque, dental plaque, supragingival plaque, child, united states of america, homo sapiens2022-04-07v4No1 / 43
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 43
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, sudan2018-08-30v4No1 / 44
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
797amnoncommon 2-year-old human stage, child, formula fed, germany, homo sapiens, feces2021-06-13v3No1 / 46
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 47
892amnoncommon 2-year-old human stage, child, supragingival dental plaque, dental plaque, supragingival plaque, united states of america, homo sapiens2022-04-07v4No1 / 48
922amnoncommon 2-year-old human stage, child, no dental caries, supragingival dental plaque, supragingival plaque, dentition, united states of america, homo sapiens2022-07-25v4No1 / 48
736amnoncommon 2-year-old human stage, 1-year-old human stage, age 1-3 years, child, tanzania, pemba island, feces, homo sapiens2021-01-25v3No1 / 49
797amnoncommon 2-year-old human stage, breast fed, child, germany, homo sapiens, feces2021-06-13v3No1 / 50
564amnoncommon 2-5 year-old child stage, homo sapiens, child, italy, feces, control2019-11-18v3No1 / 50
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 50
730amnoncommon crohn's disease, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 51
797amnon high in 12-month-old human stage infant compared to 2-year-old human stage child in formula fed germany homo sapiens feces 2021-06-13v3No1 / 52
598amnonhigher in mouthwash of students compared to teachers ( high in 14-year-old human stage 13-year-old human stage child age 13-15 years compared to adult in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 52
730amnon high in control compared to crohn's disease in amsterdam kingdom of the netherlands child feces homo sapiens 2021-01-05v1No1 / 52
892amnon high in supragingival plaque supragingival dental plaque dental plaque compared to saliva in 4-year-old human stage child united states of america homo sapiens 2022-04-07v4No1 / 53
926amnoncommon 2-5 year-old child stage, supragingival plaque, supragingival dental plaque, child, orenburg, russia, homo sapiens2022-07-28v3No1 / 55
922amnoncommon 4-year-old human stage, no dental caries, child, saliva, united states of america, homo sapiens2022-07-25v4No1 / 56
892amnoncommon 4-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 57
596amnoncommon 2-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 57
922amnon high in supragingival plaque supragingival dental plaque dentition compared to saliva in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v4No1 / 58
892amnoncommon 2-year-old human stage, child, saliva, united states of america, homo sapiens2022-04-07v4No1 / 59
922amnoncommon child, 2-year-old human stage, no dental caries, saliva, united states of america, homo sapiens2022-07-25v4No1 / 59
596amnoncommon 7-year-old human stage, homo sapiens, sweden, saliva, child2020-03-17v3No1 / 59
872amnon high in infant age 6-12 months under-1-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 63
679amnoncommon south korea, age 5-10 years, child, fasting, palatine tonsil, tonsil, homo sapiens2028-03-02v3No1 / 64
695amnon high in sesame allergy compared to milk allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 64
895amnoncommon 6-12 year-old child stage, cystic fibrosis, bordeaux, french republic, child, feces, homo sapiens2022-04-16v4No1 / 65
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, nigeria2018-08-30v4No1 / 66
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
872amnoncommon 2-year-old human stage, gambia, child, homo sapiens, feces2022-02-26v1No1 / 68
425amnoncommon homo sapiens, feces, africa, child, madagascar, antananarivo2018-12-08v4No1 / 73
596amnon high in under-1-year-old human stage compared to 2-5 year-old child stage age 1-7 years in homo sapiens sweden saliva child 2020-03-18v3No1 / 78
777amnoncommon 18-month-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 79
777amnon high in 3-month-old human stage infant compared to 18-month-old human stage child in municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 79
425amnoncommon homo sapiens, feces, africa, child, central african republic, bangui2018-12-08v4No1 / 79
598amnonhigher in mouthwash of kids with braces compared to no braces ( high in teeth braces braces compared to control in 14-year-old human stage 13-year-old human stage child age 13-15 years saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 79
736amnon high in adult female compared to 2-year-old human stage 1-year-old human stage age 1-3 years child in tanzania pemba island feces homo sapiens 2021-01-25v3No1 / 79
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 80
777amnon high in 3-year-old human stage compared to 5-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 81
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, european, caucasian, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 82
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
777amnoncommon 5-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 83
777amnon high in 18-month-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 83
804amnon high in iga negative fraction compared to iga positive fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 85
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to 2-5 year-old child stage child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
711amnon high in age 8-12 years child compared to adult in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v4No1 / 88
777amnoncommon 3-year-old human stage, homo sapiens, saliva, sweden, municipality of umea, child2021-04-26v3No1 / 92
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, hispanic or latin american, hispanic, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 93
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 94
723amnonhigher in children age 2-4 years compared to mothers ( high in 2-5 year-old child stage child compared to adult in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 95
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
922amnon high in child 4-year-old human stage compared to human adult stage adult in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 97
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
730amnoncommon control, amsterdam, kingdom of the netherlands, child, feces, homo sapiens2021-01-05v1No1 / 97
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, african american, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 98
804amnon high in iga positive fraction compared to iga negative fraction in central african republic madagascar age 2-5 years child africa homo sapiens feces 2021-06-18v4No1 / 100
922amnon high in saliva compared to supragingival plaque supragingival dental plaque dentition in no dental caries 4-year-old human stage child united states of america homo sapiens 2022-07-25v4No1 / 102
704amnon high in dental caries compared to control in 10-15-years-old human age 5-10 years homo sapiens saliva child turkey istanbul 2028-04-02v3No1 / 102
425amnon high in antananarivo madagascar compared to central african republic bangui in homo sapiens africa child duodenum 2018-12-08v4No1 / 103
704amnoncommon 10-15-years-old human, istanbul, turkey, child, saliva, homo sapiens2028-04-02v3No1 / 105
491amnoncommon ovis aries, sheep, lamb, child, rumen, ireland, farm, age 100 days2019-02-26v4No1 / 105
438amnoncommon 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
892amnon high in saliva compared to supragingival plaque supragingival dental plaque dental plaque in 4-year-old human stage child united states of america homo sapiens 2022-04-07v4No1 / 107
695amnon high in milk allergy compared to sesame allergy in food allergy age 4-10 years child israel feces homo sapiens 2028-03-27v4No1 / 107
704amnoncommon istanbul, turkey, age 5-10 years, child, saliva, homo sapiens2028-04-02v3No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
425amnoncommon homo sapiens, africa, child, stunted growth, stomach2018-12-08v4No1 / 111
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
658amnon high in asian burmese compared to hispanic or latin american hispanic in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
777amnon high in 5-year-old human stage compared to 3-year-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 120
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
425amnoncommon homo sapiens, africa, child, duodenum, antananarivo, madagascar2018-12-08v4No1 / 123
598amnoncommon 14-year-old human stage, 13-year-old human stage, child, age 13-15 years, saliva, kingdom of spain, oral cavity, homo sapiens2020-03-25v3No1 / 124
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
425amnoncommon homo sapiens, africa, child, duodenum, stunted growth, central african republic, bangui2018-12-08v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to biopsy rectum biopsy site in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 126
711amnon high in adult compared to age 8-12 years child in state of colorado united states of america mouth oral cavity homo sapiens 2028-05-21v4No1 / 133
797amnon high in 2-year-old human stage child compared to 12-month-old human stage infant in formula fed germany homo sapiens feces 2021-06-13v3No1 / 139
62amnon high in egypt compared to united states of america in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 144
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, urinary schistosomiasis, schistosomiasis2019-03-18v4No1 / 146
509amnoncommon 10-15-years-old human, feces, homo sapiens, nigeria, kebbi state, rural community, child, control2019-03-18v4No1 / 147
605amnon high in recurrent otitis media compared to control in 2-year-old human stage 1-year-old human stage australia nasopharynx child age 1-3 years perth 2020-04-07v3No1 / 149
658amnoncommon 7-year-old human stage, 10-year-old human stage, 11-year-old human stage, 9-year-old human stage, 8-year-old human stage, 6-year-old human stage, asian, burmese, homo sapiens, child, dentition, supragingival dental plaque, supragingival plaque, united states of america, state of nebraska2020-09-17v3No1 / 157
297amnoncommon adolescent stage, immature stage, homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
658amnon high in asian burmese compared to african american in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 166
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in no dental caries supragingival dental plaque supragingival plaque dentition united states of america homo sapiens 2022-07-25v4No1 / 167
892amnon high in 4-year-old human stage child compared to human adult stage adult organism in saliva united states of america homo sapiens 2022-04-07v4No1 / 180
924amnoncommon guangzhou city prefecture, 8-year-old human stage, 7-year-old human stage, child, supragingival dental plaque, supragingival plaque, china2022-07-27v3No1 / 181
777amnon high in 3-year-old human stage compared to 18-month-old human stage in child municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 184
555amnon high in supragingival plaque dentition compared to saliva in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 185
872amnon high in 1-year-old human stage compared to infant age 6-12 months under-1-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 188
922amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 200
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
658amnon high in asian burmese compared to european caucasian in 7-year-old human stage 10-year-old human stage 11-year-old human stage 9-year-old human stage 8-year-old human stage 6-year-old human stage homo sapiens child dentition supragingival dental plaque supragingival plaque united states of america state of nebraska 2020-09-17v3No1 / 212
892amnon high in 4-year-old human stage child compared to 1-year-old human stage infant in saliva united states of america homo sapiens 2022-04-07v4No1 / 216
10amnonpositively correlated with age (6-35) ( high in adult compared to child in homo sapiens feces toronto )2016-10-27v4No1 / 228
598amnonlower in mouthwash of students compared to teachers ( high in adult compared to 14-year-old human stage 13-year-old human stage child age 13-15 years in saliva kingdom of spain oral cavity homo sapiens )2020-03-25v3No1 / 232
872amnon high in 1-year-old human stage compared to 2-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 233
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
425amnon high in antananarivo madagascar compared to bangui central african republic in homo sapiens feces africa child 2018-12-08v4No1 / 248
892amnon high in adult human adult stage compared to 4-year-old human stage child in saliva united states of america homo sapiens 2022-04-07v4No1 / 275
438amnon high in 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage adult in homo sapiens feces china 2018-12-30v4No1 / 279
596amnon high in 2-5 year-old child stage age 1-7 years compared to under-1-year-old human stage in homo sapiens sweden saliva child 2020-03-18v3No1 / 288
922amnon high in human adult stage adult compared to 4-year-old human stage child in no dental caries saliva united states of america homo sapiens 2022-07-25v4No1 / 291
723amnon high in 2-5 year-old child stage compared to age 0-6 months infant in homo sapiens indonesia municipality of yogyakarta feces child 2021-01-02v3No1 / 305
542amnon high in adult age 12-23 years compared to child age 1-7 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 337
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
777amnon high in 18-month-old human stage child compared to 3-month-old human stage infant in municipality of umea sweden saliva homo sapiens 2021-04-26v3No1 / 583
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
425amnon high in duodenum compared to feces in homo sapiens africa child 2018-12-08v4No1 / 622
872amnon high in 2-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v1No1 / 704
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014

Problems / suggestions? Please email info AT dbbact DOT org