Summary for ontology term: children

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaCACGATTAACCCAAGTCAATAGAAGCCGGCGTACAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACACACAAT0.285714
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__EikenellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTATTTAAGCAGGATGTGAAATCCCCGGGCTTAACCTGGGAGCTGCGTTCTGAACTGGATAGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG0.285714
GTTTTAATTTTTGTAGAGAAGGAGTCTTGCTATGTTGCCCAGGCTGGTCTCACACTCCTGGGCTCAAGCAATCTGCCTGCCTTGGCCTCATAAAGTGCTAGGATTACAGGCGTAAGCCACCATGCCAAGCCACCTTCTTTTGATTTTTAC0.285714
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGGGGGGG0.285714
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCTTAAGTCCATCTTAAAAGCGTGGGGCTCAACCCCATGAGGGGATGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGGGGAATTCCTAGT0.285714
d__BacteriaGTTTTAATTTTTGTAGAGAAGGAGTCTTGCTCTGTTGCCCAGGCTGGTCTCAAACTCCTGGGCTCAAGCAATCTGCCTGCCTTGGCCTCATAAAGTGCTAGGATTACAGGCGTAAGCCACCATGCCAAGCCACCTTCTTTTGATTTTTAC0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGTAAGTTGGAAGTGAAATCTATGGGCTTAACCCATAAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGG0.285714
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGG0.285714
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGG0.285714

Annotations:

common ontology terms
term enrichment score
TermScore
children0.666667
colon0.500000
crohn's disease0.400000
sigmoid colon0.400000
terminal ileum0.400000
LOWER IN crohn's disease0.400000
biopsy0.222222
rectum0.166667
caecum0.054054
LOWER IN control0.010582
control0.010582
united states of america0.008065
homo sapiens0.007353
Fraction of dbbact annotations with this term covered by the query
TermScore
crohn's disease1.000000
LOWER IN crohn's disease1.000000
children0.500000
colon0.333333
sigmoid colon0.250000
terminal ileum0.250000
biopsy0.125000
rectum0.090909
caecum0.027778
LOWER IN control0.005405
control0.005405
united states of america0.004049
homo sapiens0.003690
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
united states of america1.000000
rectum1.000000
caecum1.000000
colon1.000000
sigmoid colon1.000000
terminal ileum1.000000
biopsy1.000000
children1.000000
crohn's disease0.250000
LOWER IN control0.250000
control0.250000
LOWER IN crohn's disease0.250000

Problems / suggestions? Please email info AT dbbact DOT org