Summary for ontology term: china

Number of annotations with term: 1162

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGCCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGGAACTGTAAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.001709
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.000855
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.000855
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.000855
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.000855
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCTTCTTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGGGAAGCTCAGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.000855
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATTGGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCCAATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.000855
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAAGCAAGTTGGAAGTGAAATGCATGGGCTTAACCCATGAGCTGCTTTCAAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.000855
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.000855
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCACTGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTAGAGCTAGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.000855

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaTACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.153846
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTGGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.153846
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTG0.076923
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.076923
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.076923
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.076923
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGTCGATTAAGTTAGATGTGAAACCCCCGGGCTTAACTTGGGGACTGCATCTAATACTGGTTGACTTAGAGTACAGGAGAGGGAAGCGGAATTCCTA0.076923
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGACGGGAATACAAGTTAGTTGTGAAATACCTCGGCTTAACTGAGGAACTGCAACTAAAACTATATTTCTTGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.076923
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.076923
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGCCGATTAAGTGTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGCAGACTGGTTGGCTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.076923

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGGGGCTCAACTCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.235571
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Hyphomicrobiaceae;g__DevosiaTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGATCGTTAAGTCGGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTCGATACTGGCGATCTTGAGTCCGGAAGAGGTGAGTGGAACTCCTAG0.197609
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.195652
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__PhenylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGACAGTTTAGTCAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCTGTCTTGAGTTCGGGAGAGGTGAGTGGAATGCCGAG0.187711
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__GeodermatophilaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTTGCGTCGGCTGTGAAATCCCGAGGCTCAACCTCGGGTCTGCAGTCGATACGAGCAAACTAGAGTGTTGCAGGGGAGACTGGAATTCCTGG0.181194
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp4;g__Gp4TACGGGGGGAGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCCACCGCAAGTCGACTGTGAAATCTCCGGGCTTAACCCGGAAAGGTCAGCCGATACTGCGGGGCTAGAGTGCAGAAGGGGCAACTGGAATTCTCG0.180305
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp16;g__Gp16TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGCAGGCGGTCGTTCAAGTCGCGTGTGAAAGCCCCCGGCTCAACTGGGGAGGGTCACGCGATACTGATCGACTCGAAGGCAGGAGAGGGTAGTGGAATTCCCGG0.179775
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhodospirillalesTACGAAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCTTATCAAGTCAGGCGTGAAATTCCCGGGCTCAACCTGGGGGCTGCGCTTGATACTGATGAGCTTGAATGCGGGAGAGGATAGTGGAATTCCCAG0.177778
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__MyxococcalesTACAGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGCGTGTAGGCGGCTTTGCAAGTCGGGTGTGAAAGCCCTCAGCTCAACTGAGGAAGTGCGCCCGAAACTGCAGAGCTTGAGTGCCGGAGAGGGTGGCGGAATTCCCCA0.174157
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGCTTTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAGAAGCTTGAGTCCGGGAGAGGTGAGTGGAACTGCGAG0.169515

Annotations:

common ontology terms
term enrichment score
TermScore
china0.956003
soil0.397083
adult0.176929
homo sapiens0.167919
feces0.163903
research facility0.157505
rhizosphere0.149129
control0.115409
depth (soil) 0-20cm0.113561
farm0.109018
zhejiang province0.095110
rumen0.087562
loess plateau0.077796
silt loam0.073507
shaanxi province0.073365
LOWER IN control0.072036
triticum aestivum0.069308
jiangsu province0.069251
intestine0.064412
hunan province0.061402
female0.060589
caecum0.056171
marine sediment0.055179
saliva0.054604
robinia pseudoacacia0.053746
reforestation0.053746
guangzhou city prefecture0.053601
ph 7-80.052664
agricultural field0.051020
mangrove swamp0.049100
bos grunniens0.048699
cultivated environment0.047541
winter0.047416
fertilized soil0.046332
zea mays0.046081
sediment0.045882
yak0.045416
gallus gallus0.045234
tibet autonomous region0.043771
agricultural feature0.043321
sprague dawley0.043142
yunwushan national natural grassland protection zone0.042834
ningxia province0.042834
calci-orthic aridisol0.042834
haplic calcisol0.042834
grazing exclusion0.042834
chicken0.041935
oryza sativa0.041468
municipality of beijing0.040201
sichuan province0.040124
water0.040070
luancheng county0.040067
jiangxi province0.039669
salic solonetz0.039669
da'an station0.039669
songnen plain0.039669
rat0.038449
biochar0.038372
nanjing city prefecture0.036933
ruminal fluid0.036651
mangrove0.036484
wheat0.036154
child0.035568
clay loam0.033557
rumen liquid0.033463
city0.032380
tibetan plateau0.031919
paddy field soil0.031919
topsoil0.031542
tongue0.031336
shanghai proper0.030278
black soil0.030278
captive0.029089
mongolia0.028734
ph 90.028632
depth (soil) 50cm0.028428
glycine max0.028294
fourth decade human stage0.028161
subgingival dental plaque0.028030
pig0.027642
sus scrofa0.027642
hainan autonomous prefecture0.027042
heavy metal0.027042
ph 7.60.026981
pika0.026981
deer0.026981
heilongjiang province0.026981
fresh water0.026826
ochotonidae0.026801
pot expreiment0.026801
periodontitis0.026719
bulk soil0.026681
ph 70.026622
shandong province0.026622
male0.026425
subgingival plaque0.026367
ovis aries0.025988
rattus norvegicus0.025876
ph 6-70.025330
10 years0.025168
Fraction of dbbact annotations with this term covered by the query
TermScore
bos grunniens1.000000
yak1.000000
kandelia candel1.000000
futian national nature reserve1.000000
mudflat1.000000
tibet autonomous region1.000000
guangzhou city prefecture1.000000
qiao nature reserve1.000000
sonneratia apetala1.000000
LOWER IN qiao nature reserve1.000000
riwoqe county1.000000
quaternary laterite soil1.000000
cucurbita moschata1.000000
pumpkin1.000000
lumen of jejunum1.000000
LOWER IN jejunal mucosa1.000000
age 7 weeks1.000000
wuhan1.000000
LOWER IN lumen of jejunum1.000000
jejunal mucosa1.000000
china0.956757
hunan province0.857143
mongolia0.800000
greenhouse soil0.750000
anser cygnoides0.750000
hainan autonomous prefecture0.750000
zhejiang province0.750000
litopenaeus vannamei0.750000
pacific white shrimp0.750000
municipality of beijing0.750000
heavy metal0.750000
non-manured soil0.750000
nanjing city prefecture0.750000
npk fertilizer0.750000
shanxi province0.750000
sichuan province0.700000
rex rabbit0.666667
10 cm depth0.666667
low salt concentration0.666667
LOWER IN high salt concentration0.666667
high salt concentration0.666667
LOWER IN low salt concentration0.666667
shanghai proper0.666667
tibetan plateau0.666667
rice field0.666667
mud0.666667
fermentation pit mud0.666667
ph 7.850.666667
serofluid dish0.666667
jiangshui0.666667
non-fertilized soil0.666667
LOWER IN non-fertilized soil0.666667
LOWER IN without biochar0.666667
without biochar0.666667
ph 7.60.666667
shanghai district0.666667
northeast china0.666667
pika0.666667
yunnan province0.666667
chemical fertilization n,p,k0.666667
high fusarium cumulative disease incidence 0.666667
low fusarium cumulative disease incidence 0.666667
trichoderma guizhouense njau 47420.666667
LOWER IN chemical fertilization n,p,k0.666667
LOWER IN high fusarium cumulative disease incidence 0.666667
LOWER IN low fusarium cumulative disease incidence 0.666667
mouth neoplasm0.666667
LOWER IN mouth neoplasm0.666667
nanchang city prefecture0.666667
chronic periodontitis0.666667
manured soil0.666667
dalian city prefecture0.666667
two weeks0.666667
luancheng county0.666667
fusarium oxysporum0.666667
bio-organic fertilizer0.666667
black soil0.666667
loess plateau0.666667
hong kong0.666667
ph 90.666667
depth 20-40cm0.666667
depth 10-20cm0.666667
LOWER IN depth 20-40cm0.666667
clay loam0.666667
guangxi zhuang autonomous region0.666667
deer0.666667
heilongjiang province0.666667
paddy field soil0.666667
LOWER IN dental caries0.666667
dental caries0.666667
biochar0.625000
sprague dawley0.600000
fertilized soil0.600000
rumen liquid0.600000
ruminal fluid0.571429
oryza sativa0.571429
triticum aestivum0.545455
jiangsu province0.538462
chronic gastritis0.500000
LOWER IN chronic gastritis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
china0.955250
soil0.351979
homo sapiens0.213425
feces0.205680
adult0.166954
research facility0.123924
rhizosphere0.089501
control0.077453
depth (soil) 0-20cm0.074010
farm0.063683
zhejiang province0.050775
rumen0.048193
LOWER IN control0.043029
loess plateau0.041308
silt loam0.041308
shaanxi province0.039587
female0.037866
jiangsu province0.037005
triticum aestivum0.037005
intestine0.034423
marine sediment0.032702
hunan province0.031842
caecum0.031842
saliva0.031842
agricultural field0.030120
ph 7-80.029260
robinia pseudoacacia0.028399
reforestation0.028399
guangzhou city prefecture0.027539
mangrove swamp0.025818
sediment0.025818
bos grunniens0.024957
winter0.024957
zea mays0.024957
cultivated environment0.024957
gallus gallus0.024096
fertilized soil0.024096
agricultural feature0.024096
yak0.023236
water0.023236
sprague dawley0.022375
tibet autonomous region0.022375
chicken0.022375
yunwushan national natural grassland protection zone0.022375
ningxia province0.022375
calci-orthic aridisol0.022375
haplic calcisol0.022375
grazing exclusion0.022375
child0.021515
oryza sativa0.021515
sichuan province0.020654
rat0.020654
municipality of beijing0.020654
jiangxi province0.020654
luancheng county0.020654
salic solonetz0.020654
da'an station0.020654
songnen plain0.020654
biochar0.019793
ruminal fluid0.018933
mangrove0.018933
wheat0.018933
nanjing city prefecture0.018933
rumen liquid0.017212
city0.017212
clay loam0.017212
tongue0.016351
topsoil0.016351
tibetan plateau0.016351
paddy field soil0.016351
shanghai proper0.015491
captive0.015491
fresh water0.015491
black soil0.015491
male0.014630
subgingival dental plaque0.014630
subgingival plaque0.014630
mongolia0.014630
pig0.014630
sus scrofa0.014630
fourth decade human stage0.014630
periodontitis0.014630
depth (soil) 50cm0.014630
glycine max0.014630
ph 90.014630
digestive system0.013769
hainan autonomous prefecture0.013769
rattus norvegicus0.013769
bulk soil0.013769
ovis aries0.013769
ph 7.60.013769
pika0.013769
ochotonidae0.013769
pot expreiment0.013769
heavy metal0.013769
ph 70.013769
shandong province0.013769
ph 6-70.013769
deer0.013769
heilongjiang province0.013769
Exp. ID User ID Description Date Region Flag Sequences
59amnon high in state of texas australia malaysia seoul united states of america compared to china in apis mellifera digestive system 2017-02-02v4No1 / 1
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in litopenaeus vannamei pacific white shrimp shenzhen city prefecture digestive system sea water china )2017-03-06v4No1 / 1
112amnonStrongly higher in zebrafish treated with BPA or estradiol ( high in bisphenol a estradiol compared to control in danio rerio zebra fish intestine research facility china )2017-04-09v4No1 / 1
155amnonhigh freq in soil loosely bound to wheat root (dominant triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 1
155amnonhigh freq in bulk soil in wheat field (dominant triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 1
156amnonchloroplast (brassica) (other brassica, leaf, china)2017-07-02v4No1 / 1
164amnondominant laodelphax striatellus, small brown planthopper, china2017-07-13v4No1 / 1
175amnonhigh freq in heavy metal contaminated soils in china (dominant soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 1
296amnonhigh freq. in wheat field soil (dominant soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 1
809amnondominant dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1
412amnondominant soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 1
421amnondominant soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1
917amnondominant ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1
917amnondominant qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1
444amnonhigh freq. in uncultivated soil plot (dominant yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 1
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 2
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 2
604amnon high in infectious bronchitis virus bronchitis compared to control in caecum chicken gallus gallus cecal content china research facility 2020-04-06v3No1 / 2
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in litopenaeus vannamei pacific white shrimp shenzhen city prefecture digestive system china sea water )2017-03-06v4No1 / 2
90amnondecreases during douchi fermentation ( high in timepoint early timepoint compared to late timepoint in douchi china food (fermented) )2017-03-08v4No1 / 2
616amnondominant in topsoil of PK/NP/NPK/NK fertilized sugarcane field (dominant depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 2
155amnonhigh freq in soil tightly bound to wheat root (dominant triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 2
694amnon high in control compared to polycystic ovary syndrome in china shanghai district obesity adult female feces homo sapiens 2028-03-17v3No1 / 2
725amnon high in control compared to periodontitis acute pericementitis in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 2
271amnondominant depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2
824sheryoDominant in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (dominant yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 2
837sheryoDominant in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (dominant 30 years, depth 0-40cm, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 2
849amnon high in multiple sclerosis multiple sclerosis compared to control in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 2
422amnondominant soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 2
422amnondominant soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 2
439amnonpresent only in abomasum in yak rumen ( high in abomasum compared to omasum ruminant reticulum in bos grunniens yak rumen farm china )2018-12-31v4No1 / 2
917amnondominant qiao nature reserve, depth (soil) 0-20cm, ph 6-6.5, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 2
917amnondominant depth (soil) 0-20cm, futian national nature reserve, kandelia candel, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 2
917amnondominant depth (soil) 0-20cm, ph 6-6.5, futian national nature reserve, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 2
40amnonhigher in soil susceptible to tobacco bacterial wilt disease ( high in disease compared to control in soil field soil nicotiana tabacum rhizosphere china )2016-12-09v4No1 / 3
561amnondominant bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 3
90amnondominant koji, china, food (fermented)2017-03-08v4No1 / 3
631sheryodominant in maize field unamended bulk soil (dominant bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 3
631sheryodominant in maize field biochar amended bulk soil, after 6 years of biochar amended (dominant ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 3
223amnon high in other regions compared to sanmen bay in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 3
725amnon high in control compared to periodontitis acute pericementitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 3
760sheryoDominant in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (dominant manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 3
760sheryoDominant in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (dominant npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 3
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 3
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 3
315amnonlower in captive grown compared to wild frogs ( high in wild compared to research facility in hunan province jiangxi province quasipaa spinosa giant spiny frog frog colon digestive system china )2018-04-10v4No1 / 3
800amnondominant 7-18 days following heavy metal contamination (dominant spring, reservoir, sediment depth 0-10cm, heavy metal, china, xiannv lake, lake, fresh water, sediment)2021-06-15v4No1 / 3
809amnondominant lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 3
824sheryoDomionant in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (dominant depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 3
828sheryoDominant in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (dominant depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 3
837sheryoDominant in agricultural field at depths 0-40cm, shaanxi, China (dominant depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 3
837sheryoDominant in soil at 40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (dominant depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 3
837sheryoDominant in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (dominant depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 3
894amnon high in diaporthe citri plant disease compared to control in citrus unshiu china endosphere citrus zhejiang province leaf orchard 2022-04-11v4No1 / 3
917amnondominant qiao nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, ph 7-8, soil, saline marsh2022-07-08v3No1 / 3
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 3
478amnondominant farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 3
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years dentition supragingival plaque china 2019-09-10v3No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 4
597amnon high in gout compared to control in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
597amnon high in control compared to gout in homo sapiens feces adult zhejiang province china 2020-03-23v3No1 / 4
608sheryoDominant in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (dominant triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 4
631sheryoDominant in maize field biochar amended rhizosphere soil (dominant ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 4
134amnondominant rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 4
686sheryoDominant in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (dominant organic fertilizer- chicken manure compost, ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence )2028-03-08v4No1 / 4
686sheryoDominant in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (dominant low fusarium cumulative disease incidence , bacillus amyloliquefaciens w19, bacterial enriched bio-fertilizer, ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae)2028-03-08v4No1 / 4
686sheryoDominant in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (dominant trichoderma guizhouense njau 4742, fungal enriched bio-fertilizer, fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, low fusarium cumulative disease incidence )2028-03-08v4No1 / 4
204amnondominant water, drinking water reservoir, sediment, china2017-10-02v4No1 / 4
716amnon high in chronic bad breath halitosis compared to control in tongue china dermal layer of tongue homo sapiens adult 2028-05-22v3No1 / 4
269amnonhigh freq. in fresh yao meat food (dominant china, foodon product type)2018-01-09v4No1 / 4
760sheryoDominant in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (dominant ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 4
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 4
791sheryoDominant at 0cm depth in low saline low sodicity soil in China (dominant depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 4
824sheryoDominant in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (dominant depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 4
837sheryoDominant in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (dominant depth 40-100cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 4
837sheryoDominant in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (dominant depth 100-300cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 4
420amnonhigh freq. in soil of vegetable open field (dominant soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 4
420amnonhigh freq. in soil of vegetables in organic plastic tunnel (dominant soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 4
908amnondominant guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 4
931amnondominant riwoqe county, china, ruminal fluid, yak, tibet autonomous region, bos grunniens, rumen2022-08-25v3No1 / 4
3amnonHigher in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in chronic gastritis compared to in homo sapiens tongue china )2016-10-06v4No1 / 5
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 5
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 5
913amnon high in control diet compared to yeast supplemented diet yeast (food source) in sichuan white goose age 70 days municipality of chongqing china goose cecal content bird anser cygnoides caecum research facility 2022-06-01v3No1 / 5
608sheryoDominant in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (dominant triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 5
624sheryodominant in ryegrass rhizosphere soil amended with biochar after 30-40 days (dominant china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments amended with biochar (dominant biochar, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments unamended with biochar (dominant china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 5
628sheryodominant in bulk soil with barley plants after 180 days in treatments amended with biochar (dominant biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 5
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 5
765sheryoDominant in wheat field in the loess plateau in china (dominant triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 5
771amnondominant body proper, whole body, china, cotton aphid, aphis gossypii2021-04-21v3No1 / 5
779amnon high in ulcerative colitis compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 5
791sheryoDominant at 20cm depth in low saline low sodicity soil in China (dominant ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 5
791sheryoDominant at 80cm depth in low saline low sodicity soil in China (dominant depth (soil) 80cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 5
824sheryoDominant in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (dominant depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 5
828sheryoDominant in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (dominant depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 5
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens subgingival dental plaque subgingival plaque china adult municipality of shanghai periodontitis chronic periodontitis 2021-09-11v3No1 / 5
837sheryoDominant in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (dominant depth 0-40cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 5
837sheryoDominant in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (dominant depth 0-40cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 5
414amnondominant soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 5
894amnon high in control compared to diaporthe citri plant disease in citrus unshiu china leaf surface citrus zhejiang province leaf orchard 2022-04-11v4No1 / 5
894amnon high in plant disease diaporthe citri compared to control in citrus unshiu china leaf surface citrus zhejiang province leaf orchard 2022-04-11v4No1 / 5
420amnonhigh freq. in soil of vegetable in plastic tunnel (dominant soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, greenhouse soil, cultivated environment, china)2018-12-02v4No1 / 5
512amnondominant fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 5
519amnon high in control compared to dental caries in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 5
34amnonhigh freq. in mangrove rhizosphere (dominant mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 6
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 6
616amnondominant in topsoil of non-fertilized sugarcane field (dominant depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 6
628sheryodominant in bulk soil with barley plants after 180 days in treatments unamended with biochar (dominant bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 6
631sheryodominant in maize field unamended rhizosphere soil (dominant unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 6
112amnondominant danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 6
279amnondominant grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 6
156amnondominant soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 6
156amnondominant brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 6
686sheryoDominant in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (dominant ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 6
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens mouth mucosa oral cavity mouth china 2017-10-01v4No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 6
257amnonhigh freq. in tilapia pond sediment (dominant sediment, freshwater sediment metagenome, pond, fishpond, tilapia, china)2017-11-26v4No1 / 6
754sheryoDominant in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (dominant bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 6
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 6
792amnondominant depth (soil) 20-60cm, haloxylon ammodendron, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 6
791sheryoDominant at 40cm depth in low saline low sodicity soil in China (dominant depth (soil) 40cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 6
795amnoncommon uterine tube infundibulum, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 6
837sheryoDominant in agricultural field at depths 100-300cm, shaanxi, China (dominant depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 6
856amnon high in control compared to ulcerative colitis ulcerative colitis in rectum intestinal mucosa human adult stage adult china biopsy homo sapiens 2022-01-09v3No1 / 6
883amnondominant oilfield, yellow river delta, china, shengli oilfield, oil contaminated soil, soil2022-03-20v4No1 / 6
414amnondominant soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 6
420amnonhigh freq. in soil of vegetables in organic field (dominant soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, china, cultivated environment)2018-12-02v4No1 / 6
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 6
931amnondominant riwoqe county, china, yak, tibet autonomous region, bos grunniens, ileum, colon, caecum, feces2022-08-25v3No1 / 6
933amnondominant quaternary laterite soil, pumpkin, cucurbita moschata, china, ph 5.5, guangxi zhuang autonomous region, rhizosphere, research facility2022-09-11v3No1 / 6
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 7
572amnon high in control compared to liver carcinoma in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 7
667amnondominant depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild rice (Oryza rufipogon) rhizosphere (dominant oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (dominant deep plough, conventional tillage, pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-18v4No1 / 7
792amnondominant depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 7
824sheryoDominant in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (dominant depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 7
825amnon high in control compared to type 1 diabetes mellitus type i diabetes mellitus in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 7
415amnondominant rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 7
454amnondominant feces, elaphurus davidianus, pere deer, deer, captive, china2019-01-10v4No1 / 7
478amnondominant farm, shrimp farm, sediment, china2019-02-19v4No1 / 7
531amnondominant rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 8
90amnonincreases during koji preparation ( high in timepoint late timepoint compared to early timepoint in koji china food (fermented) )2017-03-08v4No1 / 8
115amnondominant coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 8
134amnondominant rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 8
279amnondominant grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 8
667amnondominant depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 8
667amnondominant depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 8
687amnondominant shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 8
701amnondominant municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 8
223amnondominant sediment, marine sediment, ocean, east china sea, china2017-10-26v4No1 / 8
259amnonhigh freq. in soil and rhizpsphere of peanut plants (dominant soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 8
735amnondominant control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 8
792amnondominant depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v4No1 / 8
819amnondominant dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v1No1 / 8
824sheryoDominant in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (dominant depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 8
837sheryoDominant in agricultural field at depths 40-100cm, shaanxi, China (dominant depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 8
837sheryoDominant in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (dominant depth 100-300cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 8
855sheryoDopminant in soil depth of 10cm in fertilized soil in china (dominant luancheng county, china, agricultural field, depth (water) 10cm, fertilized soil, soil)2021-12-27v3No1 / 8
417amnondominant anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 8
454amnondominant feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v4No1 / 8
463amnondominant intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 8
512amnondominant fen, peatland, peat soil, soil, ph 5.5-6.5, tibetan plateau, riganqiao peatland, china2019-03-22v4No1 / 8
40amnonhigher in soil protective from tobacco bacterial wilt disease ( high in control compared to disease in soil field soil nicotiana tabacum rhizosphere china )2016-12-09v4No1 / 9
572amnon high in control compared to pancreatic cancer in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 9
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended with biochar (dominant soil, depth 0-20cm, limestone, tobacco field, china, ph 7-8, fungicide, difenoconazole, biochar)2020-04-21v4No1 / 9
91amnondominant serofluid dish, jiangshui, food (fermented), china2017-03-08v4No1 / 9
624sheryodominant in ryegrass rhizosphere soil after 30-40 days (dominant days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 9
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide and biochar (dominant biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 9
163amnondominant ochotonidae, pika, ochotona dauurica, mongolia grassland, stomach, china2017-07-13v4No1 / 9
675sheryoDominant in watermelon rhizosphere soil inucolated with Fusarium oxysporum f. sp. niveum (dominant inoculated with fusarium oxysporum f. sp. niveum, ph 7, co culture with wheat (triticum aestivum l.), citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 9
675sheryoDominant in watermelon rhizosphere soil (dominant co culture with wheat (triticum aestivum l.), un-inoculated, ph 7, citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 9
783sheryodominant in desert soil in mongolia under water addition treatment (dominant 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 9
687amnondominant chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
742amnondominant dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v3No1 / 9
741amnondominant pellet feed diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 9
271amnondominant depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 9
752sheryoDominant in soil planted with Panax notoginseng amended with 2% biochar (dominant biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 9
775amnon high in control compared to lichen planus in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 9
819amnondominant adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v1No1 / 9
819amnondominant skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 9
828sheryoDominant in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (dominant depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 9
837sheryoDominant in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (dominant depth 40-100cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 9
391amnoncommon under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v4No1 / 9
863amnondominant forest musk deer, moschus berezovskii, qilian county, china, deer, captive, farm, feces2022-01-28v4No1 / 9
894amnon high in control compared to plant disease diaporthe citri in citrus unshiu china endosphere citrus zhejiang province leaf orchard 2022-04-11v4No1 / 9
421amnonhigh freq. in paddy field soil incubated without copper (dominant soil, research facility, zhejiang province, paddy field soil, china)2018-12-02v4No1 / 9
521amnonhigh freq. in weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
530amnondominant snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
603amnondominant in baijiu fermentation pit mud in first 2 batches (dominant mud, hefei city prefecture, china, baijiu, fermentation pit mud, days 0-90)2020-04-05v3No1 / 10
687amnon high in chinese bohai black beef cattle compared to chinese luxi yellow beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 10
735amnondominant restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 10
746sheryoDominant in saline soil in dafeng, china (dominant ph 7.6, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 10
279amnondominant pika, ochotonidae, colon, caecum, china2018-01-24v4No1 / 10
780amnondominant jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 10
791sheryoDominant in highly saline sodic soil at 0cm depth in China (dominant depth (soil) 0-20cm, ph 10.5, high salinity, high sodicity, depth 0cm, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 10
359amnondominant soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 10
824sheryoDominant in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (dominant 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 10
828sheryoDominant in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (dominant depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 10
828sheryoDominant in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (dominant depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 10
899amnoncommon in snail intestine from heavy metal contaminated greenhouse (dominant heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, greenhouse, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 10
519amnon high in dental caries compared to control in homo sapiens adult late adult stage city saliva china 2019-06-25v3No1 / 10
547amnondominant red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 11
585amnon high in stomach intestine compared to buccal mass in china pomacea canaliculata golden apple snail nanheng river qingpu district 2020-02-02v3No1 / 11
590amnondominant china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 11
115amnonhigher in medium and large size fish compared to small size ( high in large size medium size compared to small size in coreius guichenoti largemouth bronze gudgeon fish freshwater river biome yangtze river intestine china )2017-04-10v4No1 / 11
202amnon high in mouth neoplasm neoplasm cancer compared to control in homo sapiens mouth mucosa china mouth oral cavity 2017-10-01v4No1 / 11
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 11
264amnondominant oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 11
737amnondominant ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 11
269amnonincreases during one month in refrigeration of yao meat ( high in late timepoint food spoilage compared to fresh early timepoint in china foodon product type )2018-01-09v4No1 / 11
279amnondominant grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 11
755sheryodominant in domesticated rice (Oryza stavia) rhizosphere (dominant oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 11
767sheryoDominant in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (dominant dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 11
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (dominant pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 11
787amnondominant control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 11
819amnon high in low atmospheric pollution dalian city prefecture compared to high atmospheric pollution baoding city prefecture in age 25-45 years china scalp adult skin female homo sapiens 2021-07-12v1No1 / 11
819amnondominant dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 11
824sheryoDominant in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (dominant 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, depth 40-60cm, china, soil)2021-08-08v4No1 / 11
370amnondominant desert, air, gobi desert2018-09-06v4No1 / 11
783sheryodominant in desert soil in mongolia without water addition treatment (dominant no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 11
391amnondominant under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v4No1 / 11
849amnon high in control compared to multiple sclerosis multiple sclerosis in fourth decade human stage china zhejiang province adult homo sapiens feces 2021-12-14v3No1 / 11
863amnondominant xinglong mountain national nature reserve, alpine musk deer, moschus chrysogaster, yuzhong county, china, deer, captive, farm, feces2022-01-28v4No1 / 11
412amnondominant soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 11
913amnon high in yeast (food source) yeast supplemented diet compared to control diet in sichuan white goose age 70 days municipality of chongqing china goose cecal content bird anser cygnoides caecum research facility 2022-06-01v3No1 / 11
444amnon high in spring compared to winter in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v4No1 / 11
444amnon high in winter compared to spring in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v4No1 / 11
475amnonhigh freq. in air in subway train in hong kong (dominant air, hong kong, city, subway)2019-01-20v4No1 / 11
478amnondominant farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 11
513amnondominant waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 11
27amnondominant bos grunniens, rumen, china2016-12-05v4No1 / 12
50amnonhigh freq. in mitten crab intestine (dominant intestine, eriocheir sinensis, china)2017-01-19v4No1 / 12
914amnondominant yak, qinghai province, tibet autonomous region, bos grunniens, feces2022-06-26v3No1 / 12
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and without biochar (dominant difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 12
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide (dominant without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 12
134amnondominant rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 12
657amnondominant research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 12
279amnondominant grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 12
163amnondominant stomach, ochotonidae, pika, ochotona curzoniae, mongolia grassland, china2017-07-13v4No1 / 12
667amnondominant depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 12
750sheryoDominant in soil of wheat field in China (dominant fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 12
279amnondominant pika, ochotonidae, stomach, small intestine, china2018-01-24v4No1 / 12
767sheryoDominant in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (dominant soil, fusarium, fusarium oxysporum f. sp. chrysanthemi, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 12
815amnon high in red fox vulpes vulpes compared to corsac fox vulpes corsac in lake hulun wild winter mongolia feces 2021-07-04v3No1 / 12
370amnoncommon desert, air, gobi desert2018-09-06v4No1 / 12
840amnondominant china, broiler chicken, gallus gallus, ileum, farm2021-11-08v3No1 / 12
855sheryoDominant in soil depth of 75cm in fertilized soil in china (dominant depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 12
858amnondominant 0%-1% salt concentration, suan cai, fermneted chinese cabbage, china, fermented vegetable food product, low salt concentration, two weeks2022-01-11v4No1 / 12
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
913amnondominant sichuan white goose, age 70 days, municipality of chongqing, china, goose, cecal content, bird, anser cygnoides, caecum, research facility2022-06-01v3No1 / 12
504amnondominant nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 12
530amnondominant snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 13
555amnon high in autistic disorder autism compared to control in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 13
585amnon high in buccal mass compared to stomach intestine in china pomacea canaliculata golden apple snail nanheng river qingpu district 2020-02-02v3No1 / 13
604amnondominant caecum, chicken, gallus gallus, cecal content, china, research facility2020-04-06v3No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide and biochar (dominant biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 13
111amnondominant caecum, mongolian sheep, ovis aries, rectum, ileum, colon, china2017-04-09v4No1 / 13
160amnonhigh freq. in river water upstream of WTP effluent in spring in china (dominant spring, river, water, china)2017-07-12v4No1 / 13
165amnonhigh freq. in house fly larva grown on moist wheat bran (dominant research facility, musca domestica, house fly, larval stage, digestive system, china)2017-07-16v4No1 / 13
667amnondominant depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 13
675sheryoHigher in watermelon rhizosphere soil uninoculated compared to watermelon rhizosphere soil inoculated with fusarium oxysporum f. sp. niveum ( high in un-inoculated compared to inoculated with fusarium oxysporum f. sp. niveum in co culture with wheat (triticum aestivum l.) ph 7 citrullus lanatus rhizosphere china )2028-02-22v4No1 / 13
725amnondominant control, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 13
751sheryoDominant in tomato soil infected with Fusarium oxysporum (dominant china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 13
752sheryoDominant in soil planted with Panax notoginseng (dominant panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 13
315amnonhigh freq. in frog gut (dominant hunan province, jiangxi province, quasipaa spinosa, giant spiny frog, frog, colon, digestive system, china)2018-04-10v4No1 / 13
315amnonhigh freq. in frog pond water (dominant hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 13
795amnoncommon vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 13
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in age 6-14 years hangzhou city prefecture china child homo sapiens feces 2021-08-12v3No1 / 13
400amnonhigh freq. in hmong (chinese) females from thailand (dominant homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 13
894amnondominant citrus unshiu, china, endosphere, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 13
421amnonhigh freq. in paddy field soil incubated with copper (dominant soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 13
931amnondominant riwoqe county, china, yak, tibet autonomous region, bos grunniens, jejunum, duodenum2022-08-25v3No1 / 13
530amnondominant snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
547amnon high in low salt concentration compared to high salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 14
579amnonhigh freq. in pond water of mud crab aquaculture (dominant china, pond, saline water, saline water aquarium, fish farm, scylla paramamosain, mud crab, summer, autumn)2020-01-14v3No1 / 14
585amnondominant china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 14
585amnondominant china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 14
115amnonlower in medium and large size fish compared to small size ( high in small size compared to medium size large size in coreius guichenoti largemouth bronze gudgeon fish freshwater river biome yangtze river intestine china )2017-04-10v4No1 / 14
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility china qinghai province rumen liquid rumen age < 1 year lamb sheep ovis aries )2020-09-13v4No1 / 14
164amnoncommon laodelphax striatellus, small brown planthopper, china2017-07-13v4No1 / 14
168amnonhigh freq. in mud from chinese liquor fermentation pit (dominant mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 14
687amnondominant holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 14
250amnonhigh freq. in bamboo forest soil (dominant soil, ph 4, bamboo, phyllostachys pubescens, depth (soil) 0-10cm, woodland area, china)2017-11-22v4No1 / 14
725amnondominant chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
725amnondominant acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
746sheryoDominant in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (dominant saline soil, solonchak, china, dafeng city, jiangsu province, ph 7.5, solanum lycopersicum, biological fertilization, chicken manure, trichoderma guizhouense njau 4742)2021-03-03v4No1 / 14
290amnon high in city compared to rural community small village in homo sapiens feces adult china 2018-02-01v4No1 / 14
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (dominant paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 14
812amnondominant zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v3No1 / 14
382amnondominant water, hot spring, geothermal field, ganzi tibetan autonomous prefecture, china, high temperature environment2018-10-22v4No1 / 14
402amnondominant sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 2,3, china2018-11-18v4No1 / 14
862amnondominant himalayan griffon, gyps himalayensis, china, qinghai province, bird, feces2022-01-20v4No1 / 14
865amnon high in canis lupus wolf compared to canis lupus familiaris dog in china feces 2022-02-08v3No1 / 14
438amnondominant tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, adult, jiangsu province, china2018-12-30v4No1 / 14
475amnonhigh freq. in air next to subway stations in hong kong (dominant air, hong kong, city)2019-01-20v4No1 / 14
506amnondominant soil, boreal wetland, seasonal frozen marsh, depth (soil) 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 14
25amnon high in compared to in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 15
25amnon high in control compared to antibiotic in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 15
64amnondominant saliva, homo sapiens, sichuan province2017-02-16v4No1 / 15
160amnonhigh freq. in wastewater treatment plant effluent in spring in china (dominant spring, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 15
687amnondominant chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 15
707amnon high in systemic lupus erythematosus compared to control in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
741amnon high in pellet feed diet compared to alfalfa diet in intestine ram's horn snail china research facility planorbella trivolvis 2021-02-17v3No1 / 15
279amnondominant pika, ochotonidae, mouth, china2018-01-24v4No1 / 15
779amnon high in crohn's disease compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 15
787amnoncommon in high grain diet induced subacute acidosis (dominant acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 15
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
815amnon high in vulpes corsac corsac fox compared to vulpes vulpes red fox in lake hulun wild winter mongolia feces 2021-07-04v3No1 / 15
819amnoncommon dalian city prefecture, adult, age 25-45 years, female, china, scalp, skin, homo sapiens2021-07-12v1No1 / 15
373amnondominant soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 15
380amnondominant tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 15
402amnondominant sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 1, china2018-11-18v4No1 / 15
860amnondominant duck, china, intestinal contents, anas platyrhynchos, intestine, research facility2022-01-12v3No1 / 15
934amnondominant age 7 weeks, wuhan, china, jejunal mucosa, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 15
934amnondominant age 7 weeks, wuhan, china, lumen of jejunum, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 15
524amnondominant homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 15
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in homo sapiens feces sichuan province )2016-12-06v4No1 / 16
50amnoncommon in mitten crab gills (dominant gill, eriocheir sinensis, china)2017-01-19v4No1 / 16
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 16
585amnondominant china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 16
590amnoncommon in turtle pond water (dominant china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 16
604amnon high in control compared to infectious bronchitis virus bronchitis in caecum chicken gallus gallus cecal content china research facility 2020-04-06v3No1 / 16
85amnondominant litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 16
652amnondominant sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 16
725amnondominant chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 16
753amnondominant zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v4No1 / 16
314amnondominant caecum, cecal content, tibet autonomous region, farm, tibetan pig, tibetan swine, china2018-04-10v4No1 / 16
800amnondominant 100-250 days following heavy metal contamination (dominant autumn, summer, reservoir, sediment depth 0-10cm, heavy metal, china, xiannv lake, lake, fresh water, sediment)2021-06-15v4No1 / 16
878amnondominant pm10, municipality of beijing, china, respirable suspended particulate matter, air, city2022-03-11v3No1 / 16
904amnondominant age 42 weeks, jinghong-1, hen, china, chicken, gallus gallus, caecum, research facility2022-05-18v3No1 / 16
519amnondominant homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 16
590amnondominant china, turtle farm, farm, hainan autonomous prefecture, intestine, red-eared slider turtle, trachemys scripta elegans, age 0 days, neonate stage2020-02-10v4No1 / 17
90amnondominant douchi, china, food (fermented)2017-03-08v4No1 / 17
116amnondominant research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 17
640amnondominant saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 17
661amnondominant lung, farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus2020-09-20v4No1 / 17
688amnondominant nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 17
725amnondominant periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 17
290amnondominant homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 17
775amnondominant jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 17
849amnondominant fourth decade human stage, china, multiple sclerosis, multiple sclerosis, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 17
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 17
36amnondominant homo sapiens, feces, sichuan province2016-12-06v4No1 / 18
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 18
561amnon high in winter withered grass diet compared to spring green stage diet in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 18
627amnondominant feces, pregnancy, adult, female, china2020-05-16v3No1 / 18
111amnondominant rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 18
716amnondominant chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 18
746sheryoDominant in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (dominant chemical fertilization n,p,k, solanum lycopersicum, ph 7.5, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 18
774amnondominant control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 18
780amnondominant caecum, jinzhou city prefecture, china, research facility, chicken, gallus gallus2021-04-28v3No1 / 18
795amnondominant cloaca, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 18
865amnondominant inner mongolia autonomous region, china, dog, canis lupus familiaris, feces2022-02-08v3No1 / 18
894amnondominant citrus unshiu, china, leaf surface, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 18
419amnondominant rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 18
899amnoncommon in snail intestine from phytoremedation field (dominant phytoremedation field, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, field, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 18
428amnondominant homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 18
504amnondominant nan'ao island, water, sea water, china2019-03-14v4No1 / 18
519amnondominant homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 18
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years dentition supragingival plaque china 2019-09-10v3No1 / 19
555amnondominant homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 19
60amnondominant anser cygnoides, feces, china2017-02-03v4No1 / 19
115amnoncommon coreius guichenoti, largemouth bronze gudgeon, fish, freshwater river biome, yangtze river, intestine, china2017-04-10v4No1 / 19
637amnondominant gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 19
160amnonhigh freq. in river water upstream of WTP effluent in autumn in china (dominant river, water, autumn, china)2017-07-12v4No1 / 19
165amnonhigh freq. in moist wheat bran (dominant research facility, wheat bran, china)2017-07-16v4No1 / 19
216amnondominant mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 19
725amnondominant control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 19
292amnondominant homo sapiens, adult, feces, control, china2018-02-05v4No1 / 19
299amnondominant saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
774amnondominant tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 19
795amnoncommon cloaca, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 19
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis, gingival erosive oral lichen planus, oral lichen planus2021-09-11v3No1 / 19
855sheryoDominant in soil depth of 350cm in fertilized soil in china (dominant depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 19
855sheryoDominant in soil depth of 800cm in fertilized soil in china (dominant depth 800cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 19
855sheryoDominant in soil depth of 1000cm in fertilized soil in china (dominant depth 1000cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 19
438amnondominant young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 19
438amnondominant 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 19
451amnondominant serofluid dish, jiangshui, china, food (fermented)2019-01-10v4No1 / 19
924amnondominant 8-year-old human stage, 7-year-old human stage, china, supragingival dental plaque, supragingival plaque, guangzhou city prefecture, child2022-07-27v3No1 / 19
463amnoncommon intestine, portunus trituberculatus, horse crab, research facility, china2019-01-13v4No1 / 19
707amnon high in control compared to systemic lupus erythematosus in fifth decade human stage fourth decade human stage guangzhou city prefecture adult female china homo sapiens feces 2028-04-11v3No1 / 19
579amnonhigh freq. in pond water of mud crab aquaculture (dominant spring, china, pond, saline water, saline water aquarium, fish farm, scylla paramamosain, mud crab)2020-01-14v3No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in homo sapiens feces china adult 2020-03-30v4No1 / 20
160amnonhigh freq. in wastewater treatment plant effluent in autumn in china (dominant wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 20
697amnondominant sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v3No1 / 20
720amnondominant autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 20
271amnoncommon depth (soil) 0-20cm, glycine max, soybean, root structure, root, root nodule, china2018-01-09v4No1 / 20
281amnondominant shinisaurus crocodilurus, crocodile lizard, cloaca, china2018-01-25v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 20
292amnondominant homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 20
791sheryoDominant in highly saline sodic soil at 20cm depth in China (dominant ph 10.5, depth 20cm, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 20
818amnondominant ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 20
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis2021-09-11v3No1 / 20
855sheryoDominant in soil depth of 175cm in fertilized soil in china (dominant depth 175cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 20
419amnonhigh freq. in rats with induced constipation (dominant rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 20
899amnonlower in snail intestine from phytoremedation field compared to greenhouse ( high in greenhouse compared to phytoremedation field field in heavy metal contaminated soil land snail bradybaena ravida china sedum alfredii heavy metal zhejiang province intestine )2022-04-25v3No1 / 20
439amnondominant bos grunniens, yak, rumen, farm, china2018-12-31v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 20
575amnonhigh freq. in professional martial arts athletes (dominant young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v3No1 / 21
581amnondominant in red swamp crayfish grown in flooded rice field (dominant procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v3No1 / 21
597amnondominant homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 21
221amnondominant rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 21
223amnon high in other regions compared to hangzhou bay in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 21
716amnondominant control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 21
720amnondominant control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 21
254amnondominant river, water, fresh water, depth (soil) 50cm, jiulong river, fujian province, china2017-11-23v4No1 / 21
741amnondominant alfalfa diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 21
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 21
791sheryoDominant in highly saline sodic soil at 40cm depth in China (dominant depth (soil) 40cm, ph 10.5, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 21
791sheryoDominant in highly saline sodic soil at8 80cm depth in China (dominant depth (soil) 80cm, ph 10, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 21
825amnondominant age 6-14 years, hangzhou city prefecture, china, child, control, homo sapiens, feces2021-08-12v3No1 / 21
911amnon high in spinal cord injury compared to control in human adult stage china nanjing city prefecture homo sapiens feces 2022-05-21v4No1 / 21
911amnondominant human adult stage, china, nanjing city prefecture, control, homo sapiens, feces2022-05-21v4No1 / 21
442amnondominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 21
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 21
707amnondominant fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 22
720amnon high in control compared to autoimmune hepatitis in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 22
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
779amnondominant control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant homo sapiens, feces, guangzhou city prefecture, adult, stroke, china)2018-05-15v4No1 / 22
795amnondominant uterine tube infundibulum, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 22
819amnoncommon adult, age 25-45 years, female, baoding city prefecture, china, scalp, skin, homo sapiens2021-07-12v1No1 / 22
858amnondominant 3%-5% salt concentration, suan cai, fermneted chinese cabbage, china, fermented vegetable food product, high salt concentration, two weeks2022-01-11v4No1 / 22
865amnondominant wolf, china, canis lupus, feces2022-02-08v3No1 / 22
924amnon high in control compared to dental caries dental caries in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v3No1 / 22
566amnon high in insomnia compared to control in homo sapiens feces china adult 2019-11-24v4No1 / 23
572amnon high in liver carcinoma compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 23
601amnondominant homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 23
603amnondominant in baijiu fermentation pit mud in later batches (dominant hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 23
694amnondominant china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 23
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 23
314amnondominant caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 23
795amnondominant vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 23
856amnondominant human adult stage, china, intestinal mucosa, biopsy, adult, rectum, control, homo sapiens2022-01-09v3No1 / 23
934amnon high in lumen of jejunum compared to jejunal mucosa in jejunum age 7 weeks wuhan research facility gallus gallus chicken china 2022-09-18v3No1 / 23
566amnondominant feces, china, homo sapiens, adult2019-11-24v4No1 / 24
597amnondominant homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 24
601amnon high in type 2 diabetes mellitus compared to control in homo sapiens feces china adult 2020-03-30v4No1 / 24
202amnondominant homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 24
753amnondominant china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v4No1 / 24
349amnondominant rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 24
815amnondominant lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v3No1 / 24
849amnondominant fourth decade human stage, china, zhejiang province, adult, control, homo sapiens, feces2021-12-14v3No1 / 24
59amnon high in austin united states of america compared to australia malaysia seoul china in apis mellifera digestive system 2017-02-02v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 25
640amnondominant dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 25
661amnondominant farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus, intestine2020-09-20v4No1 / 25
707amnondominant fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 25
290amnondominant homo sapiens, feces, adult, city, china2018-02-01v4No1 / 25
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 25
856amnondominant human adult stage, china, ulcerative colitis, intestinal mucosa, biopsy, adult, ulcerative colitis, rectum, homo sapiens2022-01-09v3No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
911amnondominant human adult stage, china, spinal cord injury, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 26
584amnondominant male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 26
899amnonhigh in snail intestine from phytoremedation field compared to greenhouse ( high in phytoremedation field field compared to greenhouse in zhejiang province heavy metal contaminated soil heavy metal sedum alfredii land snail bradybaena ravida intestine china )2022-04-25v3No1 / 26
438amnondominant fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 26
601amnondominant homo sapiens, feces, china, adult, control2020-03-30v4No1 / 27
815amnondominant corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 27
438amnondominant 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 27
924amnon high in dental caries dental caries compared to control in 8-year-old human stage 7-year-old human stage china supragingival dental plaque supragingival plaque guangzhou city prefecture child 2022-07-27v3No1 / 27
530amnondominant snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 28
741amnoncommon pellet feed diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 28
267amnoncommon fish, digestive system, oreochromis niloticus, research facility, china2017-12-24v4No1 / 28
779amnon high in control compared to ulcerative colitis in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 28
825amnondominant type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 28
862amnoncommon qinghai province, china, himalayan griffon, gyps himalayensis, bird, feces2022-01-19v4No1 / 28
590amnoncommon china, turtle farm, farm, hainan autonomous prefecture, intestine, red-eared slider turtle, trachemys scripta elegans, age 0 days, neonate stage2020-02-10v4No1 / 29
165amnoncommon in house fly larva grown on moist wheat bran (common research facility, musca domestica, house fly, larval stage, digestive system, china)2017-07-16v4No1 / 29
858amnon high in two weeks compared to 3 days in suan cai fermneted chinese cabbage china fermented vegetable food product 2022-01-11v4No1 / 29
863amnon high in spring compared to winter in xinglong mountain national nature reserve alpine musk deer moschus chrysogaster yuzhong county china deer captive farm feces 2022-01-28v4No1 / 29
438amnondominant 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
36amnonhigher in centernarians ( high in centererians compared to adult in homo sapiens feces sichuan province )2016-12-06v4No1 / 30
90amnonincreases during douchi fermentation ( high in timepoint late timepoint compared to early timepoint in douchi china food (fermented) )2017-03-08v4No1 / 30
624sheryolower in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in without biochar compared to biochar in china jiangsu province soil 10 cm depth ph 7-8 ryegrass rhizosphere days 30-40 )2020-05-11v4No1 / 30
774amnon high in tonsillitis compared to control in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 30
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
438amnondominant 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 30
652amnon high in control compared to rheumatoid arthritis in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 31
155amnonhigher in bulk soil compared to loose bound root soil ( high in bulk soil compared to rhizosphere in triticum aestivum wheat soil china )2017-07-02v4No1 / 31
315amnonhigher in captive grown compared to wild frogs ( high in research facility compared to wild in hunan province jiangxi province quasipaa spinosa giant spiny frog frog colon digestive system china )2018-04-10v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in homo sapiens adult feces china 2018-02-05v4No1 / 32
279amnon high in small intestine stomach compared to mouth in pika ochotonidae china 2018-01-24v4No1 / 33
856amnoncommon ulcerative colitis, ulcerative colitis, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 33
687amnon high in chinese luxi yellow beef cattle compared to chinese bohai black beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 34
269amnondecreases during one month in refrigeration of yao meat ( high in fresh early timepoint compared to late timpoint food spoilage in china foodon product type )2018-01-09v4No1 / 34
561amnon high in spring green stage diet compared to withered grass diet winter in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 35
858amnon high in 3 days compared to two weeks in suan cai fermneted chinese cabbage china fermented vegetable food product 2022-01-11v4No1 / 35
865amnon high in dog canis lupus familiaris compared to canis lupus wolf in china feces 2022-02-08v3No1 / 35
85amnonlower in shrimps exposed to sulfide compared to controls ( high in control compared to sulfide in litopenaeus vannamei pacific white shrimp shenzhen city prefecture digestive system china sea water )2017-03-06v4No1 / 36
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 38
688amnon high in male organism male compared to female female organism in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 39
725amnon high in periodontitis acute pericementitis compared to control in mouth mucosa buccal mucosa adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 39
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in chronic periodontitis periodontitis municipality of shanghai adult china subgingival plaque subgingival dental plaque homo sapiens 2021-09-11v3No1 / 39
687amnon high in high milk yield compared to low milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 40
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No1 / 40
112amnoncommon danio rerio, zebra fish, intestine, research facility, china2017-04-09v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in fish digestive system oreochromis niloticus research facility china )2017-12-24v4No1 / 41
825amnoncommon type 1 diabetes mellitus, age 6-14 years, hangzhou city prefecture, china, child, type i diabetes mellitus, homo sapiens, feces2021-08-12v3No1 / 41
60amnoncommon anser cygnoides, feces, china2017-02-03v4No1 / 42
837sheryoHigher in agricultural field at depths 40-100cm compared to 0-40cm, shaanxi, China ( high in depth 40-100cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 42
547amnon high in high salt concentration compared to low salt concentration in red pepper sauce capsicum annuum sichuan province china food (fermented) 2019-08-15v4No1 / 43
555amnon high in control compared to autistic disorder autism in homo sapiens shanghai proper child age 7-14 years saliva china 2019-09-10v3No1 / 43
725amnon high in periodontitis acute pericementitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 43
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
652amnon high in rheumatoid arthritis compared to control in sichuan province china adult saliva homo sapiens 2020-09-13v3No1 / 44
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 44
725amnon high in periodontitis chronic periodontitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 44
419amnon high in constipation compared to control in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 44
50amnoncommon in mitten crab intestine (common intestine, eriocheir sinensis, china)2017-01-19v4No1 / 45
818amnoncommon ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 45
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, control2020-03-23v3No1 / 46
858amnon high in 0%-1% salt concentration low salt concentration compared to 3%-5% salt concentration high salt concentration in two weeks china suan cai fermneted chinese cabbage fermented vegetable food product 2022-01-11v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, control2019-12-16v3No1 / 47
597amnoncommon homo sapiens, feces, adult, zhejiang province, china, gout2020-03-23v3No1 / 47
640amnon high in dentition supragingival dental plaque supragingival plaque compared to saliva in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 47
254amnon high in winter dry season autumn compared to summer wet season in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 47
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 47
894amnoncommon orchard, zhejiang province, china, citrus unshiu, citrus, leaf, endosphere2022-04-11v4No1 / 47
720amnoncommon autoimmune hepatitis, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 48
373amnon high in rhizosphere compared to soil in oryza sativa rice hunan province rice field china 2018-09-08v4No1 / 48
856amnoncommon control, human adult stage, china, intestinal mucosa, biopsy, adult, rectum, homo sapiens2022-01-09v3No1 / 48
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 49
849amnoncommon zhejiang province, fourth decade human stage, adult, multiple sclerosis, multiple sclerosis, china, homo sapiens, feces2021-12-14v3No1 / 50
883amnon high in depth (soil) 0-20cm compared to depth (soil) 60-100cm in oilfield yellow river delta china shengli oilfield oil contaminated soil soil 2022-03-20v4No1 / 50
725amnoncommon control, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 51
865amnoncommon canis lupus, wolf, china, feces2022-02-08v3No1 / 51
911amnoncommon spinal cord injury, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 51
694amnoncommon china, shanghai district, obesity, adult, female, feces, homo sapiens2028-03-17v3No1 / 52
439amnoncommon bos grunniens, yak, rumen, farm, china2018-12-31v4No1 / 52
661amnoncommon lung, farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus2020-09-20v4No1 / 53
279amnon high in small intestine stomach compared to caecum colon in pika ochotonidae china 2018-01-24v4No1 / 53
279amnon high in mouth compared to small intestine stomach in pika ochotonidae china 2018-01-24v4No1 / 53
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 54
771amnoncommon body proper, whole body, china, cotton aphid, aphis gossypii2021-04-21v3No1 / 54
707amnoncommon fifth decade human stage, fourth decade human stage, systemic lupus erythematosus, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 55
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
774amnon high in control compared to tonsillitis in saliva oral cavity oral wash adult hong kong homo sapiens 2021-04-24v3No1 / 55
819amnon high in low atmospheric pollution dalian city prefecture compared to high atmospheric pollution baoding city prefecture in skin of cheek age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 55
720amnoncommon control, adult, zhengzhou city prefecture, china, feces, homo sapiens2028-05-23v3No1 / 56
775amnon high in lichen planus compared to control in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 56
812amnoncommon zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v3No1 / 56
911amnon high in control compared to spinal cord injury in human adult stage nanjing city prefecture china homo sapiens feces 2022-05-21v4No1 / 56
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 56
753amnon high in canis lupus wolf zoological garden captive compared to farm dog breeding center canis lupus familiaris dog in china adult feces 2021-03-12v4No1 / 57
116amnoncommon research facility, litopenaeus vannamei, pacific white shrimp, intestine, south china sea, china2017-04-10v4No1 / 58
624sheryoHigher in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in biochar compared to without biochar in china jiangsu province soil 10 cm depth ph 7-8 ryegrass rhizosphere days 30-40 )2020-05-11v4No1 / 59
281amnoncommon shinisaurus crocodilurus, crocodile lizard, cloaca, china2018-01-25v4No1 / 59
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, liver carcinoma2019-12-16v3No1 / 60
250amnoncommon in bamboo forest soil (common soil, bamboo, phyllostachys pubescens, ph 4, depth (soil) 0-10cm, woodland area, china)2017-11-22v4No1 / 60
90amnoncommon douchi, china, food (fermented)2017-03-08v4No1 / 61
627amnoncommon feces, pregnancy, adult, female, china2020-05-16v3No1 / 61
637amnoncommon gestational age 8-12 weeks, chengdu city prefecture, china, adult, pregnancy, female, feces, homo sapiens2020-08-18v3No1 / 61
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
819amnoncommon dalian city prefecture, skin of cheek, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 61
849amnoncommon control, fourth decade human stage, china, zhejiang province, adult, homo sapiens, feces2021-12-14v3No1 / 61
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
575amnoncommon in professional martial arts athletes (common young adult stage, homo sapiens, feces, athlete, high physical activity, adult, china)2020-01-05v3No1 / 63
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 63
163amnon high in ochotona dauurica mongolia grassland compared to ochotona curzoniae tibet platue in ochotonidae pika stomach china 2017-07-13v4No1 / 63
380amnoncommon tibet autonomous region, feces, homo sapiens, tibetan plateau, adult2018-10-03v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in rattus norvegicus rat sprague dawley male research facility feces china )2019-01-06v4No1 / 63
865amnoncommon inner mongolia autonomous region, china, feces, dog, canis lupus familiaris2022-02-08v3No1 / 64
640amnoncommon dentition, supragingival plaque, supragingival dental plaque, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 65
657amnonpostively correlated with age ( high in older age age compared to younger age in research facility china qinghai province rumen liquid rumen age < 1 year lamb sheep ovis aries )2020-09-13v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in adult zhengzhou city prefecture china feces homo sapiens 2028-05-23v3No1 / 65
735amnon high in restricted feed compared to control in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 65
858amnoncommon 0%-1% salt concentration, low salt concentration, two weeks, suan cai, fermneted chinese cabbage, china, fermented vegetable food product2022-01-11v4No1 / 65
572amnon high in pancreatic cancer compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 66
373amnonlower in soil of mature plants compared to seedlings ( high in early timepoints seedling compared to late timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 66
223amnon high in zhoushan island compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 67
840amnoncommon farm, china, ileum, broiler chicken, gallus gallus2021-11-08v3No1 / 67
858amnon high in 3%-5% salt concentration high salt concentration compared to 0%-1% salt concentration low salt concentration in suan cai fermneted chinese cabbage china fermented vegetable food product two weeks 2022-01-11v4No1 / 67
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in rattus sprague dawley rat feces research facility china )2017-10-25v4No1 / 68
572amnoncommon homo sapiens, tongue, dermal layer of tongue, china, pancreatic cancer2019-12-16v3No1 / 70
91amnoncommon serofluid dish, jiangshui, china, food (fermented)2017-03-08v4No1 / 70
742amnoncommon dalian city prefecture, captive, zoological garden, china, pygoscelis papua, gentoo penguin, bird, feces2021-02-18v3No1 / 70
819amnon high in scalp compared to skin of cheek in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 70
417amnoncommon anser cygnoides, swan goose, bird, feces, winter, china2018-12-01v4No1 / 70
419amnon high in control compared to constipation in rat rattus norvegicus sprague dawley research facility feces china 2018-12-02v4No1 / 70
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
914amnon high in control compared to diarrhea in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v3No1 / 71
716amnoncommon control, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 72
934amnon high in jejunal mucosa compared to lumen of jejunum in age 7 weeks wuhan china chicken gallus gallus jejunum research facility 2022-09-18v3No1 / 72
697amnoncommon sichuan province, china, oral cavity, research facility, female organism, sprague dawley, female2028-03-29v3No1 / 73
934amnoncommon lumen of jejunum, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 73
603amnonhigher in inital batches of baijiu fermentation pit mud ( high in days 0-90 compared to days 180-270 in mud hefei city prefecture china baijiu fermentation pit mud )2020-04-05v3No1 / 74
774amnoncommon tonsillitis, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 74
34amnonhigher in 10cm, 20cm depth compared to 0cm ( high in 10 cm depth 20 cm depth compared to topsoil in mangrove swamp rhizosphere china )2016-12-06v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 75
299amnon high in control compared to mouth neoplasm cancer in saliva adult homo sapiens china 2018-02-27v4No1 / 75
858amnoncommon 3%-5% salt concentration, high salt concentration, suan cai, fermneted chinese cabbage, china, fermented vegetable food product, two weeks2022-01-11v4No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in 2-5 year-old child stage age 3-6 compared to 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
279amnoncommon pika, ochotonidae, stomach, small intestine, china2018-01-24v4No1 / 77
819amnoncommon skin of cheek, baoding city prefecture, age 25-45 years, china, adult, skin, female, homo sapiens2021-07-12v1No1 / 77
512amnon high in depth (soil) 10 cm depth (soil) 0-20cm compared to depth (soil) 60cm in fen peatland peat soil soil china 2019-03-22v4No1 / 77
609sheryohigher in soil without tobacco plants and with difenoconazole fungicide ( high in absence of tobacco plants compared to presence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 78
163amnoncommon ochotonidae, pika, ochotona dauurica, mongolia grassland, stomach, china2017-07-13v4No1 / 80
451amnoncommon serofluid dish, jiangshui, china, food (fermented)2019-01-10v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
373amnonhigher in soil of mature plants compared to seedlings ( high in late timepoints compared to seedling early timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 81
837sheryoHigher in agricultural field at depths 100-300cm compared to 0-40cm, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 81
911amnoncommon control, human adult stage, china, nanjing city prefecture, homo sapiens, feces2022-05-21v4No1 / 81
707amnoncommon fifth decade human stage, fourth decade human stage, guangzhou city prefecture, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 82
716amnoncommon chronic bad breath, halitosis, tongue, china, dermal layer of tongue, homo sapiens, adult2028-05-22v3No1 / 82
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 83
279amnoncommon grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 83
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to fresh food spoilage late timepoint in china foodon product type )2018-01-09v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 83
601amnoncommon homo sapiens, feces, china, adult, type 2 diabetes mellitus2020-03-30v4No1 / 85
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
402amnoncommon sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 1, china2018-11-18v4No1 / 87
914amnon high in diarrhea compared to control in yak qinghai province tibet autonomous region bos grunniens feces 2022-06-26v3No1 / 88
382amnoncommon water, hot spring, geothermal field, ganzi tibetan autonomous prefecture, china, high temperature environment2018-10-22v4No1 / 89
904amnoncommon age 42 weeks, research facility, china, jinghong-1, hen, caecum, gallus gallus, chicken2022-05-18v3No1 / 89
530amnoncommon snake, feces, snake farm, farm, adula, hunan province, naja atra, chinese cobra, china2019-07-21v4No1 / 90
223amnon high in hangzhou bay compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 90
899amnoncommon in snail intestine from heavy metal contaminated greenhouse (common greenhouse, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 90
855sheryoHigher in soil depth of 75cm compared to soil depth of 350cm in fertilized soil in china ( high in depth 175cm compared to depth 350cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 91
725amnoncommon chronic periodontitis, periodontitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 92
774amnoncommon control, saliva, oral cavity, oral wash, adult, hong kong, homo sapiens2021-04-24v3No1 / 92
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
836amnoncommon oral lichen planus, gingival erosive oral lichen planus, chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
837sheryoHigher in agricultural field at depths0-40cm compared to 40-100cm, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common homo sapiens, feces, adult, female, thailand, hmong, china)2018-11-18v4No1 / 95
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, saliva, china2019-09-10v3No1 / 96
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in capra hircus goat china research facility ruminal fluid rumen shanxi province dairy goat )2021-05-23v3No1 / 96
753amnoncommon zoological garden, captive, canis lupus, wolf, china, adult, feces2021-03-12v4No1 / 98
202amnoncommon homo sapiens, mouth mucosa, oral cavity, china, mouth2017-10-01v4No1 / 100
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 101
438amnoncommon young adult stage, homo sapiens, feces, china2018-12-30v4No1 / 101
279amnoncommon pika, ochotonidae, mouth, china2018-01-24v4No1 / 103
855sheryoHigher in soil depth of 1000cm compared to soil depth of 800cm in fertilized soil in china ( high in depth (water) 1000m compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 103
168amnoncommon in mud from chinese liquor fermentation pit (common mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 104
279amnoncommon grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 104
414amnon high in non-manured soil compared to manured soil in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 104
519amnoncommon homo sapiens, adult, late adult stage, city, dentition, supragingival plaque, china2019-06-25v3No1 / 104
34amnonhigher in 0cm depth compared to 10cm, 20cm depth ( high in topsoil compared to 10 cm depth 20 cm depth in mangrove swamp rhizosphere china )2016-12-06v4No1 / 106
438amnoncommon 6-12 year-old child stage, homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
631sheryoHigher in maize field biochar amended rhizosphere soil compared to unamended rhizosphere soil ( high in biochar compared to unamended soil in rhizosphere china guizhou province kaiyang county soil maize field after 6 years )2020-06-02v3No1 / 108
438amnoncommon 2-5 year-old child stage, homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
524amnoncommon homo sapiens, sichuan province, saliva, adult, china2019-07-06v4No1 / 109
223amnon high in sanmen bay compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 110
271amnon high in root structure root compared to soil rhizosphere in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
899amnoncommon in snail intestine from phytoremedation field (common phytoremedation field, field, heavy metal contaminated soil, land snail, bradybaena ravida, china, sedum alfredii, heavy metal, zhejiang province, intestine)2022-04-25v3No1 / 110
373amnon high in soil compared to rhizosphere in oryza sativa rice hunan province rice field china 2018-09-08v4No1 / 111
855sheryoHigher in soil depth of 800cm compared to soil depth of 350cm in fertilized soil in china ( high in depth 800cm compared to depth 350cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 111
438amnoncommon 65-79 year-old human stage, feces, homo sapiens, adult, jiangsu province, china2018-12-30v4No1 / 111
555amnoncommon homo sapiens, shanghai proper, child, age 7-14 years, supragingival plaque, dentition, china2019-09-10v3No1 / 112
735amnon high in control compared to restricted feed in research facility nanjing city prefecture china pregnancy digesta rumen female organism female sheep ovis aries 2021-01-22v3No1 / 112
863amnon high in winter compared to spring in xinglong mountain national nature reserve alpine musk deer moschus chrysogaster yuzhong county china deer captive farm feces 2022-01-28v4No1 / 112
269amnoncommon in fresh yao meat food (common china, foodon product type)2018-01-09v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
417amnon high in mongolia summer compared to winter china in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 114
438amnoncommon fifth decade human stage, fourth decade human stage, feces, homo sapiens, jiangsu province, adult, china2018-12-30v4No1 / 115
640amnoncommon saliva, homo sapiens, shanghai district, china, adult, female2020-08-22v4No1 / 117
792amnon high in rhizosphere nitraria tangutorum haloxylon ammodendron compared to soil in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v4No1 / 118
414amnon high in manured soil compared to non-manured soil in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 118
315amnonlower in frog pond water compared to frog gut ( high in quasipaa spinosa giant spiny frog frog compared to water fresh water in hunan province jiangxi province china )2018-04-10v4No1 / 119
753amnoncommon china, farm, dog breeding center, adult, feces, canis lupus familiaris, dog2021-03-12v4No1 / 120
438amnoncommon tenth decade human stage, ninth decade human stage, feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
581amnoncommon in red swamp crayfish grown in flooded rice field (common procambarus clarkii, red swamp crayfish, fish, intestine, adult, china, jiangsu province, rice field)2020-01-21v3No1 / 122
741amnon high in alfalfa diet compared to pellet feed diet in intestine ram's horn snail china research facility planorbella trivolvis 2021-02-17v3No1 / 123
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in tibet autonomous region feces homo sapiens tibetan plateau adult 2018-10-03v4No1 / 123
590amnoncommon in turtle pond water (common china, turtle farm, farm, hainan autonomous prefecture, pond water, water)2020-02-10v4No1 / 127
753amnon high in farm dog breeding center canis lupus familiaris dog compared to captive zoological garden canis lupus wolf in china adult feces 2021-03-12v4No1 / 127
779amnon high in control compared to crohn's disease in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 127
855sheryoCommon in soil depth of 1000cm in fertilized soil in china (common depth 1000cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 127
934amnoncommon jejunal mucosa, age 7 weeks, wuhan, china, chicken, gallus gallus, jejunum, research facility2022-09-18v3No1 / 127
855sheryoHigher in soil depth of 800cm compared to soil depth of 1000cm in fertilized soil in china ( high in depth 800cm compared to depth 1000cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 128
783sheryohigher in desert soil in mongolia under no water addition treatment compared to soil with water addition ( high in no water addition ambient precipitation compared to water addition 100% above ambient precipitation in ph 7.85 luvic gypsisols cambic arenosols china mongolia dengkou county ulan buh desert bajada sandy desert soil )2021-05-11v4No1 / 130
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 131
417amnon high in winter china compared to mongolia summer in anser cygnoides swan goose bird feces 2018-12-01v4No1 / 132
775amnoncommon jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 133
438amnoncommon 14-year-old human stage, 13-year-old human stage, homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
519amnoncommon homo sapiens, adult, late adult stage, city, saliva, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, buccal mass2020-02-02v3No1 / 136
675sheryoHigher in watermelon rhizosphere soil inoculated with fusarium oxysporum f. sp. niveum compared to uninoculated watermelon rhizosphere soil ( high in inoculated with fusarium oxysporum f. sp. niveum compared to un-inoculated in co culture with wheat (triticum aestivum l.) ph 7 citrullus lanatus rhizosphere china )2028-02-22v4No1 / 136
725amnoncommon periodontitis, acute pericementitis, mouth mucosa, buccal mucosa, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 136
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 136
315amnoncommon in frog gut (common hunan province, jiangxi province, quasipaa spinosa, giant spiny frog, frog, colon, digestive system, china)2018-04-10v4No1 / 138
628sheryoHigher in bulk soil with barley plants after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in bulk soil china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 140
741amnoncommon alfalfa diet, intestine, ram's horn snail, china, research facility, planorbella trivolvis2021-02-17v3No1 / 141
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 141
855sheryoCommon in soil depth of 800cm in fertilized soil in china (common depth 800cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 142
279amnoncommon pika, ochotonidae, colon, caecum, china2018-01-24v4No1 / 146
815amnoncommon corsac fox, vulpes corsac, lake hulun, wild, winter, mongolia, feces2021-07-04v3No1 / 146
85amnoncommon litopenaeus vannamei, pacific white shrimp, shenzhen city prefecture, digestive system, china, sea water2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common air, hong kong, city)2019-01-20v4No1 / 147
64amnoncommon saliva, homo sapiens, sichuan province2017-02-16v4No1 / 152
254amnon high in winter dry season compared to summer wet season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 153
780amnon high in jejunum duodenum small intestine compared to caecum in jinzhou city prefecture china research facility chicken gallus gallus 2021-04-28v3No1 / 153
837sheryoHigher at 100-300cm depth compared 40-100cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 40-100cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 154
836amnoncommon chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 155
512amnon high in depth (soil) 60cm compared to depth (soil) 10 cm depth (soil) 0-20cm in fen peatland peat soil soil china 2019-03-22v4No1 / 155
725amnoncommon control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 156
314amnon high in tibetan pig tibetan swine compared to sus scrofa pig in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 157
402amnoncommon sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 2,3, china2018-11-18v4No1 / 159
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens adult late adult stage city china 2019-06-25v3No1 / 159
815amnoncommon lake hulun, wild, winter, mongolia, red fox, vulpes vulpes, feces2021-07-04v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
475amnoncommon in air in subway train in hong kong (common air, hong kong, city, subway)2019-01-20v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
25amnon high in control compared to antibiotic in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 163
652amnoncommon sichuan province, china, adult, saliva, homo sapiens2020-09-13v3No1 / 166
438amnonlower in kindergarten compared to primary and middle school kids ( high in 14-year-old human stage 13-year-old human stage 6-12 year-old child stage age 8-12 age 13-14 compared to 2-5 year-old child stage age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
894amnoncommon leaf surface, citrus unshiu, china, citrus, zhejiang province, leaf, orchard2022-04-11v4No1 / 172
579amnoncommon in pond water of mud crab aquaculture (common spring, china, pond, saline water, saline water aquarium, fish farm, scylla paramamosain, mud crab)2020-01-14v3No1 / 173
855sheryoCommon in soil depth of 175cm in fertilized soil in china (common depth 175cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 173
163amnoncommon stomach, ochotonidae, pika, ochotona curzoniae, mongolia grassland, china2017-07-13v4No1 / 174
530amnoncommon snake, deinagkistrodon acutus, pit viper, feces, snake farm, farm, adula, hunan province, china2019-07-21v4No1 / 178
299amnoncommon in healthy (non-tumor) controls (common saliva, adult, homo sapiens, control, china)2018-02-27v4No1 / 179
924amnoncommon guangzhou city prefecture, 8-year-old human stage, 7-year-old human stage, child, supragingival dental plaque, supragingival plaque, china2022-07-27v3No1 / 181
555amnon high in supragingival plaque dentition compared to saliva in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 184
604amnoncommon caecum, chicken, gallus gallus, cecal content, china, research facility2020-04-06v3No1 / 185
661amnoncommon farm, maojian district, age 3 years, china, chinese giant salamander, andrias davidianus, intestine2020-09-20v4No1 / 186
883amnoncommon oil contaminated soil, oilfield, yellow river delta, china, shengli oilfield, soil2022-03-20v4No1 / 187
631sheryoHigher in maize field biochar amended bulk soil, after 6 years of biochar amended, compared to unamended soil ( high in biochar compared to unamended soil in china guizhou province kaiyang county soil maize field bulk soil after 6 years )2020-06-02v3No1 / 188
299amnoncommon saliva, adult, homo sapiens, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare rhizosphere days 180 mature barley plants )2020-05-18v4No1 / 190
860amnoncommon china, research facility, duck, anas platyrhynchos, intestine, intestinal contents2022-01-12v3No1 / 190
156amnonlower in soil and rhizosphere supplemented with struvite ( high in control compared to struvite in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 191
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, stomach2020-02-02v3No1 / 194
686sheryoHigher in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical and organic fertilizer and had high Fusarium cumulative disease incidence ( high in high fusarium cumulative disease incidence organic fertilizer- chicken manure compost chemical fertilization n,p,k compared to low fusarium cumulative disease incidence bacterial enriched bio-fertilizer fungal enriched bio-fertilizer in fusarium oxysporum f. sp. vanillae soil from vanilla field vanilla planifolia pot expreiment wanning city ph 7.6 )2028-03-08v4No1 / 196
631sheryoHigher in maize field unamended bulk soil, after 6 years of biochar amended, compared to biochar amended soil ( high in unamended soil compared to biochar in china guizhou province kaiyang county soil maize field bulk soil after 6 years )2020-06-02v3No1 / 201
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, china, type i diabetes mellitus, induced type 1 diabetes2020-01-31v3No1 / 202
791sheryoHigh at 80cm depth compared to 0cm depth in highly saline sodic soil in China ( high in depth (soil) 80cm compared to depth (soil) 0-20cm depth 0cm in high salinity high sodicity soil salic solonetz da'an station china songnen plain )2021-06-07v4No1 / 203
878amnoncommon pm10, respirable suspended particulate matter, city, municipality of beijing, china, air2022-03-11v3No1 / 203
438amnonlower in centenarians compared to adults ( high in fifth decade human stage fourth decade human stage 65-79 year-old human stage compared to tenth decade human stage ninth decade human stage age >94 in homo sapiens feces china )2018-12-30v4No1 / 203
555amnon high in saliva compared to supragingival plaque dentition in homo sapiens shanghai proper child age 7-14 years china 2019-09-10v3No1 / 205
603amnonlower in inital batches of baijiu fermentation pit mud ( high in days 180-270 compared to days 0-90 in mud hefei city prefecture china baijiu fermentation pit mud )2020-04-05v3No1 / 205
783sheryohigher in desert soil in mongolia under water addition treatment compared to soil without water addition ( high in 100% above ambient precipitation water addition compared to no water addition ambient precipitation in ph 7.85 luvic gypsisols cambic arenosols china mongolia dengkou county ulan buh desert bajada sandy desert soil )2021-05-11v4No1 / 206
254amnon high in autumn compared to winter summer in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 206
725amnoncommon chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 206
863amnoncommon qilian county, farm, captive, china, forest musk deer, moschus berezovskii, deer, feces2022-01-28v4No1 / 206
913amnoncommon municipality of chongqing, china, research facility, cecal content, caecum, age 70 days, bird, anser cygnoides, sichuan white goose, goose2022-06-01v3No1 / 206
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in subacute rumen acidosis acidosis compared to control in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 207
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common ph 7, jilin province, rhizosphere, soil, black soil, china, glycine soja)2021-03-18v3No1 / 210
780amnon high in caecum compared to jejunum duodenum small intestine in jinzhou city prefecture china research facility chicken gallus gallus 2021-04-28v3No1 / 212
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
855sheryoHigher in soil depth of 350cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 350cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 217
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
584amnoncommon male, rattus norvegicus, rat, sprague dawley, research facility, feces, control, china2020-01-31v3No1 / 221
824sheryoHigher in soil at 0-10cm depth after 0-9 years compared to after 27-35 years of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in depth (soil) 0-10cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 230
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens shanghai district china adult female 2020-08-22v4No1 / 232
780amnoncommon jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 232
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 234
279amnoncommon grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 235
349amnoncommon rattus, rat, feces, research facility, sprague dawley, male, china2018-07-29v4No1 / 235
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in young adult stage soldiers compared to tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage adult age >94 in homo sapiens feces china )2018-12-30v4No1 / 238
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 239
286amnoncommon in feces of individuals with kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
837sheryoHigher at 40-100cm depth compared to 0-40cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 40-100cm compared to depth 0-40cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 239
585amnoncommon china, pomacea canaliculata, golden apple snail, nanheng river, qingpu district, intestine2020-02-02v3No1 / 240
725amnoncommon acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 240
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in skin of cheek age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 242
855sheryoCommon in soil depth of 350cm in fertilized soil in china (common depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 242
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare rhizosphere days 180 mature barley plants )2020-05-18v4No1 / 243
824sheryoHigher soil at 40-60cm depth after 0-9 years compared to 27-35 years after of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in depth 40-60cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 247
837sheryoHigher at 100-300cm depth compared 0-40cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 250
767sheryoHigh in control treatment soil with high fusarium indices compared to soil with low fusarium indices planted with Chrysanthemum in Nanjing China ( high in fusarium high fusarium cumulative disease incidence compared to conventional tillage paenibacillus paenibacillus polymyxa compost soil bio-organic fertilizer soil fumigation dazomet deep plough low fusarium cumulative disease incidence in soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county )2021-04-18v4No1 / 252
111amnoncommon rumen, ruminant reticulum, omasum, mongolian sheep, ovis aries, china2017-04-09v4No1 / 253
279amnoncommon grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 253
419amnoncommon rat, rattus norvegicus, sprague dawley, research facility, feces, china2018-12-02v4No1 / 254
561amnon high in grass growth diet summer compared to spring green stage diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 256
746sheryoHigh in saline soil fertilized with chemical fertilizer compared to biological fertilizer, planted with tomatos, in dafeng, china ( high in chemical fertilization n,p,k compared to trichoderma guizhouense njau 4742 chicken manure biological fertilization in saline soil solonchak china dafeng city jiangsu province ph 7.5 solanum lycopersicum )2021-03-03v4No1 / 269
931amnoncommon jejunum, duodenum, riwoqe county, china, yak, tibet autonomous region, bos grunniens2022-08-25v3No1 / 270
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 273
315amnoncommon in frog pond water (common hunan province, jiangxi province, water, fresh water, pond, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common spring, river, water, china)2017-07-12v4No1 / 278
688amnoncommon nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 278
134amnon high in taxus cuspidata compared to taxus media in rhizosphere tree taxus china 2017-04-16v4No1 / 279
438amnon high in 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage adult in homo sapiens feces china 2018-12-30v4No1 / 279
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 281
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
863amnoncommon farm, yuzhong county, xinglong mountain national nature reserve, moschus chrysogaster, alpine musk deer, china, deer, captive, feces2022-01-28v4No1 / 290
156amnoncommon brassica, brassica oleracea, leaf, phyllosphere, china2017-07-27v4No1 / 292
561amnon high in grass growth diet summer compared to withered grass diet winter in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 294
111amnon high in rumen ruminant reticulum omasum compared to rectum ileum caecum colon in mongolian sheep ovis aries china 2017-04-09v4No1 / 294
780amnoncommon caecum, jinzhou city prefecture, china, research facility, chicken, gallus gallus2021-04-28v3No1 / 294
824sheryoHigher in soil at 0-10cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in depth (soil) 0-10cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 294
737amnoncommon ruminal fluid, rumen, hainan autonomous prefecture, age 2 months, research facility, hainan black goat, china, goat, capra hircus2021-01-27v3No1 / 295
824sheryoHigher soil at 40-60cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 299
419amnoncommon in rats with induced constipation (common rat, rattus norvegicus, sprague dawley, research facility, feces, constipation, china)2018-12-02v4No1 / 300
223amnon high in other regions compared to yushan islands in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 302
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 305
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth (soil) 0-20cm compared to depth 20-40cm in ph 6-7 clay loam gleysol china jiangsu province sihong county chenwei forest soil poplar plantation poplar )2021-08-25v4No1 / 312
752sheryoHigher in treatments with biochar compared to treatments without biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in biochar compared to without biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 317
687amnon high in chinese laoshan milk goat goat capra hircus compared to chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 318
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
828sheryoHigher at 20-40cm depth compared to 0-20cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth 20-40cm compared to depth (soil) 0-10cm in ph 6-7 clay loam gleysol china jiangsu province sihong county chenwei forest soil poplar plantation poplar )2021-08-25v4No1 / 321
402amnon high in zone 2,3 compared to zone 1 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 322
628sheryoHigher in bulk soil with barley plants after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in bulk soil china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 327
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
111amnoncommon caecum, mongolian sheep, ovis aries, rectum, ileum, colon, china2017-04-09v4No1 / 330
163amnon high in ochotona curzoniae tibet plateau compared to ochotona dauurica mongolia grassland in ochotonidae pika stomach china 2017-07-13v4No1 / 331
855sheryoHigher in soil depth of 175cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 175cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 334
837sheryoHigher at 40-100cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 40-100cm compared to depth 100-300cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 336
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
750sheryoCommon in soil of wheat field in China (common fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 337
819amnon high in high atmospheric pollution baoding city prefecture compared to low atmospheric pollution dalian city prefecture in adult age 25-45 years female china scalp skin homo sapiens 2021-07-12v1No1 / 337
254amnoncommon river, water, fresh water, depth (soil) 50cm, jiulong river, fujian province, china2017-11-23v4No1 / 347
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
767sheryoHigh in conservation tillage compared to conventional tillage soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' in Nanjing China ( high in conservation tillage compared to deep plough conventional tillage in dazomet soil fumigation soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county bio-organic fertilizer compost biofilter paenibacillus polymyxa paenibacillus compost soil pig manure )2021-04-18v4No1 / 350
792amnoncommon depth (soil) 20-60cm, nitraria tangutorum, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 352
767sheryoHigh in conventional tillage compared to conservation tillage soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' in Nanjing China ( high in deep plough conventional tillage compared to conservation tillage in dazomet soil fumigation soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county bio-organic fertilizer compost biofilter paenibacillus polymyxa paenibacillus compost soil pig manure )2021-04-18v4No1 / 355
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth (soil) 50cm jiulong river fujian province china )2017-11-23v4No1 / 356
561amnon high in winter withered grass diet compared to grass growth diet summer in ruminal fluid rumen alpine meadow tibetan plateau china yak bos grunniens 2019-11-05v3No1 / 357
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
767sheryoHigh in soil with low fusarium indices compared to control treatment soil with high fusarium indices planted with Chrysanthemum in Nanjing China ( high in low fusarium cumulative disease incidence conventional tillage deep plough dazomet soil fumigation bio-organic fertilizer paenibacillus polymyxa paenibacillus compost soil pig manure compared to control high fusarium cumulative disease incidence in soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county )2021-04-18v4No1 / 360
442amnoncommon in tnbs induced colitis in rat feces (common rattus norvegicus, rat, sprague dawley, male, research facility, feces, tnbs, colitis, china)2019-01-06v4No1 / 360
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
686sheryoHigher in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal and bacterial bio-fertilizer and had low Fusarium cumulative disease incidence ( high in fungal enriched bio-fertilizer bacterial enriched bio-fertilizer low fusarium cumulative disease incidence compared to chemical fertilization n,p,k organic fertilizer- chicken manure compost high fusarium cumulative disease incidence in fusarium oxysporum f. sp. vanillae soil from vanilla field vanilla planifolia pot expreiment wanning city ph 7.6 )2028-03-08v4No1 / 371
579amnoncommon in pond water of mud crab aquaculture (common china, pond, saline water, saline water aquarium, fish farm, scylla paramamosain, mud crab, summer, autumn)2020-01-14v3No1 / 374
687amnon high in low milk yield compared to high milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 375
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
791sheryoCommon in highly saline sodic soil at8 80cm depth in China (common depth (soil) 80cm, ph 10, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 377
442amnoncommon rattus norvegicus, rat, sprague dawley, male, research facility, feces, china2019-01-06v4No1 / 378
512amnon high in tibetan plateau riganqiao peatland ph 5.5-6.5 compared to hani peatland baekdudaegan ph 5-6 in fen peatland peat soil soil china 2019-03-22v4No1 / 381
216amnoncommon mouse, mus musculus, feces, research facility, male, c57bl/6, china2017-10-24v4No1 / 385
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 395
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
561amnon high in spring green stage diet compared to summer grass growth diet in bos grunniens yak china tibetan plateau alpine meadow rumen ruminal fluid 2019-11-05v3No1 / 397
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 397
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
791sheryoHigher in high sodicity and high salinity soil compared to low sodicity and low salinity soil at 80cm depth in China ( high in ph 10 high sodicity high salinity compared to ph 9 low sodicity low salinity in depth (soil) 80cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 404
883amnon high in oilfield oil contaminated soil compared to non-contaminated soil in yellow river delta shengli oilfield china soil 2022-03-20v4No1 / 404
800amnoncommon 100-250 days following heavy metal contamination (common autumn, summer, reservoir, sediment depth 0-10cm, heavy metal, china, xiannv lake, lake, fresh water, sediment)2021-06-15v4No1 / 412
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 418
687amnoncommon chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 429
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 431
792amnon high in soil compared to haloxylon ammodendron nitraria tangutorum rhizosphere in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v4No1 / 432
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
504amnoncommon nan'ao island, sediment, marine sediment, china2019-03-14v4No1 / 437
792amnoncommon depth (soil) 20-60cm, haloxylon ammodendron, rhizosphere, sand, ph 9, minqin county, depth (soil) 50cm, desert, china2021-06-07v4No1 / 443
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
504amnoncommon nan'ao island, water, sea water, china2019-03-14v4No1 / 452
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
787amnoncommon in high grain diet induced subacute acidosis (common acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 463
111amnon high in rectum caecum ileum colon compared to rumen ruminant reticulum omasum in mongolian sheep ovis aries china 2017-04-09v4No1 / 464
314amnoncommon caecum, cecal content, tibet autonomous region, farm, tibetan pig, tibetan swine, china2018-04-10v4No1 / 467
254amnonlower in river when close to populated region compared to downstream ( high in downstream compared to upstream city populated place in river water fresh water depth (soil) 50cm jiulong river fujian province china )2017-11-23v4No1 / 468
160amnoncommon in wastewater treatment plant effluent in autumn in china (common autumn, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 469
221amnoncommon rattus, sprague dawley, rat, feces, research facility, china2017-10-25v4No1 / 470
438amnonhigher in centenarians compared to adults ( high in tenth decade human stage ninth decade human stage age >94 compared to fifth decade human stage fourth decade human stage 65-79 year-old human stage in homo sapiens feces china )2018-12-30v4No1 / 474
454amnoncommon feces, elaphurus davidianus, pere deer, deer, wild, china2019-01-10v4No1 / 480
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
512amnoncommon fen, peatland, peat soil, soil, ph 5.5-6.5, tibetan plateau, riganqiao peatland, china2019-03-22v4No1 / 483
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
791sheryoHigh at 0cm depth compared to 80cm depth in highly saline sodic soil in China ( high in depth (soil) 0-20cm depth 0cm compared to depth (soil) 80cm in high salinity high sodicity soil salic solonetz da'an station china songnen plain )2021-06-07v4No1 / 496
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 497
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 504
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in dairy goat shanxi province rumen ruminal fluid research facility china goat capra hircus )2021-05-23v3No1 / 504
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
454amnoncommon feces, elaphurus davidianus, pere deer, deer, captive, china2019-01-10v4No1 / 509
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 517
824sheryoHigher at 40-60cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 40-60cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 520
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
27amnoncommon bos grunniens, rumen, china2016-12-05v4No1 / 532
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, baijiu, china, hefei city prefecture, days 0-90)2020-04-05v3No1 / 542
725amnon high in subgingival dental plaque subgingival plaque compared to buccal mucosa mouth mucosa in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 544
908amnoncommon guanzhong horse, shanxi province, china, adult organism, horse, equus caballus, research facility, feces2022-05-19v4No1 / 567
254amnon high in summer wet season autumn compared to winter dry season in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common spring, wastewater treatment plant, effluent, china)2017-07-12v4No1 / 573
914amnoncommon tibet autonomous region, qinghai province, bos grunniens, yak, feces2022-06-26v3No1 / 575
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth (soil) 50cm jiulong river fujian province china 2017-11-23v4No1 / 581
931amnoncommon ileum, colon, caecum, feces, riwoqe county, china, yak, tibet autonomous region, bos grunniens2022-08-25v3No1 / 587
687amnoncommon holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 593
792amnoncommon depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v4No1 / 595
791sheryoCommon in highly saline sodic soil at 20cm depth in China (common ph 10.5, depth 20cm, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 596
444amnonhigher in continuously cropped strawberry soil ( high in continuous cropping age 5 years age 10 years compared to age 1 year in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 602
603amnoncommon in baijiu fermentation pit mud in later batches (common hefei city prefecture, china, baijiu, fermentation pit mud, mud, days 180-270)2020-04-05v3No1 / 608
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage age >94 compared to young adult stage soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
791sheryoCommon in highly saline sodic soil at 40cm depth in China (common depth (soil) 40cm, ph 10.5, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 618
223amnon high in yushan islands compared to other regions in sediment marine sediment ocean east china sea china 2017-10-26v4No1 / 619
264amnoncommon oryctolagus cuniculus, rex rabbit, caecum, research facility, jiangsu province, china2017-12-11v4No1 / 622
931amnon high in jejunum duodenum compared to ruminal fluid rumen in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 622
931amnoncommon ruminal fluid, rumen, riwoqe county, china, yak, tibet autonomous region, bos grunniens2022-08-25v3No1 / 626
883amnon high in depth (soil) 60-100cm compared to depth (soil) 0-20cm in oilfield yellow river delta china shengli oilfield oil contaminated soil soil 2022-03-20v4No1 / 627
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
279amnon high in caecum colon compared to stomach small intestine in pika ochotonidae china 2018-01-24v4No1 / 634
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in autumn summer compared to spring in reservoir sediment depth 0-10cm heavy metal china xiannv lake lake fresh water sediment )2021-06-15v4No1 / 644
616amnon high in ph 5.5-6 fertilized soil compared to ph 6.7 non-fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 648
791sheryoCommon in highly saline sodic soil at 0cm depth in China (common depth (soil) 0-20cm, ph 10.5, high salinity, high sodicity, depth 0cm, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 648
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
25amnoncommon oryctolagus cuniculus, caecum, rex rabbit, sichuan province, research facility2016-12-01v4No1 / 669
561amnoncommon bos grunniens, yak, china, tibetan plateau, alpine meadow, rumen, ruminal fluid2019-11-05v3No1 / 670
791sheryoHigher in high sodicity and high salinity soil compared to low sodicity and low salinity soil at 0cm depth in China ( high in ph 10.5 high sodicity high salinity compared to ph 8.5 low sodicity low salinity in depth (soil) 0-20cm depth 0cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 670
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 671
791sheryoHigher at 80cm depth compared to 0cm depth in low saline low sodicity soil in China ( high in depth (soil) 80cm compared to depth (soil) 0-20cm depth 0cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 675
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
506amnoncommon soil, boreal wetland, seasonal frozen marsh, depth (soil) 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 690
134amnon high in taxus mairei southeast china subtropical compared to taxus media taxus cuspidata northeast china temperate in rhizosphere tree taxus china 2017-04-16v4No1 / 694
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
824sheryoHigher at 20-40cm depth compared to 10-20cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 695
787amnoncommon control, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat2021-05-23v3No1 / 700
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
746sheryoHigh in saline soil fertilized with biological fertilizer compared to chemical fertilizer, planted with tomatos, in dafeng, china ( high in trichoderma guizhouense njau 4742 chicken manure biological fertilization compared to chemical fertilization n,p,k in saline soil solonchak china dafeng city jiangsu province ph 7.5 solanum lycopersicum )2021-03-03v4No1 / 703
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
809amnoncommon lu'an city prefecture, flowerpot, research facility, greenhouse, dendrobium officinale, rhizosphere, china2021-06-20v4No1 / 715
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
134amnon high in taxus media taxus cuspidata northeast china temperate compared to taxus mairei southeast china subtropical in rhizosphere tree taxus china 2017-04-16v4No1 / 734
824sheryoHigher at 10-20cm depth compared to 0-10cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth (soil) 0-10cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 734
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
735amnoncommon restricted feed, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 744
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth (soil) 0-20cm depth 0cm compared to depth (soil) 80cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 748
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
735amnoncommon control, research facility, nanjing city prefecture, china, pregnancy, digesta, rumen, female organism, female, sheep, ovis aries2021-01-22v3No1 / 761
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 790
454amnon high in summer compared to winter in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 791
478amnoncommon farm, litopenaeus vannamei, pacific white shrimp, intestine, china2019-02-19v4No1 / 795
478amnoncommon farm, shrimp farm, water, saline water, china2019-02-19v4No1 / 799
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
746sheryoCommon in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (common chemical fertilization n,p,k, solanum lycopersicum, ph 7.5, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 811
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 831
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 844
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
837sheryoHigher at 0-40cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 863
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 866
855sheryoCommon in soil depth of 75cm in fertilized soil in china (common depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 873
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in ph 9 low sodicity low salinity compared to ph 10 high sodicity high salinity in depth (soil) 80cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 895
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, fusarium oxysporum f. sp. chrysanthemi, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 922
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in ph 8.5 low sodicity low salinity compared to ph 10.5 high sodicity high salinity in depth (soil) 0-20cm depth 0cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 932
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
901amnon high in depth (sediment) 0-20cm compared to sediment surface depth (sediment) 0cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 939
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
701amnoncommon municipality of beijing, research facility, china, male, male organism, age 2 years, rumen liquid, rumen, bos taurus, cow2028-04-01v3No1 / 953
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
917amnon high in qiao nature reserve compared to futian national nature reserve in mangrove biome mangrove depth (soil) 0-20cm china marsh soil saline marsh 2022-07-08v3No1 / 967
931amnon high in jejunum duodenum compared to ileum feces colon caecum in tibet autonomous region riwoqe county china yak bos grunniens 2022-08-25v3No1 / 970
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus mairei, china2017-04-16v4No1 / 973
675sheryoCommon in watermelon rhizosphere soil (common co culture with wheat (triticum aestivum l.), un-inoculated, ph 7, citrullus lanatus, rhizosphere, china)2028-02-22v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 989
746sheryoCommon in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (common saline soil, solonchak, china, dafeng city, jiangsu province, ph 7.5, solanum lycopersicum, biological fertilization, chicken manure, trichoderma guizhouense njau 4742)2021-03-03v4No1 / 993
809amnoncommon dendrobium moniliforme, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1002
933amnoncommon guangxi zhuang autonomous region, ph 5.5, quaternary laterite soil, research facility, china, cucurbita moschata, pumpkin, rhizosphere2022-09-11v3No1 / 1002
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
687amnon high in chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus compared to chinese laoshan milk goat goat capra hircus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 1022
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1025
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 1035
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1038
687amnoncommon chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1039
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common depth 100-300cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common depth 40-100cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1069
917amnon high in futian national nature reserve compared to qiao nature reserve in depth (soil) 0-20cm china marsh mangrove mangrove biome soil saline marsh 2022-07-08v3No1 / 1071
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common depth (soil) 40cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1085
478amnoncommon farm, shrimp farm, sediment, china2019-02-19v4No1 / 1085
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
454amnon high in wild compared to captive in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 1094
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county, bio-organic fertilizer, compost biofilter, paenibacillus polymyxa, paenibacillus, compost soil, pig manure, conventional tillage, deep plough)2021-04-18v4No1 / 1109
855sheryoHigher in soil depth of 75cm compared to soil depth of 10cm in fertilized soil in china ( high in depth 75cm compared to depth (water) 10cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1112
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, depth 40-60cm, china, soil)2021-08-08v4No1 / 1113
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common depth (soil) 80cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1128
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
134amnoncommon rhizosphere, tree, taxus, northeast china, temperate, taxus cuspidata, china2017-04-16v4No1 / 1141
687amnoncommon shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1147
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1155
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
746sheryoCommon in saline soil in dafeng, china (common ph 7.6, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 1170
257amnoncommon in tilapia pond sediment (common sediment, freshwater sediment metagenome, pond, fishpond, tilapia, china)2017-11-26v4No1 / 1179
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, ph 7-8, soil, saline marsh2022-07-08v3No1 / 1211
204amnoncommon water, drinking water reservoir, sediment, china2017-10-02v4No1 / 1220
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
901amnon high in bulk sediment compared to rhizosphere in taihu lake depth (sediment) 0-20cm depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1228
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
901amnoncommon taihu lake, depth (sediment) 0-20cm, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1246
800amnoncommon 7-18 days following heavy metal contamination (common spring, reservoir, sediment depth 0-10cm, heavy metal, china, xiannv lake, lake, fresh water, sediment)2021-06-15v4No1 / 1248
134amnoncommon rhizosphere, tree, taxus, taxus media, northeast china, temperate, china2017-04-16v4No1 / 1251
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common china, rhizosphere, citrullus lanatus, co culture with wheat (triticum aestivum l.), ph 7, inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1274
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
917amnoncommon ph 6-6.5, futian national nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 1290
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1294
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
454amnon high in winter compared to summer in elaphurus davidianus pere deer deer feces china 2019-01-10v4No1 / 1304
223amnoncommon ocean, sediment, east china sea, marine sediment, china2017-10-26v4No1 / 1311
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1311
863amnon high in yuzhong county xinglong mountain national nature reserve moschus chrysogaster alpine musk deer compared to moschus berezovskii qilian county forest musk deer in china deer captive farm feces 2022-01-28v4No1 / 1311
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common depth 0-40cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common 20 years, depth 0-40cm, robinia pseudoacacia, loess plateau, shaanxi province, china, reforestation, silt loam, soil)2021-09-26v4No1 / 1323
783sheryocommon in desert soil in mongolia without water addition treatment (common no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1324
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common 30 years, depth 0-40cm, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1346
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1354
809amnoncommon dendrobium huoshanense, lu'an city prefecture, flowerpot, research facility, greenhouse, rhizosphere, china2021-06-20v4No1 / 1356
917amnoncommon ph 6-6.5, kandelia candel, depth (soil) 0-20cm, marsh, china, qiao nature reserve, mangrove, soil2022-07-08v3No1 / 1364
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1369
454amnon high in captive compared to wild in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1374
420amnoncommon in soil of vegetable open field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 1376
901amnoncommon in macrophyte plant rhizosphere (common rhizosphere, depth (sediment) 0-20cm, taihu lake, taihu national park, china, depth (water) 20-100cm, lake sediment)2022-04-25v4No1 / 1378
917amnoncommon ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1379
883amnon high in non-contaminated soil compared to oil contaminated soil oilfield in yellow river delta china shengli oilfield soil 2022-03-20v4No1 / 1381
420amnonhigh freq. in soil of vegetable in plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, greenhouse soil, cultivated environment, china)2018-12-02v4No1 / 1396
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1442
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon depth (soil) 0-20cm, rhizosphere, glycine max, soybean, china2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1491
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 1506
855sheryoHigher in soil depth of 75cm compared to soil depth of 175cm in fertilized soil in china ( high in depth 75cm compared to depth 175cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1522
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
901amnoncommon sediment surface, depth (sediment) 0cm, taihu lake, depth (water) 20-100cm, taihu national park, china, lake sediment2022-04-25v4No1 / 1550
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
863amnon high in qilian county moschus berezovskii forest musk deer compared to xinglong mountain national nature reserve yuzhong county moschus chrysogaster alpine musk deer in china deer captive farm feces 2022-01-28v4No1 / 1604
422amnon high in ph 5-6 compared to ph 7-8 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 1634
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common trichoderma guizhouense njau 4742, fungal enriched bio-fertilizer, fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1661
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1670
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
819amnon high in skin of cheek compared to scalp in age 25-45 years china adult skin female homo sapiens 2021-07-12v1No1 / 1684
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common fusarium oxysporum f. sp. vanillae, soil from vanilla field, vanilla planifolia, pot expreiment, wanning city, ph 7.6, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common organic fertilizer- chicken manure compost, ph 7.6, wanning city, pot expreiment, vanilla planifolia, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1765
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1819
931amnon high in ileum feces colon caecum compared to ruminal fluid rumen in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 1870
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
901amnon high in rhizosphere compared to bulk sediment in depth (sediment) 0-20cm taihu lake depth (water) 20-100cm taihu national park china lake sediment 2022-04-25v4No1 / 1892
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to autumn summer in reservoir sediment depth 0-10cm heavy metal china xiannv lake lake fresh water sediment )2021-06-15v4No1 / 1962
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
931amnon high in ileum feces colon caecum compared to jejunum duodenum in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 2008
931amnon high in ruminal fluid rumen compared to jejunum duodenum in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 2088
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
931amnon high in ruminal fluid rumen compared to ileum feces colon caecum in riwoqe county china yak tibet autonomous region bos grunniens 2022-08-25v3No1 / 2519
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
837sheryoHigher in soil after 10 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3368
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 10 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3585
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3936
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org