Summary for ontology term: china

Number of annotations with term: 1116

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGCCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGGAACTGTAAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.002671
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.001781
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.001781
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.001781
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.001781
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.001781
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.001781
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGAAGTGAAAGCCCGGTGCTTAACGCCGGGACTGCTTTGGAAACTGTTTAGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.001781
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__ParasutterellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGTTGAGTAAGACAGATGTGAAATCCCCGAGCTTAACTCGGGAATGGCATATGTGACTGCTCGACTAGAGTGTGTCAGAGGGAGGTGGAATTCCACG0.001781
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCACTAAGGGTCTGTGGTGAAAGATCGAAGCTTAACTTCGGTAAGCCATGGAAACCGTAGAGCTAGAGTGTGTGAGAGGATCGTGGAATTCCATGT0.001781

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.181818
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaTACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.181818
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTGGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAAATCCGGGGCTCAACCCCGGAACTGCGTTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__CoprococcusTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGTAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTATGCAGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCCAG0.181818
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCAACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCGCGGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG0.181818
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.090909
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.090909

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGGGGCTCAACTCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.247123
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Hyphomicrobiaceae;g__DevosiaTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGATCGTTAAGTCGGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTCGATACTGGCGATCTTGAGTCCGGAAGAGGTGAGTGGAACTCCTAG0.209772
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.208973
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__PhenylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGACAGTTTAGTCAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCTGTCTTGAGTTCGGGAGAGGTGAGTGGAATGCCGAG0.199581
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp16;g__Gp16TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGCAGGCGGTCGTTCAAGTCGCGTGTGAAAGCCCCCGGCTCAACTGGGGAGGGTCACGCGATACTGATCGACTCGAAGGCAGGAGAGGGTAGTGGAATTCCCGG0.192491
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp4;g__Gp4TACGGGGGGAGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCCACCGCAAGTCGACTGTGAAATCTCCGGGCTTAACCCGGAAAGGTCAGCCGATACTGCGGGGCTAGAGTGCAGAAGGGGCAACTGGAATTCTCG0.192115
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhodospirillalesTACGAAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCTTATCAAGTCAGGCGTGAAATTCCCGGGCTCAACCTGGGGGCTGCGCTTGATACTGATGAGCTTGAATGCGGGAGAGGATAGTGGAATTCCCAG0.190052
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__GeodermatophilaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTTGCGTCGGCTGTGAAATCCCGAGGCTCAACCTCGGGTCTGCAGTCGATACGAGCAAACTAGAGTGTTGCAGGGGAGACTGGAATTCCTGG0.188786
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__MyxococcalesTACAGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGCGCGTGTAGGCGGCTTTGCAAGTCGGGTGTGAAAGCCCTCAGCTCAACTGAGGAAGTGCGCCCGAAACTGCAGAGCTTGAGTGCCGGAGAGGGTGGCGGAATTCCCCA0.187500
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACAGAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCGAACGTGAAATCCCTGGGCTCAACCCAGGAACTGCGTCCGATACTGGTTGGCTTGAATCCGGGAGAGGGATGTGGAATTCCAGG0.182085

Annotations:

common ontology terms
term enrichment score
TermScore
china0.975233
soil0.397985
adult0.186996
homo sapiens0.177384
feces0.169363
research facility0.153277
rhizosphere0.152193
control0.116320
farm0.113298
depth (soil) 0-20cm0.100279
zhejiang province0.099868
rumen0.085246
loess plateau0.080808
silt loam0.076190
shaanxi province0.076159
jiangsu province0.072661
triticum aestivum0.071977
LOWER IN control0.071749
intestine0.067062
hunan province0.063839
female0.063164
marine sediment0.057086
saliva0.056700
reforestation0.055838
robinia pseudoacacia0.055838
agricultural field0.052790
mangrove swamp0.051020
winter0.049540
cultivated environment0.049404
guangzhou city prefecture0.048653
fertilized soil0.048555
sediment0.047880
zea mays0.047828
caecum0.046530
agricultural feature0.045259
sprague dawley0.044853
ph 7-80.044836
grazing exclusion0.044521
haplic calcisol0.044521
calci-orthic aridisol0.044521
ningxia province0.044521
yunwushan national natural grassland protection zone0.044521
oryza sativa0.043113
municipality of beijing0.042105
sichuan province0.041729
luancheng county0.041667
water0.041487
jiangxi province0.041237
songnen plain0.041237
da'an station0.041237
salic solonetz0.041237
rat0.039920
biochar0.039903
nanjing city prefecture0.038664
wheat0.037575
gallus gallus0.037341
clay loam0.034904
rumen liquid0.034803
chicken0.033898
city0.033822
tibetan plateau0.033202
paddy field soil0.033202
topsoil0.032794
tongue0.032571
shanghai proper0.031496
black soil0.031496
ruminal fluid0.031250
child0.030702
captive0.030488
mongolia0.029897
ph 90.029785
periodontitis0.029565
depth (soil) 50cm0.029565
fourth decade human stage0.029420
glycine max0.029420
subgingival dental plaque0.029348
sus scrofa0.028716
pig0.028716
heavy metal0.028269
deer0.028269
hainan autonomous prefecture0.028136
male0.028111
ph 7.60.028070
pika0.028070
heilongjiang province0.028070
fresh water0.027907
ochotonidae0.027875
pot expreiment0.027875
shandong province0.027875
bulk soil0.027746
ph 70.027682
subgingival plaque0.027530
ovis aries0.027119
rattus norvegicus0.026876
10 years0.026178
dermal layer of tongue0.026008
depth (soil) 0-10cm0.025974
digestive system0.025856
greenhouse soil0.024677
leaf0.024671
Fraction of dbbact annotations with this term covered by the query
TermScore
spring6.000000
LOWER IN spring4.000000
LOWER IN crohn's disease2.000000
crohn's disease2.000000
adula1.000000
austin1.000000
colon1.000000
LOWER IN colon1.000000
municipality of beijing1.000000
heavy metal1.000000
nanjing city prefecture1.000000
shanxi province1.000000
deer1.000000
qilian county1.000000
moschus berezovskii1.000000
yuzhong county1.000000
moschus chrysogaster1.000000
LOWER IN yuzhong county1.000000
LOWER IN moschus chrysogaster1.000000
LOWER IN qilian county1.000000
LOWER IN moschus berezovskii1.000000
respirable suspended particulate matter1.000000
shengli oilfield1.000000
yellow river delta1.000000
citrus unshiu1.000000
constipation1.000000
LOWER IN constipation1.000000
sedum alfredii1.000000
bradybaena ravida1.000000
taihu national park1.000000
LOWER IN acute pancreatitis1.000000
LOWER IN pancreatitis1.000000
acute pancreatitis1.000000
pancreatitis1.000000
LOWER IN spinal cord injury1.000000
spinal cord injury1.000000
china0.994186
zhejiang province0.900000
hunan province0.857143
guangzhou city prefecture0.800000
mongolia0.800000
greenhouse soil0.750000
bos grunniens0.750000
hainan autonomous prefecture0.750000
litopenaeus vannamei0.750000
pacific white shrimp0.750000
fertilized soil0.750000
non-manured soil0.750000
npk fertilizer0.750000
sichuan province0.700000
rex rabbit0.666667
10 cm depth0.666667
low salt concentration0.666667
LOWER IN high salt concentration0.666667
high salt concentration0.666667
LOWER IN low salt concentration0.666667
shanghai proper0.666667
anser cygnoides0.666667
tibetan plateau0.666667
yak0.666667
rice field0.666667
mud0.666667
fermentation pit mud0.666667
ph 7.850.666667
serofluid dish0.666667
jiangshui0.666667
non-fertilized soil0.666667
LOWER IN non-fertilized soil0.666667
LOWER IN without biochar0.666667
without biochar0.666667
ph 7.60.666667
shanghai district0.666667
northeast china0.666667
pika0.666667
yunnan province0.666667
black soil0.666667
chemical fertilization n,p,k0.666667
high fusarium cumulative disease incidence 0.666667
low fusarium cumulative disease incidence 0.666667
trichoderma guizhouense njau 47420.666667
LOWER IN chemical fertilization n,p,k0.666667
LOWER IN high fusarium cumulative disease incidence 0.666667
LOWER IN low fusarium cumulative disease incidence 0.666667
mouth neoplasm0.666667
LOWER IN mouth neoplasm0.666667
nanchang city prefecture0.666667
chronic periodontitis0.666667
manured soil0.666667
dalian city prefecture0.666667
two weeks0.666667
luancheng county0.666667
fusarium oxysporum0.666667
bio-organic fertilizer0.666667
loess plateau0.666667
hong kong0.666667
tibet autonomous region0.666667
ph 90.666667
hen0.666667
depth 20-40cm0.666667
depth 10-20cm0.666667
Fraction of annotations for the query sequences containing the term
TermScore
china0.956989
soil0.353943
homo sapiens0.222222
feces0.206989
adult0.173835
research facility0.118280
rhizosphere0.091398
control0.078853
farm0.066308
depth (soil) 0-20cm0.064516
zhejiang province0.052867
rumen0.046595
LOWER IN control0.043011
silt loam0.043011
loess plateau0.043011
shaanxi province0.041219
female0.039427
jiangsu province0.038530
triticum aestivum0.038530
intestine0.035842
marine sediment0.034050
hunan province0.033154
saliva0.033154
agricultural field0.031362
reforestation0.029570
robinia pseudoacacia0.029570
mangrove swamp0.026882
sediment0.026882
caecum0.025986
winter0.025986
zea mays0.025986
cultivated environment0.025986
ph 7-80.025090
guangzhou city prefecture0.025090
fertilized soil0.025090
agricultural feature0.025090
water0.024194
sprague dawley0.023297
grazing exclusion0.023297
haplic calcisol0.023297
calci-orthic aridisol0.023297
ningxia province0.023297
yunwushan national natural grassland protection zone0.023297
oryza sativa0.022401
sichuan province0.021505
rat0.021505
municipality of beijing0.021505
jiangxi province0.021505
luancheng county0.021505
songnen plain0.021505
da'an station0.021505
salic solonetz0.021505
biochar0.020609
gallus gallus0.019713
wheat0.019713
nanjing city prefecture0.019713
child0.018817
chicken0.017921
rumen liquid0.017921
city0.017921
clay loam0.017921
tongue0.017025
topsoil0.017025
tibetan plateau0.017025
paddy field soil0.017025
shanghai proper0.016129
ruminal fluid0.016129
captive0.016129
black soil0.016129
fresh water0.016129
male0.015233
subgingival plaque0.015233
subgingival dental plaque0.015233
mongolia0.015233
sus scrofa0.015233
pig0.015233
fourth decade human stage0.015233
periodontitis0.015233
depth (soil) 50cm0.015233
glycine max0.015233
ph 90.015233
digestive system0.014337
hainan autonomous prefecture0.014337
rattus norvegicus0.014337
bulk soil0.014337
ph 7.60.014337
ovis aries0.014337
ochotonidae0.014337
pika0.014337
pot expreiment0.014337
heavy metal0.014337
ph 70.014337
shandong province0.014337
deer0.014337
heilongjiang province0.014337
dermal layer of tongue0.013441
leaf0.013441
depth (soil) 0-10cm0.013441
10 years0.013441
greenhouse soil0.012545
Exp. ID User ID Description Date Region Flag Sequences
59amnon high in united states of america australia state of texas malaysia seoul compared to china in digestive system apis mellifera 2017-02-02v4No1 / 1
571amnondominant mangrove swamp, soil, marine sediment, guangdong province, mudflat, china, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v4No1 / 1
112amnonStrongly higher in zebrafish treated with BPA or estradiol ( high in estradiol bisphenol a compared to control in research facility intestine danio rerio zebra fish china )2017-04-09v4No1 / 1
155amnonhigh freq in soil loosely bound to wheat root (dominant soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 1
155amnonhigh freq in bulk soil in wheat field (dominant soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 1
156amnonchloroplast (brassica) (other leaf, brassica, china)2017-07-02v4No1 / 1
164amnondominant laodelphax striatellus, small brown planthopper, china2017-07-13v4No1 / 1
175amnonhigh freq in heavy metal contaminated soils in china (dominant soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 1
296amnonhigh freq. in wheat field soil (dominant agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 1
809amnondominant research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1
412amnondominant soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 1
421amnondominant soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1
444amnonhigh freq. in uncultivated soil plot (dominant soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 1
571amnondominant mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 2
571amnondominant mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 2
604amnon high in bronchitis infectious bronchitis virus compared to control in research facility caecum gallus gallus chicken cecal content china 2020-04-06v3No1 / 2
85amnonhigher in shrimps exposed to sulfide compared to controls ( high in sulfide compared to control in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v4No1 / 2
90amnondecreases during douchi fermentation ( high in timepoint early timepoint compared to late timepoint in douchi food (fermented) china )2017-03-08v4No1 / 2
616amnondominant in topsoil of PK/NP/NPK/NK fertilized sugarcane field (dominant china, soil, fertilized soil, topsoil, guangzhou city prefecture, saccharum, sugarcane, ph 5.5-6, depth (soil) 0-20cm)2020-04-27v3No1 / 2
155amnonhigh freq in soil tightly bound to wheat root (dominant soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 2
694amnon high in control compared to polycystic ovary syndrome in feces homo sapiens female obesity adult china shanghai district 2028-03-17v3No1 / 2
725amnon high in control compared to periodontitis acute pericementitis in homo sapiens mouth mucosa adult buccal mucosa china municipality of beijing 2021-01-03v3No1 / 2
271amnondominant soil, china, depth (soil) 0-20cm2018-01-09v4No1 / 2
824sheryoDominant in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (dominant soil, depth (soil) 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 2
837sheryoDominant in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (dominant soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 2
849amnon high in multiple sclerosis multiple sclerosis compared to control in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 2
422amnondominant soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 2
422amnondominant soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 2
439amnonpresent only in abomasum in yak rumen ( high in abomasum compared to ruminant reticulum omasum in farm rumen bos grunniens yak china )2018-12-31v4No1 / 2
40amnonhigher in soil susceptible to tobacco bacterial wilt disease ( high in disease compared to control in soil field soil rhizosphere nicotiana tabacum china )2016-12-09v4No1 / 3
561amnondominant rumen, tibetan plateau, bos grunniens, yak, ruminal fluid, china, alpine meadow2019-11-05v3No1 / 3
571amnondominant mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, rhizophora stylosa, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 3
571amnondominant mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 3
571amnondominant mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 3
90amnondominant koji, food (fermented), china2017-03-08v4No1 / 3
631sheryodominant in maize field unamended bulk soil (dominant soil, bulk soil, maize field, china, guizhou province, kaiyang county, unamended soil, ph 7.9)2020-06-02v3No1 / 3
631sheryodominant in maize field biochar amended bulk soil, after 6 years of biochar amended (dominant soil, bulk soil, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 8)2020-06-02v3No1 / 3
223amnon high in other regions compared to sanmen bay in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 3
725amnon high in control compared to periodontitis acute pericementitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 3
760sheryoDominant in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (dominant soil, manured soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, ph 5.9, manure fertilization)2021-04-06v4No1 / 3
760sheryoDominant in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (dominant soil, rhizosphere, oryza sativa, hunan province, npk fertilizer, china, qiyang county, quaternary red clay, ph 5.9, npk fertilization)2021-04-06v4No1 / 3
296amnondominant agricultural feature, soil, winter, wheat, north china plain, ph>8, china, depth (soil) 0-20cm2018-02-11v4No1 / 3
296amnondominant agricultural feature, soil, winter, wheat, north china plain, ph>7, ph<8, china, depth (soil) 0-20cm2018-02-11v4No1 / 3
315amnonlower in captive grown compared to wild frogs ( high in wild compared to research facility in digestive system colon jiangxi province hunan province frog quasipaa spinosa giant spiny frog china )2018-04-10v4No1 / 3
800amnondominant 7-18 days following heavy metal contamination (dominant lake, sediment, fresh water, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm, spring)2021-06-15v4No1 / 3
809amnondominant research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 3
824sheryoDomionant in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (dominant soil, depth (soil) 0-10cm, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 3
828sheryoDominant in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (dominant soil, jiangsu province, depth (soil) 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 3
837sheryoDominant in agricultural field at depths 0-40cm, shaanxi, China (dominant soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 0-40cm)2021-09-26v4No1 / 3
837sheryoDominant in soil at 40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (dominant soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 3
837sheryoDominant in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (dominant soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 3
444amnondominant farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 3
478amnondominant farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 3
894amnon high in plant disease diaporthe citri compared to control in orchard leaf zhejiang province citrus endosphere china citrus unshiu 2022-04-11v4No1 / 3
555amnon high in autistic disorder autism compared to control in homo sapiens dentition child shanghai proper supragingival plaque age 7-14 years china 2019-09-10v3No1 / 4
571amnondominant mangrove swamp, soil, marine sediment, spartina alterniflora, guangdong province, china, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 4
571amnondominant mangrove swamp, soil, marine sediment, zhejiang province, mudflat, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 4
571amnondominant mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 4
571amnondominant mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, kandelia candel, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 4
597amnon high in gout compared to control in feces homo sapiens adult zhejiang province china 2020-03-23v3No1 / 4
597amnon high in control compared to gout in feces homo sapiens adult zhejiang province china 2020-03-23v3No1 / 4
608sheryoDominant in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (dominant soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 4
631sheryoDominant in maize field biochar amended rhizosphere soil (dominant soil, rhizosphere, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 7.85)2020-06-02v3No1 / 4
134amnondominant rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 4
686sheryoDominant in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (dominant wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 4
686sheryoDominant in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (dominant wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 4
686sheryoDominant in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (dominant wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 4
204amnondominant drinking water reservoir, sediment, water, china2017-10-02v4No1 / 4
716amnon high in halitosis chronic bad breath compared to control in homo sapiens tongue adult dermal layer of tongue china 2028-05-22v3No1 / 4
269amnonhigh freq. in fresh yao meat food (dominant foodon product type, china)2018-01-09v4No1 / 4
760sheryoDominant in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (dominant soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, no fertilization, ph 5.9)2021-04-06v4No1 / 4
296amnondominant agricultural feature, soil, winter, wheat, north china plain, ph>6, ph<7, china, depth (soil) 0-20cm2018-02-11v4No1 / 4
791sheryoDominant at 0cm depth in low saline low sodicity soil in China (dominant soil, depth 0cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, depth (soil) 0-20cm)2021-06-08v4No1 / 4
824sheryoDominant in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (dominant soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 4
837sheryoDominant in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (dominant soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 4
837sheryoDominant in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (dominant soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 4
420amnonhigh freq. in soil of vegetable open field (dominant agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 4
420amnonhigh freq. in soil of vegetables in organic plastic tunnel (dominant agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 4
908amnondominant feces, research facility, equus caballus, horse, adult organism, china, shanxi province, guanzhong horse2022-05-19v4No1 / 4
3amnonHigher in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in chronic gastritis compared to in homo sapiens tongue china )2016-10-06v4No1 / 5
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 5
571amnondominant mangrove swamp, soil, marine sediment, mudflat, china, hainan autonomous prefecture, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 5
608sheryoDominant in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (dominant soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 5
624sheryodominant in ryegrass rhizosphere soil amended with biochar after 30-40 days (dominant soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments amended with biochar (dominant soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments unamended with biochar (dominant soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 5
628sheryodominant in bulk soil with barley plants after 180 days in treatments amended with biochar (dominant soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 5
296amnondominant agricultural feature, soil, winter, wheat, north china plain, ph>5, ph<6, china, depth (soil) 0-20cm2018-02-11v4No1 / 5
765sheryoDominant in wheat field in the loess plateau in china (dominant soil, triticum aestivum, silt loam, china, shanxi province, loess plateau, chromic cambisol, ph 7.7)2021-04-12v3No1 / 5
771amnondominant body proper, whole body, china, aphis gossypii, cotton aphid2021-04-21v3No1 / 5
779amnon high in ulcerative colitis compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 5
791sheryoDominant at 20cm depth in low saline low sodicity soil in China (dominant soil, depth 20cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, ph 9)2021-06-08v4No1 / 5
791sheryoDominant at 80cm depth in low saline low sodicity soil in China (dominant soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 80cm)2021-06-08v4No1 / 5
824sheryoDominant in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (dominant soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 10-20cm)2021-08-08v4No1 / 5
828sheryoDominant in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (dominant soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 5
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens periodontitis adult subgingival plaque subgingival dental plaque chronic periodontitis china municipality of shanghai 2021-09-11v3No1 / 5
837sheryoDominant in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (dominant soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 10 years)2021-09-26v4No1 / 5
837sheryoDominant in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (dominant soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 5
414amnondominant agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph>6, black soil, mollisol, china2018-11-26v4No1 / 5
420amnonhigh freq. in soil of vegetable in plastic tunnel (dominant agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 5
512amnondominant peatland, fen, soil, peat soil, baekdudaegan, ph 5-6, hani peatland, china2019-03-22v4No1 / 5
894amnon high in control compared to plant disease diaporthe citri in orchard leaf zhejiang province citrus leaf surface china citrus unshiu 2022-04-11v4No1 / 5
894amnon high in plant disease diaporthe citri compared to control in orchard leaf zhejiang province citrus leaf surface china citrus unshiu 2022-04-11v4No1 / 5
519amnon high in control compared to dental caries in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 5
34amnonhigh freq. in mangrove rhizosphere (dominant mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 6
571amnondominant mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 6
616amnondominant in topsoil of non-fertilized sugarcane field (dominant china, soil, topsoil, guangzhou city prefecture, non-fertilized soil, saccharum, sugarcane, ph 6.7, depth (soil) 0-20cm)2020-04-27v3No1 / 6
628sheryodominant in bulk soil with barley plants after 180 days in treatments unamended with biochar (dominant soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 6
631sheryodominant in maize field unamended rhizosphere soil (dominant soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 6
112amnondominant research facility, intestine, danio rerio, zebra fish, china2017-04-09v4No1 / 6
279amnondominant grassland, leaf, stem, tibetan plateau, kobresia humilis, china2018-01-24v4No1 / 6
156amnondominant soil, rhizosphere, brassica oleracea, brassica, china2017-07-27v4No1 / 6
156amnondominant leaf, brassica oleracea, brassica, phyllosphere, china2017-07-27v4No1 / 6
686sheryoDominant in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (dominant wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 6
202amnon high in control compared to neoplasm mouth neoplasm cancer in homo sapiens oral cavity mouth mucosa mouth china 2017-10-01v4No1 / 6
725amnon high in control compared to periodontitis chronic periodontitis in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 6
257amnonhigh freq. in tilapia pond sediment (dominant pond, fishpond, sediment, freshwater sediment metagenome, tilapia, china)2017-11-26v4No1 / 6
754sheryoDominant in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (dominant soil, zhejiang province, cucumber, fusarium oxysporum, china, bio-organic fertilizer, bacillus amyloliquefaciens sqr9)2021-03-15v3No1 / 6
296amnondominant agricultural feature, soil, winter, wheat, north china plain, ph>4, ph<5, china, depth (soil) 0-20cm2018-02-11v4No1 / 6
792amnondominant desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, haloxylon ammodendron, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 6
791sheryoDominant at 40cm depth in low saline low sodicity soil in China (dominant soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 40cm)2021-06-08v4No1 / 6
795amnoncommon research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 6
837sheryoDominant in agricultural field at depths 100-300cm, shaanxi, China (dominant soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 100-300cm)2021-09-26v4No1 / 6
856amnon high in control compared to ulcerative colitis ulcerative colitis in homo sapiens rectum adult biopsy intestinal mucosa china human adult stage 2022-01-09v3No1 / 6
414amnondominant agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph<6, black soil, mollisol, npk fertilizer, china2018-11-26v4No1 / 6
883amnondominant soil, oil contaminated soil, shengli oilfield, china, yellow river delta, oilfield2022-03-20v4No1 / 6
420amnonhigh freq. in soil of vegetables in organic field (dominant agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 6
444amnondominant farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 6
571amnondominant mangrove swamp, soil, marine sediment, spartina alterniflora, china, hainan autonomous prefecture, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 7
572amnon high in control compared to liver carcinoma in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 7
667amnondominant soil, topsoil, jiangxi province, ph 4.5, forested area, china, elevation 200-300m, lushan mountain, depth (soil) 0-20cm2020-09-25v4No1 / 7
755sheryodominant in wild rice (Oryza rufipogon) rhizosphere (dominant soil, rhizosphere, ph 7, black soil, oryza rufipogon, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 7
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (dominant soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 7
792amnondominant desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, nitraria tangutorum, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 7
824sheryoDominant in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (dominant soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 20-40cm)2021-08-08v4No1 / 7
825amnon high in control compared to type i diabetes mellitus type 1 diabetes mellitus in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v3No1 / 7
415amnondominant orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 7
454amnondominant feces, captive, elaphurus davidianus, pere deer, deer, china2019-01-10v4No1 / 7
478amnondominant farm, sediment, shrimp farm, china2019-02-19v4No1 / 7
531amnondominant farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 8
90amnonincreases during koji preparation ( high in timepoint late timepoint compared to early timepoint in koji food (fermented) china )2017-03-08v4No1 / 8
115amnondominant freshwater river biome, intestine, yangtze river, coreius guichenoti, largemouth bronze gudgeon, fish, china2017-04-10v4No1 / 8
134amnondominant rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 8
279amnondominant grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 8
667amnondominant soil, topsoil, jiangxi province, ph 4.5, forested area, china, lushan mountain, elevation 800-900m, depth (soil) 0-20cm2020-09-25v4No1 / 8
667amnondominant soil, topsoil, jiangxi province, ph 4, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m, depth (soil) 0-20cm2020-09-25v4No1 / 8
687amnondominant research facility, rumen, bos taurus, rumen liquid, shandong province, china, chinese bohai black beef cattle2028-03-09v4No1 / 8
701amnondominant research facility, rumen, bos taurus, male, cow, rumen liquid, male organism, china, municipality of beijing, age 2 years2028-04-01v3No1 / 8
223amnondominant ocean, sediment, marine sediment, east china sea, china2017-10-26v4No1 / 8
259amnonhigh freq. in soil and rhizpsphere of peanut plants (dominant soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 8
735amnondominant control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 8
792amnondominant desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 8
819amnondominant homo sapiens, female, skin, adult, scalp, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 8
824sheryoDominant in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (dominant soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 20-40cm)2021-08-08v4No1 / 8
837sheryoDominant in agricultural field at depths 40-100cm, shaanxi, China (dominant soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 40-100cm)2021-09-26v4No1 / 8
837sheryoDominant in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (dominant soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 10 years)2021-09-26v4No1 / 8
855sheryoDopminant in soil depth of 10cm in fertilized soil in china (dominant soil, fertilized soil, depth (water) 10cm, agricultural field, china, luancheng county)2021-12-27v3No1 / 8
417amnondominant feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 8
454amnondominant feces, wild, elaphurus davidianus, pere deer, deer, china2019-01-10v4No1 / 8
463amnondominant research facility, intestine, portunus trituberculatus, horse crab, china2019-01-13v4No1 / 8
512amnondominant peatland, fen, soil, peat soil, tibetan plateau, riganqiao peatland, ph 5.5-6.5, china2019-03-22v4No1 / 8
40amnonhigher in soil protective from tobacco bacterial wilt disease ( high in control compared to disease in soil field soil rhizosphere nicotiana tabacum china )2016-12-09v4No1 / 9
572amnon high in control compared to pancreatic cancer in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 9
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended with biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole)2020-04-21v4No1 / 9
91amnondominant serofluid dish, jiangshui, food (fermented), china2017-03-08v4No1 / 9
624sheryodominant in ryegrass rhizosphere soil after 30-40 days (dominant soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 9
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide and biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 9
163amnondominant stomach, ochotonidae, pika, ochotona dauurica, mongolia grassland, china2017-07-13v4No1 / 9
675sheryoDominant in watermelon rhizosphere soil inucolated with Fusarium oxysporum f. sp. niveum (dominant rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 9
675sheryoDominant in watermelon rhizosphere soil (dominant rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), un-inoculated)2028-02-22v4No1 / 9
783sheryodominant in desert soil in mongolia under water addition treatment (dominant soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 9
687amnondominant research facility, rumen, bos taurus, rumen liquid, shandong province, china, chinese luxi yellow beef cattle2028-03-09v4No1 / 9
245amnondominant homo sapiens, breast milk, china2017-11-21v4No1 / 9
742amnondominant feces, zoological garden, bird, captive, china, dalian city prefecture, pygoscelis papua, gentoo penguin2021-02-18v3No1 / 9
741amnondominant research facility, intestine, china, planorbella trivolvis, ram's horn snail, pellet feed diet2021-02-17v3No1 / 9
271amnondominant rhizosphere, glycine max, soybean, china, depth (soil) 0-20cm2018-01-09v4No1 / 9
752sheryoDominant in soil planted with Panax notoginseng amended with 2% biochar (dominant soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 9
775amnon high in control compared to lichen planus in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 9
819amnondominant homo sapiens, female, skin, adult, scalp, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 9
819amnondominant homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 9
828sheryoDominant in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (dominant soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 9
837sheryoDominant in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (dominant soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 10 years)2021-09-26v4No1 / 9
391amnoncommon feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 9
863amnondominant feces, farm, captive, deer, china, qilian county, moschus berezovskii, forest musk deer2022-01-28v4No1 / 9
894amnon high in control compared to plant disease diaporthe citri in orchard leaf zhejiang province citrus endosphere china citrus unshiu 2022-04-11v4No1 / 9
421amnonhigh freq. in paddy field soil incubated without copper (dominant research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 9
521amnonhigh freq. in weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 9
3amnonLower in chronic erosive gastritis patients with yellow tongue comapred to healthy controls ( high in control compared to chronic gastritis in homo sapiens tongue china )2016-10-06v4No1 / 10
530amnondominant feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 10
603amnondominant in baijiu fermentation pit mud in first 2 batches (dominant mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 10
687amnon high in chinese bohai black beef cattle compared to chinese luxi yellow beef cattle in research facility rumen bos taurus rumen liquid shandong province china 2028-03-09v4No1 / 10
735amnondominant female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 10
746sheryoDominant in saline soil in dafeng, china (dominant jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 10
279amnondominant caecum, colon, ochotonidae, pika, china2018-01-24v4No1 / 10
780amnondominant research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 10
791sheryoDominant in highly saline sodic soil at 0cm depth in China (dominant soil, depth 0cm, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10.5, depth (soil) 0-20cm)2021-06-07v4No1 / 10
359amnondominant soil, subtropical broadleaf forest biome, topsoil, guangdong province, depth (soil) 0-10cm, woodland area, forest ecosystem, china2018-08-19v4No1 / 10
824sheryoDominant in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (dominant soil, china, depth 40-60cm, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 10
828sheryoDominant in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (dominant soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 10
828sheryoDominant in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (dominant soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 10
899amnoncommon in snail intestine from heavy metal contaminated greenhouse (dominant intestine, zhejiang province, heavy metal, greenhouse, sedum alfredii, china, bradybaena ravida, land snail, heavy metal contaminated soil)2022-04-25v3No1 / 10
519amnon high in dental caries compared to control in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 10
547amnondominant capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 11
585amnon high in intestine stomach compared to buccal mass in china qingpu district pomacea canaliculata golden apple snail nanheng river 2020-02-02v3No1 / 11
590amnondominant farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 11
115amnonhigher in medium and large size fish compared to small size ( high in large size medium size compared to small size in freshwater river biome intestine yangtze river coreius guichenoti largemouth bronze gudgeon fish china )2017-04-10v4No1 / 11
202amnon high in neoplasm mouth neoplasm cancer compared to control in homo sapiens oral cavity mouth mucosa mouth china 2017-10-01v4No1 / 11
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 11
264amnondominant research facility, caecum, oryctolagus cuniculus, rex rabbit, jiangsu province, china2017-12-11v4No1 / 11
737amnondominant research facility, rumen, age 2 months, ruminal fluid, capra hircus, china, hainan autonomous prefecture, goat, hainan black goat2021-01-27v3No1 / 11
269amnonincreases during one month in refrigeration of yao meat ( high in late timepoint food spoilage compared to early timepoint fresh in foodon product type china )2018-01-09v4No1 / 11
279amnondominant grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 11
755sheryodominant in domesticated rice (Oryza stavia) rhizosphere (dominant soil, rhizosphere, oryza sativa, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 11
767sheryoDominant in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (dominant soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 11
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (dominant soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet)2021-04-14v4No1 / 11
787amnondominant control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 11
819amnon high in dalian city prefecture low atmospheric pollution compared to baoding city prefecture high atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 11
819amnondominant homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 11
824sheryoDominant in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (dominant soil, china, depth 40-60cm, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 11
370amnondominant desert, air, gobi desert2018-09-06v4No1 / 11
783sheryodominant in desert soil in mongolia without water addition treatment (dominant soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 11
391amnondominant feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 11
849amnon high in control compared to multiple sclerosis multiple sclerosis in feces homo sapiens adult zhejiang province china fourth decade human stage 2021-12-14v3No1 / 11
863amnondominant feces, farm, captive, deer, china, yuzhong county, moschus chrysogaster, alpine musk deer, xinglong mountain national nature reserve2022-01-28v4No1 / 11
412amnondominant soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph<5, china2018-11-26v4No1 / 11
444amnon high in spring compared to winter in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china 2019-01-07v4No1 / 11
444amnon high in winter compared to spring in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china 2019-01-07v4No1 / 11
475amnonhigh freq. in air in subway train in hong kong (dominant city, air, hong kong, subway)2019-01-20v4No1 / 11
478amnondominant farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 11
513amnondominant city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 11
27amnondominant rumen, bos grunniens, china2016-12-05v4No1 / 12
50amnonhigh freq. in mitten crab intestine (dominant intestine, eriocheir sinensis, china)2017-01-19v4No1 / 12
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and without biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole)2020-04-21v4No1 / 12
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 12
134amnondominant rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 12
657amnondominant research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 12
279amnondominant grassland, steppe, leaf, stem, mongolia, china2018-01-24v4No1 / 12
163amnondominant stomach, ochotonidae, pika, mongolia grassland, ochotona curzoniae, china2017-07-13v4No1 / 12
667amnondominant soil, topsoil, jiangxi province, ph 4.5, forested area, china, lushan mountain, elevation 500-600m, depth (soil) 0-20cm2020-09-25v4No1 / 12
750sheryoDominant in soil of wheat field in China (dominant soil, triticum aestivum, china, hebei province, luancheng county, ph 7.6, fluvo-aquic soil)2021-03-11v3No1 / 12
279amnondominant stomach, small intestine, ochotonidae, pika, china2018-01-24v4No1 / 12
767sheryoDominant in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (dominant soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 12
815amnon high in vulpes vulpes red fox compared to vulpes corsac corsac fox in feces mongolia winter wild lake hulun 2021-07-04v3No1 / 12
370amnoncommon desert, air, gobi desert2018-09-06v4No1 / 12
840amnondominant farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 12
855sheryoDominant in soil depth of 75cm in fertilized soil in china (dominant soil, fertilized soil, agricultural field, china, luancheng county, depth 75cm)2021-12-27v3No1 / 12
858amnondominant two weeks, low salt concentration, fermented vegetable food product, china, fermneted chinese cabbage, suan cai, 0%-1% salt concentration2022-01-11v4No1 / 12
424amnondominant feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 12
504amnondominant sediment, marine sediment, nan'ao island, china2019-03-14v4No1 / 12
530amnondominant feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 13
555amnon high in autistic disorder autism compared to control in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v3No1 / 13
585amnon high in buccal mass compared to intestine stomach in china qingpu district pomacea canaliculata golden apple snail nanheng river 2020-02-02v3No1 / 13
604amnondominant research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide and biochar (dominant soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 13
111amnondominant rectum, caecum, colon, ileum, ovis aries, mongolian sheep, china2017-04-09v4No1 / 13
160amnonhigh freq. in river water upstream of WTP effluent in spring in china (dominant river, water, china, spring)2017-07-12v4No1 / 13
165amnonhigh freq. in house fly larva grown on moist wheat bran (dominant digestive system, research facility, larval stage, musca domestica, house fly, china)2017-07-16v4No1 / 13
667amnondominant soil, topsoil, jiangxi province, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.5, depth (soil) 0-20cm2020-09-25v4No1 / 13
675sheryoHigher in watermelon rhizosphere soil uninoculated compared to watermelon rhizosphere soil inoculated with fusarium oxysporum f. sp. niveum ( high in un-inoculated compared to inoculated with fusarium oxysporum f. sp. niveum in rhizosphere ph 7 citrullus lanatus china co culture with wheat (triticum aestivum l.) )2028-02-22v4No1 / 13
725amnondominant homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 13
751sheryoDominant in tomato soil infected with Fusarium oxysporum (dominant soil, solanum lycopersicum, fusarium oxysporum, shandong province, china, luojiazhuang)2021-03-11v3No1 / 13
752sheryoDominant in soil planted with Panax notoginseng (dominant soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 13
315amnonhigh freq. in frog gut (dominant digestive system, colon, jiangxi province, hunan province, frog, quasipaa spinosa, giant spiny frog, china)2018-04-10v4No1 / 13
315amnonhigh freq. in frog pond water (dominant pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 13
795amnoncommon research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 13
825amnon high in type i diabetes mellitus type 1 diabetes mellitus compared to control in feces homo sapiens child china hangzhou city prefecture age 6-14 years 2021-08-12v3No1 / 13
400amnonhigh freq. in hmong (chinese) females from thailand (dominant feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 13
894amnondominant orchard, leaf, zhejiang province, citrus, endosphere, china, citrus unshiu2022-04-11v4No1 / 13
421amnonhigh freq. in paddy field soil incubated with copper (dominant research facility, soil, paddy field soil, copper, zhejiang province, china)2018-12-02v4No1 / 13
530amnondominant feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 14
547amnon high in low salt concentration compared to high salt concentration in capsicum annuum sichuan province red pepper sauce food (fermented) china 2019-08-15v4No1 / 14
579amnonhigh freq. in pond water of mud crab aquaculture (dominant fish farm, saline water, summer, autumn, saline water aquarium, scylla paramamosain, china, pond, mud crab)2020-01-14v3No1 / 14
585amnondominant intestine, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 14
585amnondominant stomach, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 14
115amnonlower in medium and large size fish compared to small size ( high in small size compared to large size medium size in freshwater river biome intestine yangtze river coreius guichenoti largemouth bronze gudgeon fish china )2017-04-10v4No1 / 14
657amnonnegatively correlated with age ( high in younger age compared to age older age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 14
164amnoncommon laodelphax striatellus, small brown planthopper, china2017-07-13v4No1 / 14
168amnonhigh freq. in mud from chinese liquor fermentation pit (dominant mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 14
687amnondominant research facility, rumen, bos taurus, rumen liquid, shandong province, china, holstein dairy cow2028-03-09v4No1 / 14
250amnonhigh freq. in bamboo forest soil (dominant soil, ph 4, bamboo, phyllostachys pubescens, depth (soil) 0-10cm, woodland area, china)2017-11-22v4No1 / 14
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 14
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 14
746sheryoDominant in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (dominant solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, trichoderma guizhouense njau 4742, saline soil, ph 7.5, biological fertilization, chicken manure)2021-03-03v4No1 / 14
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (dominant soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 14
812amnondominant feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 14
382amnondominant hot spring, geothermal field, water, ganzi tibetan autonomous prefecture, high temperature environment, china2018-10-22v4No1 / 14
402amnondominant mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 2,3, china2018-11-18v4No1 / 14
862amnondominant feces, qinghai province, bird, china, gyps himalayensis, himalayan griffon2022-01-20v4No1 / 14
865amnon high in canis lupus wolf compared to canis lupus familiaris dog in feces china 2022-02-08v3No1 / 14
438amnondominant feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 14
475amnonhigh freq. in air next to subway stations in hong kong (dominant city, air, hong kong)2019-01-20v4No1 / 14
506amnondominant soil, peat soil, northeast china, depth (soil) 0-10cm, boreal wetland, seasonal frozen marsh, wetland area, china2019-03-16v4No1 / 14
25amnon high in compared to in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 15
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 15
64amnondominant homo sapiens, saliva, sichuan province2017-02-16v4No1 / 15
160amnonhigh freq. in wastewater treatment plant effluent in spring in china (dominant wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 15
687amnondominant research facility, rumen, rumen liquid, capra hircus, shandong province, china, goat, chinese laoshan milk goat2028-03-09v4No1 / 15
707amnon high in systemic lupus erythematosus compared to control in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 15
245amnoncommon homo sapiens, breast milk, china2017-11-21v4No1 / 15
741amnon high in pellet feed diet compared to alfalfa diet in research facility intestine china planorbella trivolvis ram's horn snail 2021-02-17v3No1 / 15
279amnondominant ochotonidae, pika, mouth, china2018-01-24v4No1 / 15
779amnon high in crohn's disease compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 15
787amnoncommon in high grain diet induced subacute acidosis (dominant research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 15
336amnondominant feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 15
815amnon high in vulpes corsac corsac fox compared to vulpes vulpes red fox in feces mongolia winter wild lake hulun 2021-07-04v3No1 / 15
819amnoncommon homo sapiens, female, skin, adult, scalp, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 15
373amnondominant rice field, soil, rhizosphere, oryza sativa, hunan province, rice, china2018-09-08v4No1 / 15
380amnondominant feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 15
402amnondominant mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 1, china2018-11-18v4No1 / 15
860amnondominant research facility, intestine, anas platyrhynchos, intestinal contents, china, duck2022-01-12v3No1 / 15
524amnondominant homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 15
36amnonhigher in adults compared to centenarians ( high in adult compared to centenerians in feces homo sapiens sichuan province )2016-12-06v4No1 / 16
50amnoncommon in mitten crab gills (dominant gill, eriocheir sinensis, china)2017-01-19v4No1 / 16
584amnondominant feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 16
585amnondominant china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river, buccal mass2020-02-02v3No1 / 16
590amnoncommon in turtle pond water (dominant farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 16
604amnon high in control compared to bronchitis infectious bronchitis virus in research facility caecum gallus gallus chicken cecal content china 2020-04-06v3No1 / 16
85amnondominant digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 16
652amnondominant homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 16
725amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 16
753amnondominant feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 16
314amnondominant farm, caecum, tibet autonomous region, cecal content, tibetan pig, tibetan swine, china2018-04-10v4No1 / 16
800amnondominant 100-250 days following heavy metal contamination (dominant lake, sediment, fresh water, summer, autumn, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm)2021-06-15v4No1 / 16
878amnondominant city, air, respirable suspended particulate matter, china, municipality of beijing, pm102022-03-11v3No1 / 16
904amnondominant research facility, caecum, gallus gallus, chicken, china, hen, jinghong-1, age 42 weeks2022-05-18v3No1 / 16
519amnondominant homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 16
590amnondominant farm, intestine, neonate stage, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm, age 0 days2020-02-10v4No1 / 17
90amnondominant douchi, food (fermented), china2017-03-08v4No1 / 17
116amnondominant research facility, intestine, litopenaeus vannamei, south china sea, pacific white shrimp, china2017-04-10v4No1 / 17
640amnondominant homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 17
661amnondominant farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 17
688amnondominant feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 17
725amnondominant homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 17
290amnondominant feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 17
775amnondominant homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 17
849amnondominant feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 17
428amnondominant feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 17
36amnondominant feces, homo sapiens, sichuan province2016-12-06v4No1 / 18
555amnondominant homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 18
561amnon high in winter withered grass diet compared to green stage diet spring in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 18
627amnondominant feces, female, pregnancy, adult, china2020-05-16v3No1 / 18
111amnondominant ruminant reticulum, omasum, rumen, ovis aries, mongolian sheep, china2017-04-09v4No1 / 18
716amnondominant homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 18
746sheryoDominant in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (dominant solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, chemical fertilization n,p,k, saline soil, ph 7.5)2021-03-03v4No1 / 18
774amnondominant homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 18
780amnondominant research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 18
795amnondominant research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 18
865amnondominant feces, canis lupus familiaris, dog, china, inner mongolia autonomous region2022-02-08v3No1 / 18
419amnondominant feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 18
899amnoncommon in snail intestine from phytoremedation field (dominant intestine, zhejiang province, heavy metal, field, sedum alfredii, china, bradybaena ravida, land snail, heavy metal contaminated soil, phytoremedation field)2022-04-25v3No1 / 18
428amnondominant feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 18
504amnondominant water, sea water, nan'ao island, china2019-03-14v4No1 / 18
894amnondominant orchard, leaf, zhejiang province, citrus, leaf surface, china, citrus unshiu2022-04-11v4No1 / 18
519amnondominant homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 18
555amnon high in control compared to autistic disorder autism in homo sapiens dentition child shanghai proper supragingival plaque age 7-14 years china 2019-09-10v3No1 / 19
555amnondominant homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 19
60amnondominant feces, anser cygnoides, china2017-02-03v4No1 / 19
115amnoncommon freshwater river biome, intestine, yangtze river, coreius guichenoti, largemouth bronze gudgeon, fish, china2017-04-10v4No1 / 19
637amnondominant feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 19
160amnonhigh freq. in river water upstream of WTP effluent in autumn in china (dominant river, water, autumn, china)2017-07-12v4No1 / 19
165amnonhigh freq. in moist wheat bran (dominant research facility, wheat bran, china)2017-07-16v4No1 / 19
216amnondominant feces, research facility, mus musculus, c57bl/6, male, mouse, china2017-10-24v4No1 / 19
725amnondominant homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 19
292amnondominant feces, homo sapiens, control, adult, china2018-02-05v4No1 / 19
299amnondominant homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 19
774amnondominant homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 19
795amnoncommon research facility, cloaca, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 19
836amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, oral lichen planus, china, municipality of shanghai, gingival erosive oral lichen planus2021-09-11v3No1 / 19
855sheryoDominant in soil depth of 350cm in fertilized soil in china (dominant soil, fertilized soil, agricultural field, china, luancheng county, depth 350cm)2021-12-27v3No1 / 19
855sheryoDominant in soil depth of 800cm in fertilized soil in china (dominant soil, fertilized soil, agricultural field, china, luancheng county, depth 800cm)2021-12-27v3No1 / 19
855sheryoDominant in soil depth of 1000cm in fertilized soil in china (dominant soil, fertilized soil, agricultural field, china, luancheng county, depth 1000cm)2021-12-27v3No1 / 19
438amnondominant feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 19
438amnondominant feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 19
451amnondominant serofluid dish, jiangshui, food (fermented), china2019-01-10v4No1 / 19
463amnoncommon research facility, intestine, portunus trituberculatus, horse crab, china2019-01-13v4No1 / 19
707amnon high in control compared to systemic lupus erythematosus in feces homo sapiens female adult guangzhou city prefecture china fourth decade human stage fifth decade human stage 2028-04-11v3No1 / 19
579amnonhigh freq. in pond water of mud crab aquaculture (dominant fish farm, saline water, saline water aquarium, scylla paramamosain, china, pond, mud crab, spring)2020-01-14v3No1 / 20
601amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens adult china 2020-03-30v4No1 / 20
160amnonhigh freq. in wastewater treatment plant effluent in autumn in china (dominant wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 20
697amnondominant female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 20
720amnondominant feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 20
271amnoncommon root structure, glycine max, soybean, root, root nodule, china, depth (soil) 0-20cm2018-01-09v4No1 / 20
281amnondominant cloaca, shinisaurus crocodilurus, crocodile lizard, china2018-01-25v4No1 / 20
286amnonhigh freq. in feces of individuals with kidney stones (dominant feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 20
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
292amnondominant feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 20
299amnonhigh freq. in healthy (non-tumor) controls (dominant homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 20
791sheryoDominant in highly saline sodic soil at 20cm depth in China (dominant soil, depth 20cm, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10.5)2021-06-07v4No1 / 20
333amnonhigh freq. in healthy controls feces (dominant feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 20
818amnondominant research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 20
836amnondominant homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of shanghai2021-09-11v3No1 / 20
855sheryoDominant in soil depth of 175cm in fertilized soil in china (dominant soil, fertilized soil, agricultural field, china, luancheng county, depth 175cm)2021-12-27v3No1 / 20
419amnonhigh freq. in rats with induced constipation (dominant feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 20
899amnonlower in snail intestine from phytoremedation field compared to greenhouse ( high in greenhouse compared to field phytoremedation field in intestine zhejiang province heavy metal sedum alfredii china bradybaena ravida land snail heavy metal contaminated soil )2022-04-25v3No1 / 20
439amnondominant farm, rumen, bos grunniens, yak, china2018-12-31v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 20
575amnonhigh freq. in professional martial arts athletes (dominant feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 21
581amnondominant in red swamp crayfish grown in flooded rice field (dominant rice field, intestine, adult, jiangsu province, fish, china, procambarus clarkii, red swamp crayfish)2020-01-21v3No1 / 21
597amnondominant feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 21
221amnondominant feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 21
223amnon high in other regions compared to hangzhou bay in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 21
716amnondominant homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 21
720amnondominant feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 21
254amnondominant river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 21
741amnondominant research facility, intestine, china, planorbella trivolvis, ram's horn snail, alfalfa diet2021-02-17v3No1 / 21
290amnon high in small village rural community compared to city in feces homo sapiens adult china 2018-02-01v4No1 / 21
779amnondominant feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 21
791sheryoDominant in highly saline sodic soil at 40cm depth in China (dominant soil, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10.5, depth (soil) 40cm)2021-06-07v4No1 / 21
791sheryoDominant in highly saline sodic soil at8 80cm depth in China (dominant soil, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10, depth (soil) 80cm)2021-06-07v4No1 / 21
825amnondominant feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 21
911amnon high in spinal cord injury compared to control in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v4No1 / 21
911amnondominant feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v4No1 / 21
442amnondominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 21
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 21
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 22
720amnon high in control compared to autoimmune hepatitis in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 22
286amnonhigh freq. in feces of individuals without kidney stones (dominant feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 22
779amnoncommon feces, homo sapiens, adult, guangzhou city prefecture, crohn's disease, china2021-04-28v4No1 / 22
779amnondominant feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 22
333amnonhigh freq. in stroke patient feces (dominant feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 22
795amnondominant research facility, gallus gallus, chicken, uterine tube infundibulum, adult organism, china, age 90 weeks2021-06-08v4No1 / 22
819amnoncommon homo sapiens, female, skin, adult, scalp, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 22
858amnondominant two weeks, high salt concentration, fermented vegetable food product, china, fermneted chinese cabbage, suan cai, 3%-5% salt concentration2022-01-11v4No1 / 22
865amnondominant feces, canis lupus, china, wolf2022-02-08v3No1 / 22
566amnon high in insomnia compared to control in feces homo sapiens adult china 2019-11-24v4No1 / 23
572amnon high in liver carcinoma compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 23
601amnondominant feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 23
603amnondominant in baijiu fermentation pit mud in later batches (dominant mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 23
694amnondominant feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 23
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
314amnondominant farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 23
795amnondominant research facility, vagina, gallus gallus, chicken, adult organism, china, age 90 weeks2021-06-08v4No1 / 23
856amnondominant homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 23
566amnondominant feces, homo sapiens, adult, china2019-11-24v4No1 / 24
597amnondominant feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 24
601amnon high in type 2 diabetes mellitus compared to control in feces homo sapiens adult china 2020-03-30v4No1 / 24
202amnondominant homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 24
753amnondominant feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 24
349amnondominant feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 24
815amnondominant feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 24
849amnondominant feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 24
59amnon high in united states of america austin compared to australia malaysia seoul china in digestive system apis mellifera 2017-02-02v4No1 / 25
572amnondominant homo sapiens, tongue, dermal layer of tongue, pancreatic cancer, china2019-12-16v3No1 / 25
640amnondominant homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 25
661amnondominant farm, intestine, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
856amnondominant homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 25
428amnoncommon feces, homo sapiens, adult, nanchang city prefecture, acute pancreatitis, pancreatitis, china2018-12-09v4No1 / 25
911amnondominant feces, homo sapiens, nanjing city prefecture, spinal cord injury, china, human adult stage2022-05-21v4No1 / 25
572amnondominant homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 26
572amnondominant homo sapiens, tongue, dermal layer of tongue, liver carcinoma, china2019-12-16v3No1 / 26
584amnondominant feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 26
899amnonhigh in snail intestine from phytoremedation field compared to greenhouse ( high in field phytoremedation field compared to greenhouse in intestine zhejiang province heavy metal sedum alfredii china bradybaena ravida land snail heavy metal contaminated soil )2022-04-25v3No1 / 26
438amnondominant feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 26
601amnondominant feces, homo sapiens, control, adult, china2020-03-30v4No1 / 27
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
438amnondominant feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 27
530amnondominant feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 28
741amnoncommon research facility, intestine, china, planorbella trivolvis, ram's horn snail, pellet feed diet2021-02-17v3No1 / 28
267amnoncommon digestive system, research facility, oreochromis niloticus, fish, china2017-12-24v4No1 / 28
779amnon high in control compared to ulcerative colitis in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 28
825amnondominant feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 28
862amnoncommon feces, qinghai province, bird, china, gyps himalayensis, himalayan griffon2022-01-19v4No1 / 28
590amnoncommon farm, intestine, neonate stage, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm, age 0 days2020-02-10v4No1 / 29
165amnoncommon in house fly larva grown on moist wheat bran (common digestive system, research facility, larval stage, musca domestica, house fly, china)2017-07-16v4No1 / 29
858amnon high in two weeks compared to 3 days in fermented vegetable food product china fermneted chinese cabbage suan cai 2022-01-11v4No1 / 29
863amnon high in spring compared to winter in feces farm captive deer china yuzhong county moschus chrysogaster alpine musk deer xinglong mountain national nature reserve 2022-01-28v4No1 / 29
438amnondominant feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 29
3amnondominant homo sapiens, tongue, china2016-10-06v4No1 / 30
36amnonhigher in centernarians ( high in centererians compared to adult in feces homo sapiens sichuan province )2016-12-06v4No1 / 30
90amnonincreases during douchi fermentation ( high in timepoint late timepoint compared to early timepoint in douchi food (fermented) china )2017-03-08v4No1 / 30
624sheryolower in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in without biochar compared to biochar in soil rhizosphere 10 cm depth jiangsu province ph 7-8 china ryegrass days 30-40 )2020-05-11v4No1 / 30
774amnon high in tonsillitis compared to control in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v3No1 / 30
333amnonlower in stroke patients compared to healthy controls ( high in control compared to stroke in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in feces homo sapiens adult guangzhou city prefecture china )2018-05-15v4No1 / 30
438amnondominant feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 30
652amnon high in control compared to rheumatoid arthritis in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 31
155amnonhigher in bulk soil compared to loose bound root soil ( high in bulk soil compared to rhizosphere in soil triticum aestivum wheat china )2017-07-02v4No1 / 31
315amnonhigher in captive grown compared to wild frogs ( high in research facility compared to wild in digestive system colon jiangxi province hunan province frog quasipaa spinosa giant spiny frog china )2018-04-10v4No1 / 31
165amnoncommon in moist wheat bran (common research facility, wheat bran, china)2017-07-16v4No1 / 32
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
279amnon high in stomach small intestine compared to mouth in ochotonidae pika china 2018-01-24v4No1 / 33
856amnoncommon homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 33
687amnon high in chinese luxi yellow beef cattle compared to chinese bohai black beef cattle in research facility rumen bos taurus rumen liquid shandong province china 2028-03-09v4No1 / 34
269amnondecreases during one month in refrigeration of yao meat ( high in early timepoint fresh compared to late timpoint food spoilage in foodon product type china )2018-01-09v4No1 / 34
561amnon high in green stage diet spring compared to winter withered grass diet in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 35
858amnon high in 3 days compared to two weeks in fermented vegetable food product china fermneted chinese cabbage suan cai 2022-01-11v4No1 / 35
865amnon high in canis lupus familiaris dog compared to canis lupus wolf in feces china 2022-02-08v3No1 / 35
85amnonlower in shrimps exposed to sulfide compared to controls ( high in control compared to sulfide in digestive system sea water litopenaeus vannamei shenzhen city prefecture pacific white shrimp china )2017-03-06v4No1 / 36
50amnoncommon in mitten crab gills (common gill, eriocheir sinensis, china)2017-01-19v4No1 / 37
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica oleracea brassica china )2017-07-27v4No1 / 38
688amnon high in male male organism compared to female female organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 39
725amnon high in periodontitis acute pericementitis compared to control in homo sapiens mouth mucosa adult buccal mucosa china municipality of beijing 2021-01-03v3No1 / 39
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in homo sapiens periodontitis adult subgingival plaque subgingival dental plaque chronic periodontitis china municipality of shanghai 2021-09-11v3No1 / 39
687amnon high in high milk yield compared to low milk yield in research facility rumen bos taurus rumen liquid shandong province china holstein dairy cow 2028-03-09v4No1 / 40
267amnonlower in gut of fish in water with cadmium contamination compared to control ( high in control compared to cadmium in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 40
825amnoncommon feces, homo sapiens, control, child, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 40
112amnoncommon research facility, intestine, danio rerio, zebra fish, china2017-04-09v4No1 / 41
267amnonhigher in gut of fish in water with cadmium contamination compared to control ( high in cadmium compared to control in digestive system research facility oreochromis niloticus fish china )2017-12-24v4No1 / 41
825amnoncommon feces, homo sapiens, type i diabetes mellitus, child, type 1 diabetes mellitus, china, hangzhou city prefecture, age 6-14 years2021-08-12v3No1 / 41
60amnoncommon feces, anser cygnoides, china2017-02-03v4No1 / 42
837sheryoHigher in agricultural field at depths 40-100cm compared to 0-40cm, shaanxi, China ( high in depth 40-100cm compared to depth 0-40cm in soil zea mays triticum aestivum silt loam agricultural field china shaanxi province loess plateau )2021-09-26v4No1 / 42
547amnon high in high salt concentration compared to low salt concentration in capsicum annuum sichuan province red pepper sauce food (fermented) china 2019-08-15v4No1 / 43
555amnon high in control compared to autistic disorder autism in homo sapiens saliva child shanghai proper age 7-14 years china 2019-09-10v3No1 / 43
725amnon high in periodontitis acute pericementitis compared to control in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 43
36amnoncommon feces, homo sapiens, sichuan province2016-12-06v4No1 / 44
652amnon high in rheumatoid arthritis compared to control in homo sapiens saliva adult sichuan province china 2020-09-13v3No1 / 44
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 44
725amnon high in periodontitis chronic periodontitis compared to control in homo sapiens adult subgingival plaque subgingival dental plaque china municipality of beijing 2021-01-03v3No1 / 44
419amnon high in constipation compared to control in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 44
50amnoncommon in mitten crab intestine (common intestine, eriocheir sinensis, china)2017-01-19v4No1 / 45
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
597amnoncommon feces, homo sapiens, control, adult, zhejiang province, china2020-03-23v3No1 / 46
858amnon high in low salt concentration 0%-1% salt concentration compared to high salt concentration 3%-5% salt concentration in two weeks fermented vegetable food product china fermneted chinese cabbage suan cai 2022-01-11v4No1 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 46
572amnoncommon homo sapiens, control, tongue, dermal layer of tongue, china2019-12-16v3No1 / 47
597amnoncommon feces, homo sapiens, adult, zhejiang province, gout, china2020-03-23v3No1 / 47
640amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 47
254amnon high in winter autumn dry season compared to summer wet season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 47
779amnoncommon feces, homo sapiens, control, adult, guangzhou city prefecture, china2021-04-28v4No1 / 47
894amnoncommon orchard, leaf, zhejiang province, citrus, endosphere, china, citrus unshiu2022-04-11v4No1 / 47
720amnoncommon feces, homo sapiens, adult, autoimmune hepatitis, china, zhengzhou city prefecture2028-05-23v3No1 / 48
373amnon high in rhizosphere compared to soil in rice field oryza sativa hunan province rice china 2018-09-08v4No1 / 48
856amnoncommon homo sapiens, control, rectum, adult, biopsy, intestinal mucosa, china, human adult stage2022-01-09v3No1 / 48
547amnoncommon capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 49
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 49
849amnoncommon feces, homo sapiens, adult, zhejiang province, multiple sclerosis, multiple sclerosis, china, fourth decade human stage2021-12-14v3No1 / 50
883amnon high in depth (soil) 0-20cm compared to depth (soil) 60-100cm in soil oil contaminated soil shengli oilfield china yellow river delta oilfield 2022-03-20v4No1 / 50
725amnoncommon homo sapiens, control, mouth mucosa, adult, buccal mucosa, china, municipality of beijing2021-01-03v3No1 / 51
865amnoncommon feces, canis lupus, china, wolf2022-02-08v3No1 / 51
911amnoncommon feces, homo sapiens, nanjing city prefecture, spinal cord injury, china, human adult stage2022-05-21v4No1 / 51
694amnoncommon feces, homo sapiens, female, obesity, adult, china, shanghai district2028-03-17v3No1 / 52
439amnoncommon farm, rumen, bos grunniens, yak, china2018-12-31v4No1 / 52
661amnoncommon farm, lung, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 53
279amnon high in stomach small intestine compared to caecum colon in ochotonidae pika china 2018-01-24v4No1 / 53
279amnon high in mouth compared to stomach small intestine in ochotonidae pika china 2018-01-24v4No1 / 53
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 54
771amnoncommon body proper, whole body, china, aphis gossypii, cotton aphid2021-04-21v3No1 / 54
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, systemic lupus erythematosus, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 55
292amnoncommon feces, homo sapiens, adult, crohn's disease, china2018-02-05v4No1 / 55
774amnon high in control compared to tonsillitis in homo sapiens saliva oral cavity adult hong kong oral wash 2021-04-24v3No1 / 55
819amnon high in dalian city prefecture low atmospheric pollution compared to baoding city prefecture high atmospheric pollution in homo sapiens female skin adult skin of cheek china age 25-45 years 2021-07-12v1No1 / 55
720amnoncommon feces, homo sapiens, control, adult, china, zhengzhou city prefecture2028-05-23v3No1 / 56
775amnon high in lichen planus compared to control in homo sapiens saliva adult china jinan city prefecture 2021-04-24v4No1 / 56
812amnoncommon feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 56
911amnon high in control compared to spinal cord injury in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v4No1 / 56
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 56
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
116amnoncommon research facility, intestine, litopenaeus vannamei, south china sea, pacific white shrimp, china2017-04-10v4No1 / 58
624sheryoHigher in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in biochar compared to without biochar in soil rhizosphere 10 cm depth jiangsu province ph 7-8 china ryegrass days 30-40 )2020-05-11v4No1 / 59
281amnoncommon cloaca, shinisaurus crocodilurus, crocodile lizard, china2018-01-25v4No1 / 59
572amnoncommon homo sapiens, tongue, dermal layer of tongue, liver carcinoma, china2019-12-16v3No1 / 60
250amnoncommon in bamboo forest soil (common soil, ph 4, bamboo, phyllostachys pubescens, depth (soil) 0-10cm, woodland area, china)2017-11-22v4No1 / 60
90amnoncommon douchi, food (fermented), china2017-03-08v4No1 / 61
627amnoncommon feces, female, pregnancy, adult, china2020-05-16v3No1 / 61
637amnoncommon feces, homo sapiens, female, pregnancy, adult, china, chengdu city prefecture, gestational age 8-12 weeks2020-08-18v3No1 / 61
333amnoncommon in healthy controls feces (common feces, homo sapiens, control, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 61
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, dalian city prefecture, age 25-45 years2021-07-12v1No1 / 61
849amnoncommon feces, homo sapiens, control, adult, zhejiang province, china, fourth decade human stage2021-12-14v3No1 / 61
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, elaphe carinata, king ratsnake, china2019-07-21v4No1 / 63
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in soil triticum aestivum wheat china )2017-07-02v4No1 / 63
163amnon high in ochotona dauurica mongolia grassland compared to ochotona curzoniae tibet platue in stomach ochotonidae pika china 2017-07-13v4No1 / 63
380amnoncommon feces, homo sapiens, adult, tibetan plateau, tibet autonomous region2018-10-03v4No1 / 63
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 63
865amnoncommon feces, canis lupus familiaris, dog, china, inner mongolia autonomous region2022-02-08v3No1 / 64
640amnoncommon homo sapiens, female, dentition, adult, supragingival plaque, supragingival dental plaque, china, shanghai district2020-08-22v4No1 / 65
657amnonpostively correlated with age ( high in age older age compared to younger age in research facility rumen ovis aries qinghai province rumen liquid age < 1 year sheep lamb china )2020-09-13v4No1 / 65
720amnon high in autoimmune hepatitis compared to control in feces homo sapiens adult china zhengzhou city prefecture 2028-05-23v3No1 / 65
735amnon high in restricted feed compared to control in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 65
858amnoncommon two weeks, low salt concentration, fermented vegetable food product, china, fermneted chinese cabbage, suan cai, 0%-1% salt concentration2022-01-11v4No1 / 65
572amnon high in pancreatic cancer compared to control in homo sapiens tongue dermal layer of tongue china 2019-12-16v3No1 / 66
373amnonlower in soil of mature plants compared to seedlings ( high in seedling early timepoints compared to late timepoints in rice field soil rhizosphere oryza sativa hunan province rice china )2018-09-08v4No1 / 66
223amnon high in zhoushan island compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 67
840amnoncommon farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 67
858amnon high in high salt concentration 3%-5% salt concentration compared to low salt concentration 0%-1% salt concentration in two weeks fermented vegetable food product china fermneted chinese cabbage suan cai 2022-01-11v4No1 / 67
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 68
572amnoncommon homo sapiens, tongue, dermal layer of tongue, pancreatic cancer, china2019-12-16v3No1 / 70
91amnoncommon serofluid dish, jiangshui, food (fermented), china2017-03-08v4No1 / 70
742amnoncommon feces, zoological garden, bird, captive, china, dalian city prefecture, pygoscelis papua, gentoo penguin2021-02-18v3No1 / 70
819amnon high in scalp compared to skin of cheek in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 70
417amnoncommon feces, anser cygnoides, winter, bird, swan goose, china2018-12-01v4No1 / 70
419amnon high in control compared to constipation in feces research facility rattus norvegicus sprague dawley rat china 2018-12-02v4No1 / 70
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
716amnoncommon homo sapiens, control, tongue, adult, dermal layer of tongue, china2028-05-22v3No1 / 72
697amnoncommon female, research facility, oral cavity, sprague dawley, sichuan province, female organism, china2028-03-29v3No1 / 73
603amnonhigher in inital batches of baijiu fermentation pit mud ( high in days 0-90 compared to days 180-270 in mud fermentation pit mud china hefei city prefecture baijiu )2020-04-05v3No1 / 74
774amnoncommon homo sapiens, saliva, oral cavity, adult, hong kong, oral wash, tonsillitis2021-04-24v3No1 / 74
34amnonhigher in 10cm, 20cm depth compared to 0cm ( high in 10 cm depth 20 cm depth compared to topsoil in mangrove swamp rhizosphere china )2016-12-06v4No1 / 75
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 75
299amnon high in control compared to mouth neoplasm cancer in homo sapiens saliva adult china 2018-02-27v4No1 / 75
858amnoncommon two weeks, high salt concentration, fermented vegetable food product, china, fermneted chinese cabbage, suan cai, 3%-5% salt concentration2022-01-11v4No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 2-5 year-old child stage compared to age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage in feces homo sapiens china )2018-12-30v4No1 / 76
279amnoncommon stomach, small intestine, ochotonidae, pika, china2018-01-24v4No1 / 77
819amnoncommon homo sapiens, female, skin, adult, skin of cheek, china, baoding city prefecture, age 25-45 years2021-07-12v1No1 / 77
512amnon high in depth (soil) 0-20cm depth (soil) 10 cm compared to depth (soil) 60cm in peatland fen soil peat soil china 2019-03-22v4No1 / 77
609sheryohigher in soil without tobacco plants and with difenoconazole fungicide ( high in absence of tobacco plants compared to presence of tobacco plants in soil ph 7-8 depth 0-20cm limestone fungicide china tobacco field difenoconazole )2020-04-21v4No1 / 78
163amnoncommon stomach, ochotonidae, pika, ochotona dauurica, mongolia grassland, china2017-07-13v4No1 / 80
451amnoncommon serofluid dish, jiangshui, food (fermented), china2019-01-10v4No1 / 80
3amnoncommon homo sapiens, tongue, china2016-10-06v4No1 / 81
292amnoncommon feces, homo sapiens, control, adult, china2018-02-05v4No1 / 81
373amnonhigher in soil of mature plants compared to seedlings ( high in late timepoints compared to seedling early timepoints in rice field soil rhizosphere oryza sativa hunan province rice china )2018-09-08v4No1 / 81
837sheryoHigher in agricultural field at depths 100-300cm compared to 0-40cm, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in soil zea mays triticum aestivum silt loam agricultural field china shaanxi province loess plateau )2021-09-26v4No1 / 81
911amnoncommon feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v4No1 / 81
707amnoncommon feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 82
716amnoncommon homo sapiens, tongue, adult, dermal layer of tongue, china, halitosis, chronic bad breath2028-05-22v3No1 / 82
590amnoncommon farm, intestine, age 3-5 weeks, china, hainan autonomous prefecture, trachemys scripta elegans, red-eared slider turtle, turtle farm2020-02-10v4No1 / 83
279amnoncommon grassland, steppe, leaf, stem, mongolia, china2018-01-24v4No1 / 83
269amnonpeaks at 2 weeks in refrigeration of yao meat ( high in middle timepoint two weeks compared to late timepoint fresh food spoilage in foodon product type china )2018-01-09v4No1 / 83
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
601amnoncommon feces, homo sapiens, adult, type 2 diabetes mellitus, china2020-03-30v4No1 / 85
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, ptyas mucosa, oriental ratsnake, china2019-07-21v4No1 / 86
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
336amnoncommon feces, qinghai province, anser, goose, greylag goose, china2018-05-16v4No1 / 87
402amnoncommon mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 1, china2018-11-18v4No1 / 87
382amnoncommon hot spring, geothermal field, water, ganzi tibetan autonomous prefecture, high temperature environment, china2018-10-22v4No1 / 89
904amnoncommon research facility, caecum, gallus gallus, chicken, china, hen, jinghong-1, age 42 weeks2022-05-18v3No1 / 89
530amnoncommon feces, farm, hunan province, adula, snake, snake farm, naja atra, chinese cobra, china2019-07-21v4No1 / 90
223amnon high in hangzhou bay compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 90
899amnoncommon in snail intestine from heavy metal contaminated greenhouse (common intestine, zhejiang province, heavy metal, greenhouse, sedum alfredii, china, bradybaena ravida, land snail, heavy metal contaminated soil)2022-04-25v3No1 / 90
855sheryoHigher in soil depth of 75cm compared to soil depth of 350cm in fertilized soil in china ( high in depth 175cm compared to depth 350cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 91
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 92
774amnoncommon homo sapiens, control, saliva, oral cavity, adult, hong kong, oral wash2021-04-24v3No1 / 92
601amnoncommon feces, homo sapiens, control, adult, china2020-03-30v4No1 / 93
836amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, oral lichen planus, china, municipality of shanghai, gingival erosive oral lichen planus2021-09-11v3No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
837sheryoHigher in agricultural field at depths0-40cm compared to 40-100cm, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in soil zea mays triticum aestivum silt loam agricultural field china shaanxi province loess plateau )2021-09-26v4No1 / 95
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
555amnoncommon homo sapiens, saliva, child, shanghai proper, age 7-14 years, china2019-09-10v3No1 / 96
787amnonhigher in first 2 hours compared to 5-6 hours following eating ( high in 1-2 hours compared to 5-6 hours in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 96
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
202amnoncommon homo sapiens, oral cavity, mouth mucosa, mouth, china2017-10-01v4No1 / 100
787amnonlower in first 2 hours compared to 5-6 hours following eating ( high in 5-6 hours compared to 1-2 hours in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 101
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
279amnoncommon ochotonidae, pika, mouth, china2018-01-24v4No1 / 103
855sheryoHigher in soil depth of 1000cm compared to soil depth of 800cm in fertilized soil in china ( high in depth (water) 1000m compared to depth 800cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 103
168amnoncommon in mud from chinese liquor fermentation pit (common mud, ph 5, fermentation pit mud, china)2017-07-18v4No1 / 104
279amnoncommon grassland, leaf, stem, tibetan plateau, kobresia humilis, china2018-01-24v4No1 / 104
414amnon high in non-manured soil compared to manured soil in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 104
519amnoncommon homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 104
34amnonhigher in 0cm depth compared to 10cm, 20cm depth ( high in topsoil compared to 10 cm depth 20 cm depth in mangrove swamp rhizosphere china )2016-12-06v4No1 / 106
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
631sheryoHigher in maize field biochar amended rhizosphere soil compared to unamended rhizosphere soil ( high in biochar compared to unamended soil in soil rhizosphere maize field china guizhou province kaiyang county after 6 years )2020-06-02v3No1 / 108
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
524amnoncommon homo sapiens, saliva, adult, sichuan province, china2019-07-06v4No1 / 109
223amnon high in sanmen bay compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 110
271amnon high in root structure root compared to soil rhizosphere in glycine max soybean china depth (soil) 0-20cm 2018-01-09v4No1 / 110
899amnoncommon in snail intestine from phytoremedation field (common intestine, zhejiang province, heavy metal, field, sedum alfredii, china, bradybaena ravida, land snail, heavy metal contaminated soil, phytoremedation field)2022-04-25v3No1 / 110
373amnon high in soil compared to rhizosphere in rice field oryza sativa hunan province rice china 2018-09-08v4No1 / 111
855sheryoHigher in soil depth of 800cm compared to soil depth of 350cm in fertilized soil in china ( high in depth 800cm compared to depth 350cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 111
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, 65-79 year-old human stage2018-12-30v4No1 / 111
555amnoncommon homo sapiens, dentition, child, shanghai proper, supragingival plaque, age 7-14 years, china2019-09-10v3No1 / 112
735amnon high in control compared to restricted feed in female pregnancy research facility rumen ovis aries nanjing city prefecture digesta sheep female organism china 2021-01-22v3No1 / 112
863amnon high in winter compared to spring in feces farm captive deer china yuzhong county moschus chrysogaster alpine musk deer xinglong mountain national nature reserve 2022-01-28v4No1 / 112
269amnoncommon in fresh yao meat food (common foodon product type, china)2018-01-09v4No1 / 113
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
417amnon high in mongolia summer compared to winter china in feces anser cygnoides bird swan goose 2018-12-01v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
640amnoncommon homo sapiens, female, saliva, adult, china, shanghai district2020-08-22v4No1 / 117
792amnon high in rhizosphere haloxylon ammodendron nitraria tangutorum compared to soil in desert depth (soil) 50cm china minqin county sand ph 9 depth (soil) 20-60cm 2021-06-07v4No1 / 118
414amnon high in manured soil compared to non-manured soil in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 118
315amnonlower in frog pond water compared to frog gut ( high in frog quasipaa spinosa giant spiny frog compared to water fresh water in jiangxi province hunan province china )2018-04-10v4No1 / 119
753amnoncommon feces, farm, adult, canis lupus familiaris, dog, china, dog breeding center2021-03-12v4No1 / 120
438amnoncommon feces, homo sapiens, adult, jiangsu province, age >94, china, ninth decade human stage, tenth decade human stage2018-12-30v4No1 / 121
581amnoncommon in red swamp crayfish grown in flooded rice field (common rice field, intestine, adult, jiangsu province, fish, china, procambarus clarkii, red swamp crayfish)2020-01-21v3No1 / 122
741amnon high in alfalfa diet compared to pellet feed diet in research facility intestine china planorbella trivolvis ram's horn snail 2021-02-17v3No1 / 123
380amnon high in gannan tibetan autonomous prefecture compared to gangcha region in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 123
590amnoncommon in turtle pond water (common farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 127
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
855sheryoCommon in soil depth of 1000cm in fertilized soil in china (common soil, fertilized soil, agricultural field, china, luancheng county, depth 1000cm)2021-12-27v3No1 / 127
855sheryoHigher in soil depth of 800cm compared to soil depth of 1000cm in fertilized soil in china ( high in depth 800cm compared to depth 1000cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 128
783sheryohigher in desert soil in mongolia under no water addition treatment compared to soil with water addition ( high in ambient precipitation no water addition compared to water addition 100% above ambient precipitation in soil mongolia sandy desert bajada china dengkou county ph 7.85 ulan buh desert cambic arenosols luvic gypsisols )2021-05-11v4No1 / 130
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in soil ph 7-8 depth 0-20cm limestone fungicide china tobacco field difenoconazole )2020-04-21v4No1 / 131
417amnon high in winter china compared to mongolia summer in feces anser cygnoides bird swan goose 2018-12-01v4No1 / 132
775amnoncommon homo sapiens, saliva, adult, china, jinan city prefecture2021-04-24v4No1 / 133
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
585amnoncommon china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river, buccal mass2020-02-02v3No1 / 136
675sheryoHigher in watermelon rhizosphere soil inoculated with fusarium oxysporum f. sp. niveum compared to uninoculated watermelon rhizosphere soil ( high in inoculated with fusarium oxysporum f. sp. niveum compared to un-inoculated in rhizosphere ph 7 citrullus lanatus china co culture with wheat (triticum aestivum l.) )2028-02-22v4No1 / 136
725amnoncommon homo sapiens, mouth mucosa, periodontitis, adult, buccal mucosa, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 136
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 136
315amnoncommon in frog gut (common digestive system, colon, jiangxi province, hunan province, frog, quasipaa spinosa, giant spiny frog, china)2018-04-10v4No1 / 138
628sheryoHigher in bulk soil with barley plants after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in soil bulk soil hordeum vulgare zhejiang province depth (soil) 15cm ph 4-5 china quzhou county days 180 mature barley plants )2020-05-18v4No1 / 140
741amnoncommon research facility, intestine, china, planorbella trivolvis, ram's horn snail, alfalfa diet2021-02-17v3No1 / 141
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in research facility soil paddy field soil zhejiang province china )2018-12-02v4No1 / 141
855sheryoCommon in soil depth of 800cm in fertilized soil in china (common soil, fertilized soil, agricultural field, china, luancheng county, depth 800cm)2021-12-27v3No1 / 142
279amnoncommon caecum, colon, ochotonidae, pika, china2018-01-24v4No1 / 146
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
85amnoncommon digestive system, sea water, litopenaeus vannamei, shenzhen city prefecture, pacific white shrimp, china2017-03-06v4No1 / 147
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
64amnoncommon homo sapiens, saliva, sichuan province2017-02-16v4No1 / 152
254amnon high in winter dry season compared to summer autumn wet season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 153
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
837sheryoHigher at 100-300cm depth compared 40-100cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 40-100cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 154
836amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of shanghai2021-09-11v3No1 / 155
512amnon high in depth (soil) 60cm compared to depth (soil) 0-20cm depth (soil) 10 cm in peatland fen soil peat soil china 2019-03-22v4No1 / 155
725amnoncommon homo sapiens, control, adult, subgingival plaque, subgingival dental plaque, china, municipality of beijing2021-01-03v3No1 / 156
314amnon high in tibetan pig tibetan swine compared to sus scrofa pig in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 157
402amnoncommon mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 2,3, china2018-11-18v4No1 / 159
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 159
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
25amnon high in control compared to antibiotic in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 163
652amnoncommon homo sapiens, saliva, adult, sichuan province, china2020-09-13v3No1 / 166
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v4No1 / 168
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 171
894amnoncommon orchard, leaf, zhejiang province, citrus, leaf surface, china, citrus unshiu2022-04-11v4No1 / 172
579amnoncommon in pond water of mud crab aquaculture (common fish farm, saline water, saline water aquarium, scylla paramamosain, china, pond, mud crab, spring)2020-01-14v3No1 / 173
855sheryoCommon in soil depth of 175cm in fertilized soil in china (common soil, fertilized soil, agricultural field, china, luancheng county, depth 175cm)2021-12-27v3No1 / 173
163amnoncommon stomach, ochotonidae, pika, mongolia grassland, ochotona curzoniae, china2017-07-13v4No1 / 174
530amnoncommon feces, farm, hunan province, adula, snake, deinagkistrodon acutus, pit viper, snake farm, china2019-07-21v4No1 / 178
299amnoncommon in healthy (non-tumor) controls (common homo sapiens, control, saliva, adult, china)2018-02-27v4No1 / 179
555amnon high in dentition supragingival plaque compared to saliva in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 184
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
661amnoncommon farm, intestine, china, maojian district, andrias davidianus, chinese giant salamander, age 3 years2020-09-20v4No1 / 186
883amnoncommon soil, oil contaminated soil, shengli oilfield, china, yellow river delta, oilfield2022-03-20v4No1 / 187
631sheryoHigher in maize field biochar amended bulk soil, after 6 years of biochar amended, compared to unamended soil ( high in biochar compared to unamended soil in soil bulk soil maize field china guizhou province kaiyang county after 6 years )2020-06-02v3No1 / 188
299amnoncommon homo sapiens, saliva, adult, mouth neoplasm, cancer, china2018-02-27v4No1 / 188
402amnon high in zone 1 compared to zone 2,3 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 189
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in soil rhizosphere hordeum vulgare zhejiang province depth (soil) 15cm ph 4-5 china quzhou county days 180 mature barley plants )2020-05-18v4No1 / 190
860amnoncommon research facility, intestine, anas platyrhynchos, intestinal contents, china, duck2022-01-12v3No1 / 190
156amnonlower in soil and rhizosphere supplemented with struvite ( high in control compared to struvite in soil rhizosphere brassica oleracea brassica china )2017-07-27v4No1 / 191
585amnoncommon stomach, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 194
686sheryoHigher in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical and organic fertilizer and had high Fusarium cumulative disease incidence ( high in chemical fertilization n,p,k high fusarium cumulative disease incidence organic fertilizer- chicken manure compost compared to bacterial enriched bio-fertilizer low fusarium cumulative disease incidence fungal enriched bio-fertilizer in wanning city vanilla planifolia ph 7.6 pot expreiment soil from vanilla field fusarium oxysporum f. sp. vanillae )2028-03-08v4No1 / 196
631sheryoHigher in maize field unamended bulk soil, after 6 years of biochar amended, compared to biochar amended soil ( high in unamended soil compared to biochar in soil bulk soil maize field china guizhou province kaiyang county after 6 years )2020-06-02v3No1 / 201
584amnoncommon feces, research facility, rattus norvegicus, sprague dawley, type i diabetes mellitus, rat, china, male, induced type 1 diabetes2020-01-31v3No1 / 202
791sheryoHigh at 80cm depth compared to 0cm depth in highly saline sodic soil in China ( high in depth (soil) 80cm compared to depth 0cm depth (soil) 0-20cm in soil high salinity china songnen plain da'an station salic solonetz high sodicity )2021-06-07v4No1 / 203
878amnoncommon city, air, respirable suspended particulate matter, china, municipality of beijing, pm102022-03-11v3No1 / 203
438amnonlower in centenarians compared to adults ( high in 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to age >94 ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 203
555amnon high in saliva compared to dentition supragingival plaque in homo sapiens child shanghai proper age 7-14 years china 2019-09-10v3No1 / 205
603amnonlower in inital batches of baijiu fermentation pit mud ( high in days 180-270 compared to days 0-90 in mud fermentation pit mud china hefei city prefecture baijiu )2020-04-05v3No1 / 205
783sheryohigher in desert soil in mongolia under water addition treatment compared to soil without water addition ( high in water addition 100% above ambient precipitation compared to ambient precipitation no water addition in soil mongolia sandy desert bajada china dengkou county ph 7.85 ulan buh desert cambic arenosols luvic gypsisols )2021-05-11v4No1 / 206
254amnon high in autumn compared to summer winter in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 206
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, chronic periodontitis, china, municipality of beijing2021-01-03v3No1 / 206
863amnoncommon feces, farm, captive, deer, china, qilian county, moschus berezovskii, forest musk deer2022-01-28v4No1 / 206
787amnonhigher in excess grain induced rumen acidosis compared to healthy controls ( high in acidosis subacute rumen acidosis compared to control in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 207
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common soil, rhizosphere, ph 7, black soil, glycine soja, china, jilin province)2021-03-18v3No1 / 210
780amnon high in caecum compared to small intestine duodenum jejunum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 212
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in research facility soil paddy field soil zhejiang province china )2018-12-02v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens stomach adult zhejiang province china )2019-06-26v3No1 / 214
855sheryoHigher in soil depth of 350cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 350cm compared to depth 75cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 217
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
584amnoncommon feces, control, research facility, rattus norvegicus, sprague dawley, rat, china, male2020-01-31v3No1 / 221
824sheryoHigher in soil at 0-10cm depth after 0-9 years compared to after 27-35 years of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in soil depth (soil) 0-10cm china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 230
25amnon high in antibiotic compared to control in research facility caecum oryctolagus cuniculus rex rabbit sichuan province 2016-12-01v4No1 / 231
640amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens female adult china shanghai district 2020-08-22v4No1 / 232
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common soil, rhizosphere, glycine max, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 234
279amnoncommon grassland, steppe, soil, mongolia, china2018-01-24v4No1 / 235
349amnoncommon feces, research facility, sprague dawley, rattus, male, rat, china2018-07-29v4No1 / 235
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
688amnon high in female female organism compared to male male organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 239
286amnoncommon in feces of individuals with kidney stones (common feces, homo sapiens, adult, nanning city prefecture, nephrolithiasis, china, sixth decade human stage)2018-01-27v4No1 / 239
837sheryoHigher at 40-100cm depth compared to 0-40cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 40-100cm compared to depth 0-40cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 239
585amnoncommon intestine, china, qingpu district, pomacea canaliculata, golden apple snail, nanheng river2020-02-02v3No1 / 240
725amnoncommon homo sapiens, periodontitis, adult, subgingival plaque, subgingival dental plaque, acute pericementitis, china, municipality of beijing2021-01-03v3No1 / 240
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult skin of cheek china age 25-45 years 2021-07-12v1No1 / 242
855sheryoCommon in soil depth of 350cm in fertilized soil in china (common soil, fertilized soil, agricultural field, china, luancheng county, depth 350cm)2021-12-27v3No1 / 242
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in soil rhizosphere hordeum vulgare zhejiang province depth (soil) 15cm ph 4-5 china quzhou county days 180 mature barley plants )2020-05-18v4No1 / 243
824sheryoHigher soil at 40-60cm depth after 0-9 years compared to 27-35 years after of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in soil china depth 40-60cm grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 247
837sheryoHigher at 100-300cm depth compared 0-40cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 250
767sheryoHigh in control treatment soil with high fusarium indices compared to soil with low fusarium indices planted with Chrysanthemum in Nanjing China ( high in fusarium high fusarium cumulative disease incidence compared to compost soil paenibacillus low fusarium cumulative disease incidence bio-organic fertilizer conventional tillage paenibacillus polymyxa soil fumigation dazomet deep plough in soil china nanjing county chrysanthemum chrysanthemum morifolium ramat. ph 6.9 )2021-04-18v4No1 / 252
111amnoncommon ruminant reticulum, omasum, rumen, ovis aries, mongolian sheep, china2017-04-09v4No1 / 253
279amnoncommon grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 253
419amnoncommon feces, research facility, rattus norvegicus, sprague dawley, rat, china2018-12-02v4No1 / 254
561amnon high in summer grass growth diet compared to green stage diet spring in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 256
746sheryoHigh in saline soil fertilized with chemical fertilizer compared to biological fertilizer, planted with tomatos, in dafeng, china ( high in chemical fertilization n,p,k compared to trichoderma guizhouense njau 4742 biological fertilization chicken manure in solanum lycopersicum jiangsu province solonchak china dafeng city saline soil ph 7.5 )2021-03-03v4No1 / 269
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in soil yunnan province ph 6 china panax notoginseng pot expreiment xundian county sanqi plants )2021-03-11v3No1 / 273
315amnoncommon in frog pond water (common pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, china, spring)2017-07-12v4No1 / 278
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
134amnon high in taxus cuspidata compared to taxus media in rhizosphere tree taxus china 2017-04-16v4No1 / 279
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 280
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
863amnoncommon feces, farm, captive, deer, china, yuzhong county, moschus chrysogaster, alpine musk deer, xinglong mountain national nature reserve2022-01-28v4No1 / 290
156amnoncommon leaf, brassica oleracea, brassica, phyllosphere, china2017-07-27v4No1 / 292
561amnon high in summer grass growth diet compared to winter withered grass diet in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 294
111amnon high in ruminant reticulum omasum rumen compared to rectum caecum colon ileum in ovis aries mongolian sheep china 2017-04-09v4No1 / 294
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
824sheryoHigher in soil at 0-10cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in soil depth (soil) 0-10cm china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 294
737amnoncommon research facility, rumen, age 2 months, ruminal fluid, capra hircus, china, hainan autonomous prefecture, goat, hainan black goat2021-01-27v3No1 / 295
824sheryoHigher soil at 40-60cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 299
419amnoncommon in rats with induced constipation (common feces, research facility, rattus norvegicus, sprague dawley, rat, constipation, china)2018-12-02v4No1 / 300
223amnon high in other regions compared to yushan islands in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 302
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common soil, solanum lycopersicum, fusarium oxysporum, shandong province, china, luojiazhuang)2021-03-11v3No1 / 305
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth (soil) 0-20cm compared to depth 20-40cm in soil jiangsu province clay loam ph 6-7 gleysol china sihong county poplar poplar plantation chenwei forest )2021-08-25v4No1 / 312
752sheryoHigher in treatments with biochar compared to treatments without biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in biochar compared to without biochar in soil yunnan province ph 6 china panax notoginseng pot expreiment xundian county sanqi plants )2021-03-11v3No1 / 317
687amnon high in capra hircus goat chinese laoshan milk goat compared to bos taurus chinese bohai black beef cattle chinese luxi yellow beef cattle in research facility rumen rumen liquid shandong province china 2028-03-09v4No1 / 318
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
828sheryoHigher at 20-40cm depth compared to 0-20cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth 20-40cm compared to depth (soil) 0-10cm in soil jiangsu province clay loam ph 6-7 gleysol china sihong county poplar poplar plantation chenwei forest )2021-08-25v4No1 / 321
402amnon high in zone 2,3 compared to zone 1 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 322
628sheryoHigher in bulk soil with barley plants after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in soil bulk soil hordeum vulgare zhejiang province depth (soil) 15cm ph 4-5 china quzhou county days 180 mature barley plants )2020-05-18v4No1 / 327
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
512amnoncommon peatland, fen, soil, peat soil, baekdudaegan, ph 5-6, hani peatland, china2019-03-22v4No1 / 329
111amnoncommon rectum, caecum, colon, ileum, ovis aries, mongolian sheep, china2017-04-09v4No1 / 330
163amnon high in ochotona curzoniae tibet plateau compared to ochotona dauurica mongolia grassland in stomach ochotonidae pika china 2017-07-13v4No1 / 331
855sheryoHigher in soil depth of 175cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 175cm compared to depth 75cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 334
837sheryoHigher at 40-100cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 40-100cm compared to depth 100-300cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 336
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
750sheryoCommon in soil of wheat field in China (common soil, triticum aestivum, china, hebei province, luancheng county, ph 7.6, fluvo-aquic soil)2021-03-11v3No1 / 337
819amnon high in baoding city prefecture high atmospheric pollution compared to dalian city prefecture low atmospheric pollution in homo sapiens female skin adult scalp china age 25-45 years 2021-07-12v1No1 / 337
254amnoncommon river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 347
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
767sheryoHigh in conservation tillage compared to conventional tillage soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' in Nanjing China ( high in conservation tillage compared to conventional tillage deep plough in soil compost biofilter pig manure compost soil paenibacillus china nanjing county chrysanthemum bio-organic fertilizer chrysanthemum morifolium ramat. ph 6.9 paenibacillus polymyxa soil fumigation dazomet )2021-04-18v4No1 / 350
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, nitraria tangutorum, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 352
767sheryoHigh in conventional tillage compared to conservation tillage soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' in Nanjing China ( high in conventional tillage deep plough compared to conservation tillage in soil compost biofilter pig manure compost soil paenibacillus china nanjing county chrysanthemum bio-organic fertilizer chrysanthemum morifolium ramat. ph 6.9 paenibacillus polymyxa soil fumigation dazomet )2021-04-18v4No1 / 355
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
561amnon high in winter withered grass diet compared to summer grass growth diet in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 357
134amnon high in taxus media compared to taxus cuspidata in rhizosphere tree taxus china 2017-04-16v4No1 / 358
767sheryoHigh in soil with low fusarium indices compared to control treatment soil with high fusarium indices planted with Chrysanthemum in Nanjing China ( high in pig manure compost soil paenibacillus low fusarium cumulative disease incidence bio-organic fertilizer conventional tillage paenibacillus polymyxa soil fumigation dazomet deep plough compared to control high fusarium cumulative disease incidence in soil china nanjing county chrysanthemum chrysanthemum morifolium ramat. ph 6.9 )2021-04-18v4No1 / 360
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
512amnon high in baekdudaegan ph 5-6 hani peatland compared to tibetan plateau riganqiao peatland ph 5.5-6.5 in peatland fen soil peat soil china 2019-03-22v4No1 / 363
686sheryoHigher in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal and bacterial bio-fertilizer and had low Fusarium cumulative disease incidence ( high in bacterial enriched bio-fertilizer low fusarium cumulative disease incidence fungal enriched bio-fertilizer compared to chemical fertilization n,p,k high fusarium cumulative disease incidence organic fertilizer- chicken manure compost in wanning city vanilla planifolia ph 7.6 pot expreiment soil from vanilla field fusarium oxysporum f. sp. vanillae )2028-03-08v4No1 / 371
579amnoncommon in pond water of mud crab aquaculture (common pond, fish farm, saline water, summer, autumn, saline water aquarium, scylla paramamosain, china, mud crab)2020-01-14v3No1 / 374
687amnon high in low milk yield compared to high milk yield in research facility rumen bos taurus rumen liquid shandong province china holstein dairy cow 2028-03-09v4No1 / 375
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
791sheryoCommon in highly saline sodic soil at8 80cm depth in China (common soil, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10, depth (soil) 80cm)2021-06-07v4No1 / 377
442amnoncommon feces, research facility, rattus norvegicus, sprague dawley, male, rat, china2019-01-06v4No1 / 378
512amnon high in tibetan plateau riganqiao peatland ph 5.5-6.5 compared to baekdudaegan ph 5-6 hani peatland in peatland fen soil peat soil china 2019-03-22v4No1 / 381
216amnoncommon feces, research facility, mus musculus, c57bl/6, male, mouse, china2017-10-24v4No1 / 385
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil cambisol red soil zea mays triticum aestivum hunan province china )2018-11-26v4No1 / 395
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
561amnon high in green stage diet spring compared to summer grass growth diet in rumen tibetan plateau bos grunniens yak ruminal fluid china alpine meadow 2019-11-05v3No1 / 397
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil fertilized soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 397
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
791sheryoHigher in high sodicity and high salinity soil compared to low sodicity and low salinity soil at 80cm depth in China ( high in high salinity high sodicity ph 10 compared to low salinity low sodicity ph 9 in soil china songnen plain da'an station salic solonetz depth (soil) 80cm )2021-06-08v4No1 / 404
883amnon high in oil contaminated soil oilfield compared to non-contaminated soil in soil shengli oilfield china yellow river delta 2022-03-20v4No1 / 404
800amnoncommon 100-250 days following heavy metal contamination (common lake, sediment, fresh water, summer, autumn, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm)2021-06-15v4No1 / 412
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common soil, rhizosphere, oryza sativa, ph 7, black soil, china, jilin province)2021-03-18v3No1 / 415
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 418
687amnoncommon research facility, rumen, rumen liquid, capra hircus, shandong province, china, goat, chinese laoshan milk goat2028-03-09v4No1 / 429
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in soil zea mays triticum aestivum silt loam agricultural field china shaanxi province loess plateau )2021-09-26v4No1 / 431
792amnon high in soil compared to rhizosphere haloxylon ammodendron nitraria tangutorum in desert depth (soil) 50cm china minqin county sand ph 9 depth (soil) 20-60cm 2021-06-07v4No1 / 432
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil cambisol red soil zea mays triticum aestivum hunan province china )2018-11-26v4No1 / 437
504amnoncommon sediment, marine sediment, nan'ao island, china2019-03-14v4No1 / 437
792amnoncommon desert, rhizosphere, depth (soil) 50cm, china, minqin county, sand, haloxylon ammodendron, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 443
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
504amnoncommon water, sea water, nan'ao island, china2019-03-14v4No1 / 452
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
111amnon high in rectum caecum colon ileum compared to ruminant reticulum omasum rumen in ovis aries mongolian sheep china 2017-04-09v4No1 / 464
314amnoncommon farm, caecum, tibet autonomous region, cecal content, tibetan pig, tibetan swine, china2018-04-10v4No1 / 467
254amnonlower in river when close to populated region compared to downstream ( high in downstream compared to populated place city upstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 468
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
221amnoncommon feces, research facility, sprague dawley, rattus, rat, china2017-10-25v4No1 / 470
438amnonhigher in centenarians compared to adults ( high in age >94 ninth decade human stage tenth decade human stage compared to 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 474
454amnoncommon feces, wild, elaphurus davidianus, pere deer, deer, china2019-01-10v4No1 / 480
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 483
512amnoncommon peatland, fen, soil, peat soil, tibetan plateau, riganqiao peatland, ph 5.5-6.5, china2019-03-22v4No1 / 483
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
791sheryoHigh at 0cm depth compared to 80cm depth in highly saline sodic soil in China ( high in depth 0cm depth (soil) 0-20cm compared to depth (soil) 80cm in soil high salinity china songnen plain da'an station salic solonetz high sodicity )2021-06-07v4No1 / 496
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil fertilized soil rhizosphere arachis hypogaea ph 5 peanut china )2017-12-02v4No1 / 497
373amnoncommon rice field, soil, rhizosphere, oryza sativa, hunan province, rice, china2018-09-08v4No1 / 501
616amnon high in non-fertilized soil ph 6.7 compared to fertilized soil ph 5.5-6 in soil topsoil guangzhou city prefecture china saccharum sugarcane depth (soil) 0-20cm 2020-04-27v3No1 / 504
787amnonlower in excess grain induced rumen acidosis compared to healthy controls ( high in control compared to acidosis subacute rumen acidosis in research facility rumen ruminal fluid capra hircus china shanxi province goat dairy goat )2021-05-23v3No1 / 504
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
454amnoncommon feces, captive, elaphurus davidianus, pere deer, deer, china2019-01-10v4No1 / 509
657amnoncommon research facility, rumen, ovis aries, qinghai province, rumen liquid, age < 1 year, sheep, lamb, china2020-09-13v4No1 / 517
824sheryoHigher at 40-60cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 40-60cm compared to depth 20-40cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 520
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common soil, rhizosphere, ph 7, black soil, oryza rufipogon, china, jilin province)2021-03-18v3No1 / 530
27amnoncommon rumen, bos grunniens, china2016-12-05v4No1 / 532
603amnoncommon in baijiu fermentation pit mud in first 2 batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 0-90)2020-04-05v3No1 / 542
725amnon high in subgingival plaque subgingival dental plaque compared to mouth mucosa buccal mucosa in homo sapiens adult china municipality of beijing 2021-01-03v3No1 / 544
908amnoncommon feces, research facility, equus caballus, horse, adult organism, china, shanxi province, guanzhong horse2022-05-19v4No1 / 567
254amnon high in summer autumn wet season compared to winter dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 571
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, forested area, china, lushan mountain, elevation 500-600m, depth (soil) 0-20cm2020-09-25v4No1 / 575
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 581
687amnoncommon research facility, rumen, bos taurus, rumen liquid, shandong province, china, holstein dairy cow2028-03-09v4No1 / 593
792amnoncommon desert, soil, depth (soil) 50cm, china, minqin county, sand, ph 9, depth (soil) 20-60cm2021-06-07v4No1 / 595
791sheryoCommon in highly saline sodic soil at 20cm depth in China (common soil, depth 20cm, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10.5)2021-06-07v4No1 / 596
444amnonhigher in continuously cropped strawberry soil ( high in age 5 years age 10 years continuous cropping compared to age 1 year in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 602
603amnoncommon in baijiu fermentation pit mud in later batches (common mud, fermentation pit mud, china, hefei city prefecture, baijiu, days 180-270)2020-04-05v3No1 / 608
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, forested area, china, elevation 200-300m, lushan mountain, depth (soil) 0-20cm2020-09-25v4No1 / 613
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
791sheryoCommon in highly saline sodic soil at 40cm depth in China (common soil, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10.5, depth (soil) 40cm)2021-06-07v4No1 / 618
223amnon high in yushan islands compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 619
264amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, jiangsu province, china2017-12-11v4No1 / 622
883amnon high in depth (soil) 60-100cm compared to depth (soil) 0-20cm in soil oil contaminated soil shengli oilfield china yellow river delta oilfield 2022-03-20v4No1 / 627
667amnoncommon soil, topsoil, jiangxi province, forested area, coniferous forest biome, china, lushan mountain, elevation 1000-1100m, ph 4-4.5, depth (soil) 0-20cm2020-09-25v4No1 / 630
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 634
279amnon high in caecum colon compared to stomach small intestine in ochotonidae pika china 2018-01-24v4No1 / 634
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in summer autumn compared to spring in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 644
616amnon high in fertilized soil ph 5.5-6 compared to non-fertilized soil ph 6.7 in china soil topsoil guangzhou city prefecture saccharum sugarcane depth (soil) 0-20cm 2020-04-27v3No1 / 648
791sheryoCommon in highly saline sodic soil at 0cm depth in China (common soil, depth 0cm, high salinity, china, songnen plain, da'an station, salic solonetz, high sodicity, ph 10.5, depth (soil) 0-20cm)2021-06-07v4No1 / 648
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
25amnoncommon research facility, caecum, oryctolagus cuniculus, rex rabbit, sichuan province2016-12-01v4No1 / 669
561amnoncommon rumen, tibetan plateau, bos grunniens, yak, ruminal fluid, china, alpine meadow2019-11-05v3No1 / 670
791sheryoHigher in high sodicity and high salinity soil compared to low sodicity and low salinity soil at 0cm depth in China ( high in high salinity high sodicity ph 10.5 compared to low salinity low sodicity ph 8.5 in soil depth 0cm china songnen plain da'an station salic solonetz depth (soil) 0-20cm )2021-06-08v4No1 / 670
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, tobacco plant present)2020-04-21v4No1 / 671
791sheryoHigher at 80cm depth compared to 0cm depth in low saline low sodicity soil in China ( high in depth (soil) 80cm compared to depth 0cm depth (soil) 0-20cm in soil low salinity china songnen plain da'an station salic solonetz low sodicity ph 9 )2021-06-08v4No1 / 675
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
506amnoncommon soil, peat soil, northeast china, depth (soil) 0-10cm, boreal wetland, seasonal frozen marsh, wetland area, china2019-03-16v4No1 / 690
134amnon high in subtropical taxus mairei southeast china compared to temperate taxus media taxus cuspidata northeast china in rhizosphere tree taxus china 2017-04-16v4No1 / 694
667amnoncommon soil, topsoil, jiangxi province, ph 4.5, forested area, china, lushan mountain, elevation 800-900m, depth (soil) 0-20cm2020-09-25v4No1 / 694
824sheryoHigher at 20-40cm depth compared to 10-20cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 10-20cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 695
787amnoncommon control, research facility, rumen, ruminal fluid, capra hircus, china, shanxi province, goat, dairy goat2021-05-23v3No1 / 700
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common soil, zhejiang province, cucumber, fusarium oxysporum, china, bio-organic fertilizer, bacillus amyloliquefaciens sqr9)2021-03-15v3No1 / 701
746sheryoHigh in saline soil fertilized with biological fertilizer compared to chemical fertilizer, planted with tomatos, in dafeng, china ( high in trichoderma guizhouense njau 4742 biological fertilization chicken manure compared to chemical fertilization n,p,k in solanum lycopersicum jiangsu province solonchak china dafeng city saline soil ph 7.5 )2021-03-03v4No1 / 703
412amnon high in ph<5 compared to ph>5 in soil cambisol red soil zea mays triticum aestivum hunan province china 2018-11-26v4No1 / 706
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium officinale, flowerpot2021-06-20v4No1 / 715
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
752sheryoCommon in soil planted with Panax notoginseng (common soil, yunnan province, ph 6, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 730
134amnon high in temperate taxus media taxus cuspidata northeast china compared to subtropical taxus mairei southeast china in rhizosphere tree taxus china 2017-04-16v4No1 / 734
824sheryoHigher at 10-20cm depth compared to 0-10cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth (soil) 0-10cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 734
421amnoncommon in paddy field soil incubated with copper (common research facility, soil, paddy field soil, copper, zhejiang province, china)2018-12-02v4No1 / 740
735amnoncommon female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, restricted feed, sheep, female organism, china2021-01-22v3No1 / 744
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth 0cm depth (soil) 0-20cm compared to depth (soil) 80cm in soil low salinity china songnen plain da'an station salic solonetz low sodicity ph 9 )2021-06-08v4No1 / 748
271amnon high in rhizosphere glycine max soybean compared to soil in china depth (soil) 0-20cm 2018-01-09v4No1 / 750
735amnoncommon control, female, pregnancy, research facility, rumen, ovis aries, nanjing city prefecture, digesta, sheep, female organism, china2021-01-22v3No1 / 761
667amnoncommon soil, topsoil, jiangxi province, ph 4, forested area, coniferous forest biome, china, lushan mountain, elevation 1300-1400m, depth (soil) 0-20cm2020-09-25v4No1 / 777
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common soil, yunnan province, ph 6, biochar, china, panax notoginseng, pot expreiment, xundian county, sanqi plants)2021-03-11v3No1 / 783
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 790
454amnon high in summer compared to winter in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 791
478amnoncommon farm, intestine, litopenaeus vannamei, pacific white shrimp, china2019-02-19v4No1 / 795
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 807
746sheryoCommon in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (common solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, chemical fertilization n,p,k, saline soil, ph 7.5)2021-03-03v4No1 / 811
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, cultivated environment, china2018-12-02v4No1 / 821
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
415amnoncommon orchard, soil, rhizosphere, citrus, cultivated environment, china2018-11-27v4No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 831
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, strawberry, yellow brown soil, age 5 years, age 10 years, continuous cropping, cultivated environment, china2019-01-07v4No1 / 833
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 844
412amnoncommon soil, cambisol, red soil, zea mays, triticum aestivum, hunan province, ph>5, china2018-11-26v4No1 / 856
837sheryoHigher at 0-40cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia 10 years )2021-09-26v4No1 / 863
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common soil, compost biofilter, compost, pig manure, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa)2021-04-14v4No1 / 866
855sheryoCommon in soil depth of 75cm in fertilized soil in china (common soil, fertilized soil, agricultural field, china, luancheng county, depth 75cm)2021-12-27v3No1 / 873
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet)2021-04-14v4No1 / 875
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in low salinity low sodicity ph 9 compared to high salinity high sodicity ph 10 in soil china songnen plain da'an station salic solonetz depth (soil) 80cm )2021-06-08v4No1 / 895
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common soil, ph 7-8, depth 0-20cm, limestone, biochar, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 910
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common soil, ph 7-8, depth 0-20cm, limestone, fungicide, china, tobacco field, difenoconazole, without plants)2020-07-05v4No1 / 915
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, fusarium oxysporum f. sp. chrysanthemi)2021-04-14v4No1 / 922
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in low salinity low sodicity ph 8.5 compared to high salinity high sodicity ph 10.5 in soil depth 0cm china songnen plain da'an station salic solonetz depth (soil) 0-20cm )2021-06-08v4No1 / 932
359amnoncommon soil, subtropical broadleaf forest biome, topsoil, guangdong province, depth (soil) 0-10cm, woodland area, forest ecosystem, china2018-08-19v4No1 / 935
901amnon high in depth (sediment) 0-20cm compared to sediment surface depth (sediment) 0cm in lake sediment china taihu national park depth (water) 20-100cm taihu lake 2022-04-25v4No1 / 939
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common soil, china, nanjing county, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil fumigation, dazomet)2021-04-14v4No1 / 946
444amnoncommon in uncultivated soil plot (common soil, nanjing city prefecture, yellow brown soil, china)2019-01-07v4No1 / 946
701amnoncommon research facility, rumen, bos taurus, male, cow, rumen liquid, male organism, china, municipality of beijing, age 2 years2028-04-01v3No1 / 953
422amnoncommon soil, paddy field soil, oryza sativa, jiangsu province, cultivated environment, china2018-12-02v4No1 / 957
414amnon high in ph<6 npk fertilizer compared to ph>6 in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, china, ryegrass, days 30-40)2020-05-11v4No1 / 966
134amnoncommon rhizosphere, temperate, tree, taxus, taxus mairei, northeast china, china2017-04-16v4No1 / 973
675sheryoCommon in watermelon rhizosphere soil (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), un-inoculated)2028-02-22v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 989
746sheryoCommon in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (common solanum lycopersicum, jiangsu province, solonchak, china, dafeng city, trichoderma guizhouense njau 4742, saline soil, ph 7.5, biological fertilization, chicken manure)2021-03-03v4No1 / 993
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium moniliforme, flowerpot2021-06-20v4No1 / 1002
412amnon high in ph>5 compared to ph<5 in soil cambisol red soil zea mays triticum aestivum hunan province china 2018-11-26v4No1 / 1005
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common soil, rhizosphere, 10 cm depth, jiangsu province, ph 7-8, biochar, china, ryegrass, days 30-40)2020-05-11v4No1 / 1017
687amnon high in bos taurus chinese bohai black beef cattle chinese luxi yellow beef cattle compared to capra hircus goat chinese laoshan milk goat in research facility rumen rumen liquid shandong province china 2028-03-09v4No1 / 1022
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1023
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1025
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common soil, depth 0cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, depth (soil) 0-20cm)2021-06-07v4No1 / 1035
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in soil china grazing exclusion haplic calcisol calci-orthic aridisol ningxia province yunwushan national natural grassland protection zone )2021-08-08v4No1 / 1038
687amnoncommon research facility, rumen, bos taurus, rumen liquid, shandong province, china, chinese luxi yellow beef cattle2028-03-09v4No1 / 1039
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 1049
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 10 years)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 10 years)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth (soil) 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 40cm)2021-06-08v4No1 / 1085
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
765sheryocommon in wheat field in the loess plateau in china (common soil, triticum aestivum, silt loam, china, shanxi province, loess plateau, chromic cambisol, ph 7.7)2021-04-12v3No1 / 1087
454amnon high in wild compared to captive in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1094
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph<6, black soil, mollisol, npk fertilizer, china2018-11-26v4No1 / 1105
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common soil, compost biofilter, pig manure, compost soil, paenibacillus, china, nanjing county, chrysanthemum, bio-organic fertilizer, conventional tillage, chrysanthemum morifolium ramat., ph 6.9, paenibacillus polymyxa, soil fumigation, dazomet, deep plough)2021-04-18v4No1 / 1109
855sheryoHigher in soil depth of 75cm compared to soil depth of 10cm in fertilized soil in china ( high in depth 75cm compared to depth (water) 10cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 1112
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1113
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common soil, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 9, depth (soil) 80cm)2021-06-08v4No1 / 1128
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common soil, bulk soil, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1136
134amnoncommon rhizosphere, temperate, tree, taxus, taxus cuspidata, northeast china, china2017-04-16v4No1 / 1141
687amnoncommon research facility, rumen, bos taurus, rumen liquid, shandong province, china, chinese bohai black beef cattle2028-03-09v4No1 / 1147
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common soil, depth 20cm, low salinity, china, songnen plain, da'an station, salic solonetz, low sodicity, ph 8.5, ph 9)2021-06-08v4No1 / 1155
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, china, hainan autonomous prefecture, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1169
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
746sheryoCommon in saline soil in dafeng, china (common jiangsu province, solonchak, china, dafeng city, ph 7.6, saline soil)2021-03-03v4No1 / 1170
257amnoncommon in tilapia pond sediment (common pond, fishpond, sediment, freshwater sediment metagenome, tilapia, china)2017-11-26v4No1 / 1179
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, biochar, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common soil, rhizosphere, hordeum vulgare, zhejiang province, depth (soil) 15cm, ph 4-5, china, quzhou county, days 180, mature barley plants)2020-05-18v4No1 / 1209
571amnoncommon mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, rhizophora stylosa, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1210
204amnoncommon drinking water reservoir, sediment, water, china2017-10-02v4No1 / 1220
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 100-300cm)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in farm greenhouse soil rhizosphere fragaria x ananassa nanjing city prefecture strawberry yellow brown soil cultivated environment china )2019-01-07v4No1 / 1221
531amnoncommon farm, greenhouse soil, rhizosphere, cucumis sativus, orthic anthrosol, cucumber, china2019-07-21v3No1 / 1223
901amnon high in bulk sediment compared to rhizosphere in lake sediment china taihu national park depth (water) 20-100cm depth (sediment) 0-20cm taihu lake 2022-04-25v4No1 / 1228
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common soil, china, depth 40-60cm, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
901amnoncommon lake sediment, china, taihu national park, depth (water) 20-100cm, depth (sediment) 0-20cm, taihu lake2022-04-25v4No1 / 1246
800amnoncommon 7-18 days following heavy metal contamination (common lake, sediment, fresh water, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm, spring)2021-06-15v4No1 / 1248
134amnoncommon rhizosphere, temperate, tree, taxus, taxus media, northeast china, china2017-04-16v4No1 / 1251
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common soil, fertilized soil, depth (water) 10cm, agricultural field, china, luancheng county)2021-12-27v3No1 / 1253
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 40-100cm)2021-09-26v4No1 / 1263
675sheryoCommon in watermelon rhizosphere soil inoculated with Fusarium oxysporum f. sp. niveum (common rhizosphere, ph 7, citrullus lanatus, china, co culture with wheat (triticum aestivum l.), inoculated with fusarium oxysporum f. sp. niveum)2028-02-22v4No1 / 1271
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 20-40cm)2021-08-08v4No1 / 1274
616amnoncommon in topsoil of non-fertilized sugarcane field (common soil, topsoil, guangzhou city prefecture, non-fertilized soil, china, saccharum, sugarcane, ph 6.7, depth (soil) 0-20cm)2020-04-27v3No1 / 1277
414amnoncommon agricultural feature, soil, zea mays, glycine max, triticum aestivum, heilongjiang province, ph>6, black soil, mollisol, china2018-11-26v4No1 / 1282
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 20 years)2021-09-26v4No1 / 1294
420amnoncommon in soil of vegetables in organic plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1294
454amnon high in winter compared to summer in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1304
223amnoncommon ocean, sediment, marine sediment, east china sea, china2017-10-26v4No1 / 1311
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 40-100cm, 30 years)2021-09-26v4No1 / 1311
863amnon high in yuzhong county moschus chrysogaster alpine musk deer xinglong mountain national nature reserve compared to qilian county moschus berezovskii forest musk deer in feces farm captive deer china 2022-01-28v4No1 / 1311
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 10 years)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 20 years)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 20 years)2021-09-26v4No1 / 1323
783sheryocommon in desert soil in mongolia without water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, ambient precipitation, no water addition)2021-05-11v4No1 / 1324
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, arachis hypogaea, ph 5, peanut, china)2017-12-02v4No1 / 1334
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 0-40cm, 30 years)2021-09-26v4No1 / 1346
571amnoncommon mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, kandelia candel, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1351
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common soil, silt loam, reforestation, china, shaanxi province, loess plateau, robinia pseudoacacia, depth 100-300cm, 30 years)2021-09-26v4No1 / 1354
809amnoncommon research facility, rhizosphere, greenhouse, china, lu'an city prefecture, dendrobium huoshanense, flowerpot2021-06-20v4No1 / 1356
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 20-40cm)2021-08-08v4No1 / 1369
454amnon high in captive compared to wild in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1374
420amnoncommon in soil of vegetable open field (common agricultural feature, farm, soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1376
901amnoncommon in macrophyte plant rhizosphere (common lake sediment, rhizosphere, china, taihu national park, depth (water) 20-100cm, depth (sediment) 0-20cm, taihu lake)2022-04-25v4No1 / 1378
883amnon high in non-contaminated soil compared to oil contaminated soil oilfield in soil shengli oilfield china yellow river delta 2022-03-20v4No1 / 1381
420amnonhigh freq. in soil of vegetable in plastic tunnel (common agricultural feature, farm, soil, greenhouse soil, shanghai proper, ph>7, ph 7-8, npk fertilizer, clay loam, cultivated environment, china)2018-12-02v4No1 / 1396
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion, depth 10-20cm)2021-08-08v4No1 / 1397
422amnoncommon soil, paddy field soil, oryza sativa, hubei province, hunan province, cultivated environment, china2018-12-02v4No1 / 1399
40amnoncommon soil, field soil, rhizosphere, nicotiana tabacum, china2016-12-09v4No1 / 1420
571amnoncommon mangrove swamp, soil, marine sediment, mudflat, china, hainan autonomous prefecture, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1422
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1435
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, guangdong province, china, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1437
444amnoncommon farm, greenhouse soil, rhizosphere, fragaria x ananassa, nanjing city prefecture, age 1 year, strawberry, yellow brown soil, cultivated environment, china2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common soil, mongolia, sandy desert, bajada, china, dengkou county, ph 7.85, ulan buh desert, cambic arenosols, luvic gypsisols, water addition, 100% above ambient precipitation)2021-05-11v4No1 / 1442
414amnon high in ph>6 compared to ph<6 npk fertilizer in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 1451
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with chemical fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, chemical fertilization n,p,k, high fusarium cumulative disease incidence )2028-03-08v4No1 / 1456
271amnoncommon rhizosphere, glycine max, soybean, china, depth (soil) 0-20cm2018-01-09v4No1 / 1459
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common soil, zea mays, triticum aestivum, silt loam, agricultural field, china, shaanxi province, loess plateau, depth 0-40cm)2021-09-26v4No1 / 1470
34amnoncommon in mangrove rhizosphere (common mangrove swamp, rhizosphere, china)2016-12-06v4No1 / 1473
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common soil, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, depth 10-20cm)2021-08-08v4No1 / 1477
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, npk fertilizer, china, qiyang county, quaternary red clay, ph 5.9, npk fertilization)2021-04-06v4No1 / 1491
631sheryoCommon in maize field biochar amended rhizosphere soil (common soil, rhizosphere, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 7.85)2020-06-02v3No1 / 1492
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, no fertilization, ph 5.9)2021-04-06v4No1 / 1506
855sheryoHigher in soil depth of 75cm compared to soil depth of 175cm in fertilized soil in china ( high in depth 75cm compared to depth 175cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 1522
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1523
901amnoncommon lake sediment, sediment surface, china, taihu national park, depth (water) 20-100cm, taihu lake, depth (sediment) 0cm2022-04-25v4No1 / 1550
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, mudflat, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1587
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1593
863amnon high in qilian county moschus berezovskii forest musk deer compared to yuzhong county moschus chrysogaster alpine musk deer xinglong mountain national nature reserve in feces farm captive deer china 2022-01-28v4No1 / 1604
422amnon high in ph 5-6 compared to ph 7-8 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 1634
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1636
631sheryocommon in maize field unamended rhizosphere soil (common soil, rhizosphere, maize field, china, guizhou province, kaiyang county, unamended soil, after 6 years, ph 7.6)2020-06-02v3No1 / 1637
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1643
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, mudflat, china, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth (soil) 0-10cm, china, grazing exclusion, 27-35 years of grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone)2021-08-08v4No1 / 1659
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with fungal bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, low fusarium cumulative disease incidence , fungal enriched bio-fertilizer, trichoderma guizhouense njau 4742)2028-03-08v4No1 / 1661
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1668
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common soil, manured soil, rhizosphere, oryza sativa, hunan province, china, qiyang county, quaternary red clay, ph 5.9, manure fertilization)2021-04-06v4No1 / 1670
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 1678
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common soil, urea enriched soil, china, silty clay, triticum aestivum l. cv., xiaoyan no. 22)2020-04-20v4No1 / 1682
819amnon high in skin of cheek compared to scalp in homo sapiens female skin adult china age 25-45 years 2021-07-12v1No1 / 1684
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common soil, fertilized soil, topsoil, guangzhou city prefecture, china, saccharum, sugarcane, ph 5.5-6, depth (soil) 0-20cm)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in soil triticum aestivum wheat china )2017-07-02v4No1 / 1714
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with bacterial bio-fertilizer and had low Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, bacterial enriched bio-fertilizer, bacillus amyloliquefaciens w19, low fusarium cumulative disease incidence )2028-03-08v4No1 / 1726
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1747
686sheryoCommon in vanilla field soil infected with Fusarium oxysporum, fertilized with organic fertilizer and had high Fusarium cumulative disease incidence (common wanning city, vanilla planifolia, ph 7.6, pot expreiment, soil from vanilla field, fusarium oxysporum f. sp. vanillae, high fusarium cumulative disease incidence , organic fertilizer- chicken manure compost)2028-03-08v4No1 / 1765
631sheryoCommon in maize field unamended bulk soil (common soil, bulk soil, maize field, china, guizhou province, kaiyang county, unamended soil, ph 7.9)2020-06-02v3No1 / 1814
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in lake sediment china taihu national park depth (water) 20-100cm taihu lake 2022-04-25v4No1 / 1819
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common soil, bulk soil, maize field, biochar, china, guizhou province, kaiyang county, after 6 years, ph 8)2020-06-02v3No1 / 1872
156amnoncommon soil, rhizosphere, brassica oleracea, brassica, china2017-07-27v4No1 / 1885
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>4, ph<5, china, depth (soil) 0-20cm2018-02-11v4No1 / 1886
901amnon high in rhizosphere compared to bulk sediment in lake sediment china taihu national park depth (water) 20-100cm depth (sediment) 0-20cm taihu lake 2022-04-25v4No1 / 1892
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common soil, depth (soil) 0-10cm, china, grazing exclusion, haplic calcisol, calci-orthic aridisol, ningxia province, yunwushan national natural grassland protection zone, 0-9 years of grazing exclusion)2021-08-08v4No1 / 1903
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to summer autumn in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 1962
155amnoncommon in soil tightly bound to wheat root (common soil, triticum aestivum, wheat, root, china)2017-07-02v4No1 / 1977
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>7, ph<8, china, depth (soil) 0-20cm2018-02-11v4No1 / 2160
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>6, ph<7, china, depth (soil) 0-20cm2018-02-11v4No1 / 2223
296amnoncommon in wheat field soil (common agricultural feature, soil, winter, depth 5cm, wheat, north china plain, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common soil, rhizosphere, triticum aestivum, wheat, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common soil, bulk soil, triticum aestivum, wheat, china)2017-07-02v4No1 / 2594
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>8, china, depth (soil) 0-20cm2018-02-11v4No1 / 2646
271amnoncommon soil, china, depth (soil) 0-20cm2018-01-09v4No1 / 2856
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 20 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 30 years in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 2927
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in soil triticum aestivum wheat china )2017-07-02v4No1 / 2933
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in zea mays triticum aestivum agricultural field compared to reforestation robinia pseudoacacia 10 years in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 2994
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
837sheryoHigher in soil after 10 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3368
296amnoncommon agricultural feature, soil, winter, wheat, north china plain, ph>5, ph<6, china, depth (soil) 0-20cm2018-02-11v4No1 / 3508
837sheryoHigher in soil after 10 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3585
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 10 years compared to zea mays wheat agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 3936
271amnon high in soil compared to rhizosphere glycine max soybean in china depth (soil) 0-20cm 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in soil silt loam reforestation china shaanxi province loess plateau robinia pseudoacacia )2021-09-27v4No1 / 5270
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 30 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in reforestation robinia pseudoacacia 20 years compared to zea mays triticum aestivum agricultural field in soil silt loam china shaanxi province loess plateau )2021-09-26v4No1 / 5661
271amnon high in soil rhizosphere compared to root structure root in glycine max soybean china depth (soil) 0-20cm 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org