Summary for ontology term: city

Number of annotations with term: 101

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.053763
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.053763
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__ParasutterellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGTTGAGTAAGACAGATGTGAAATCCCCGAGCTTAACTCGGGAATGGCATATGTGACTGCTCGACTAGAGTGTGTCAGAGGGAGGTGGAATTCCACG0.053763
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.053763
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTATGTTTGAGGCAGGCGGAATGCGTGG0.043011
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGCTGTGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.043011
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.043011
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.043011
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.043011
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGTCTGAAGTGAAAGGCATGGGCTCAACCTGTGGACTGCTTTGGAAACTGTGCAGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.043011

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.400000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTTCATCAAGTAGGATGTGAAATCCCCGGGCTCAACCTGGGAACAGCATACTAAACTGGTGGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__AlloprevotellaTACGGAAGGTCCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACCTTTAAGTCAGCTGTGAAATACGGCGGCTCAACCGTCGAACTGCAGTTGATACTGGAGGTCTTGAGTGCACACAGGGATACTGGAATTCATGG0.400000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGCGCACGTAGGTGGTTCGACAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGATGTGCATTTGAAACTGTTGGACTCGAGTACTGTAGAGGGAGGTAGAATTCCAGG0.400000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.300000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.300000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTGGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.300000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGAATGCAAGTCAGATGTGAAATCCATGGGCTTAACCCATGAACTGCATTTGAAACTGTATTTCTTGAGTACTGGAGAGGCAATCGGAATTCCTAG0.300000
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGCGGCCGAGTAAGTCAGCGGTGAAAGACCGGGGCTCAACCCTGGAAGTGCCGTTGATACTGTTTGGCTGGAATGATCCCGCCGCGGGAGGAATGAGTGG0.300000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGG0.106870
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGTCTGAAGTGAAAGGCATGGGCTCAACCTGTGGACTGCTTTGGAAACTGTGCAGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.106145
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCAGGGCAAGTCAGATGTGAAATACTGGGGCTCAACCCCGGGACTGCATTTGAAACTGTCCGGCTAGAGTGCAGGAGAGGCAGGCGGAATTCCTAG0.105263
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGATCAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGATCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.104000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.103286
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACTGGAAAGTCAGAGGTGAAATCCCAGGGCTCAACCTTGGAACTGCCTTTGAAACTATCAGTCTGGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.103093
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCCTGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTAGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.102564
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.102088
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__HelicobacteraceaeTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGCGTGCGCAGGTGGAACATTAAGTCAGATGTGAAATCCTATAGCTTAACTATAGAACTGCATTTGAAACTGGTGATCTTGAGTGTGGGAGAGGTAGGTGGAACTCTTGG0.101010
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGCAGGCGGGCCGGTAAGTTGGAAGTGAAATCTATGGGCTTAACCCATAAACTGCTTTCAAAACTGCTGGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.100840

Annotations:

common ontology terms
term enrichment score
TermScore
city0.969805
hokkaido0.175182
LOWER IN city0.158730
coelomic fluid0.146789
starfish0.136752
late adult stage0.136752
colombia0.129730
air0.120301
rural community0.102128
small village0.092879
japan0.081911
state of colorado0.077419
homo sapiens0.076146
adult0.073749
patiria pectinifera0.073394
asterias amurensis0.073394
house mice0.073394
ivy0.073394
hedera hibernica0.073394
LOWER IN rural community0.071429
cameroon0.070796
hong kong0.070796
new york city0.062016
belgium0.060150
feces0.059771
lima0.057692
LOWER IN small village0.057143
vellore district0.056075
yaounde0.056075
soweto0.056075
urban community0.056075
el salvador0.056075
shantytown0.056075
wild0.054608
2-month-old human stage0.054545
state of oklahoma0.054545
venezuela0.054545
amerindian0.054545
LOWER IN venezuela0.054545
LOWER IN amerindian0.054545
saliva0.053435
hunter gatherer0.053097
LOWER IN hunter gatherer0.053097
gay0.053097
wastewater treatment plant0.051724
heterosexual0.051724
msw0.051724
south africa0.050955
homosexual0.050420
msm0.050420
dense settlement biome0.050420
china0.049986
india0.049180
supragingival plaque0.045802
leaf0.044199
boston0.038835
train0.038835
columbia0.038835
LOWER IN coelomic fluid0.038835
respirable suspended particulate matter0.038835
female0.038685
subway0.038095
LOWER IN asterias amurensis0.038095
xinxiang city prefecture0.038095
jiulong river0.038095
LOWER IN starfish0.038095
LOWER IN patiria pectinifera0.038095
low income0.038095
20-year-old human stage0.038095
sciurus carolinensis0.038095
madrid0.037383
human middle aged stage0.037383
waste water0.037383
fujian province0.037383
municipality of beijing0.037383
urban biome0.036697
depth (soil) 50cm0.036697
state of arizona0.036697
united states of america0.036356
province of ontario0.036036
dentition0.035294
infant0.033520
sea water0.033195
hospital0.033058
river0.032000
south america0.029740
kingdom of spain0.027972
LOWER IN wild0.026846
canada0.026490
fresh water0.025157
mouse0.024316
skin0.023952
LOWER IN sea water0.023392
mus musculus0.022663
LOWER IN lima0.019608
LOWER IN moor0.019608
moor0.019608
LOWER IN tunapuco0.019417
tunapuco0.019417
ngoantet0.019417
Fraction of dbbact annotations with this term covered by the query
TermScore
city1.050000
boston1.000000
train1.000000
coelomic fluid1.000000
columbia1.000000
LOWER IN coelomic fluid1.000000
LOWER IN lima1.000000
lima1.000000
LOWER IN moor1.000000
moor1.000000
respirable suspended particulate matter1.000000
LOWER IN small village0.750000
small village0.750000
vellore district0.500000
LOWER IN tunapuco0.500000
tunapuco0.500000
ngoantet0.500000
LOWER IN yaounde0.500000
yaounde0.500000
LOWER IN ngoantet0.500000
subway0.500000
low hdl0.500000
LOWER IN high hdl0.500000
bogota0.500000
LOWER IN municipality of santiago de cali0.500000
LOWER IN bucaramanga0.500000
LOWER IN barranquilla0.500000
municipality of santiago de cali0.500000
bucaramanga0.500000
barranquilla0.500000
LOWER IN bogota0.500000
high filber0.500000
LOWER IN low fiber0.500000
high hdl0.500000
LOWER IN low hdl0.500000
patiria pectinifera0.500000
LOWER IN asterias amurensis0.500000
starfish0.500000
normal stool0.500000
LOWER IN hard stool0.500000
hard stool0.500000
LOWER IN normal stool0.500000
low fiber0.500000
bushbuckridge local municipality0.500000
peri-urban community0.500000
LOWER IN soweto0.500000
LOWER IN urban community0.500000
soweto0.500000
urban community0.500000
LOWER IN bushbuckridge local municipality0.500000
LOWER IN peri-urban community0.500000
xinxiang city prefecture0.500000
jiulong river0.500000
late adult stage0.500000
asterias amurensis0.500000
LOWER IN starfish0.500000
LOWER IN patiria pectinifera0.500000
el salvador0.500000
LOWER IN shantytown0.500000
shantytown0.500000
LOWER IN el salado0.500000
low income0.500000
LOWER IN sewage0.500000
sewage0.500000
dental caries0.500000
20-year-old human stage0.500000
house mice0.500000
queens region0.500000
LOWER IN manhatten region0.500000
manhatten region0.500000
LOWER IN queens region0.500000
sciurus carolinensis0.500000
LOWER IN dental caries0.500000
ivy0.500000
hedera hibernica0.500000
LOWER IN city0.400000
LOWER IN rural community0.363636
rural community0.363636
2-month-old human stage0.333333
state of oklahoma0.333333
LOWER IN state of oklahoma0.333333
cameroon0.333333
venezuela0.333333
amerindian0.333333
LOWER IN venezuela0.333333
LOWER IN amerindian0.333333
madrid0.333333
hong kong0.333333
medellin metropolitan area0.333333
LOWER IN medellin metropolitan area0.333333
lean body mass0.333333
LOWER IN lean body mass0.333333
plant fiber cell0.333333
hokkaido0.333333
LOWER IN plant fiber cell0.333333
human middle aged stage0.333333
waste water0.333333
fujian province0.333333
LOWER IN influent0.333333
influent0.333333
Fraction of annotations for the query sequences containing the term
TermScore
city0.900990
homo sapiens0.613861
feces0.485149
adult0.415842
united states of america0.178218
china0.178218
colombia0.118812
hokkaido0.118812
japan0.118812
LOWER IN city0.099010
air0.079208
coelomic fluid0.079208
wild0.079208
starfish0.079208
late adult stage0.079208
saliva0.069307
rural community0.059406
state of colorado0.059406
small village0.049505
female0.049505
LOWER IN rural community0.039604
LOWER IN united states of america0.039604
cameroon0.039604
hong kong0.039604
patiria pectinifera0.039604
south africa0.039604
sea water0.039604
asterias amurensis0.039604
south america0.039604
mus musculus0.039604
new york city0.039604
mouse0.039604
house mice0.039604
leaf0.039604
belgium0.039604
ivy0.039604
hedera hibernica0.039604
infant0.029703
vellore district0.029703
india0.029703
2-month-old human stage0.029703
state of oklahoma0.029703
LOWER IN small village0.029703
yaounde0.029703
venezuela0.029703
amerindian0.029703
hunter gatherer0.029703
LOWER IN venezuela0.029703
LOWER IN amerindian0.029703
LOWER IN hunter gatherer0.029703
soweto0.029703
urban community0.029703
el salvador0.029703
lima0.029703
shantytown0.029703
wastewater treatment plant0.029703
dentition0.029703
supragingival plaque0.029703
gay0.029703
homosexual0.029703
msm0.029703
heterosexual0.029703
msw0.029703
dense settlement biome0.029703
LOWER IN control0.019802
urban biome0.019802
boston0.019802
train0.019802
skin0.019802
kingdom of spain0.019802
madrid0.019802
subway0.019802
LOWER IN asterias amurensis0.019802
columbia0.019802
human middle aged stage0.019802
waste water0.019802
hospital0.019802
xinxiang city prefecture0.019802
river0.019802
water0.019802
fresh water0.019802
fujian province0.019802
depth (soil) 50cm0.019802
jiulong river0.019802
LOWER IN sea water0.019802
LOWER IN coelomic fluid0.019802
LOWER IN wild0.019802
LOWER IN starfish0.019802
LOWER IN patiria pectinifera0.019802
low income0.019802
state of arizona0.019802
20-year-old human stage0.019802
canada0.019802
province of ontario0.019802
sciurus carolinensis0.019802
grey squirrel0.019802
respirable suspended particulate matter0.019802
municipality of beijing0.019802
pm100.019802
probiotics0.009901
Exp. ID User ID Description Date Region Flag Sequences
682amnondominant city, air, kingdom of spain, madrid2028-03-04v3No1 / 4
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in feces homo sapiens city adult colombia )2019-01-10v4No1 / 4
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in homo sapiens city infant vellore district india 2-month-old human stage )2018-05-14v4No1 / 5
550amnondominant city, coelomic fluid, hokkaido, wild, starfish, patiria pectinifera, japan2019-08-18v4No1 / 5
550amnon high in coelomic fluid wild starfish asterias amurensis compared to sea water in city hokkaido japan 2019-08-18v4No1 / 5
519amnon high in control compared to dental caries in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 5
550amnondominant city, coelomic fluid, hokkaido, wild, starfish, asterias amurensis, japan2019-08-18v4No1 / 6
550amnon high in asterias amurensis compared to patiria pectinifera in city coelomic fluid hokkaido wild starfish japan 2019-08-18v4No1 / 7
332amnoncommon homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 8
332amnondominant homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 9
519amnon high in dental caries compared to control in homo sapiens city saliva late adult stage adult china 2019-06-25v3No1 / 10
195amnonhigh freq. in boston subway surfaces (dominant city, urban biome, boston, train)2017-09-07v4No1 / 11
475amnonhigh freq. in air in subway train in hong kong (dominant city, air, hong kong, subway)2019-01-20v4No1 / 11
513amnondominant city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 11
594amnondominant feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
861amnondominant feces, homo sapiens, female, city, south africa, rural community, soweto, urban community2022-01-15v3No1 / 13
475amnonhigh freq. in air next to subway stations in hong kong (dominant city, air, hong kong)2019-01-20v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in feces homo sapiens city adult colombia 2018-11-20v4No1 / 14
290amnon high in city compared to small village rural community in feces homo sapiens adult china 2018-02-01v4No1 / 14
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 14
276amnondominant feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 15
550amnoncommon city, coelomic fluid, hokkaido, wild, starfish, asterias amurensis, japan2019-08-18v4No1 / 15
550amnon high in coelomic fluid wild starfish patiria pectinifera compared to sea water in city hokkaido japan 2019-08-18v4No1 / 15
519amnondominant homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 16
878amnondominant city, air, respirable suspended particulate matter, china, municipality of beijing, pm102022-03-11v3No1 / 16
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in feces homo sapiens city adult colombia )2019-01-10v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 17
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 18
519amnondominant homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 18
128amnondominant city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 18
404amnondominant feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 19
550amnondominant city, sea water, hokkaido, japan2019-08-18v4No1 / 20
404amnon high in normal stool compared to hard stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 21
290amnon high in small village rural community compared to city in feces homo sapiens adult china 2018-02-01v4No1 / 21
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 21
404amnonpositively correlated with fiber intake ( high in plant fiber cell high filber compared to low fiber in feces homo sapiens city adult colombia )2018-11-20v4No1 / 22
53amnondominant feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 23
371amnonhigher in saliva of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens saliva )2018-09-06v4No1 / 24
290amnondominant feces, homo sapiens, city, adult, china2018-02-01v4No1 / 25
53amnondominant feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 25
404amnon high in hard stool compared to normal stool in feces homo sapiens city adult columbia 2018-11-20v4No1 / 27
404amnonnegatively correlated with fiber intake ( high in low fiber compared to high fiber plant fiber cell in feces homo sapiens city adult colombia )2018-11-20v4No1 / 32
519amnon high in dentition supragingival plaque compared to saliva in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 56
371amnonlower in saliva of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens saliva )2018-09-06v4No1 / 60
682amnoncommon city, air, kingdom of spain, madrid2028-03-04v3No1 / 67
594amnon high in city yaounde compared to rural community ngoantet in feces homo sapiens adult cameroon 2020-03-12v4No1 / 70
404amnon high in municipality of santiago de cali bucaramanga barranquilla compared to bogota medellin metropolitan area in feces homo sapiens city adult colombia 2018-11-20v4No1 / 71
861amnoncommon feces, homo sapiens, female, city, south africa, rural community, soweto, urban community2022-01-15v3No1 / 73
404amnoncommon feces, homo sapiens, city, adult, colombia2018-11-20v4No1 / 79
404amnon high in lean body mass low bmi compared to high bmi in feces homo sapiens city adult colombia 2018-11-20v4No1 / 84
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
550amnoncommon city, coelomic fluid, hokkaido, wild, starfish, patiria pectinifera, japan2019-08-18v4No1 / 85
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
404amnon high in female compared to male in feces homo sapiens city adult colombia 2018-11-20v4No1 / 88
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
519amnoncommon homo sapiens, city, dentition, late adult stage, adult, supragingival plaque, china2019-06-25v3No1 / 104
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
195amnoncommon in boston subway surfaces (common city, urban biome, boston, train)2017-09-07v4No1 / 116
393amnon high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 121
519amnoncommon homo sapiens, city, saliva, late adult stage, adult, china2019-06-25v3No1 / 134
475amnoncommon in air next to subway stations in hong kong (common city, air, hong kong)2019-01-20v4No1 / 147
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
594amnoncommon feces, homo sapiens, city, adult, cameroon, yaounde2020-03-12v4No1 / 154
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
519amnon high in saliva compared to dentition supragingival plaque in homo sapiens city late adult stage adult china 2019-06-25v3No1 / 159
475amnoncommon in air in subway train in hong kong (common city, air, hong kong, subway)2019-01-20v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 162
337amnoncommon in feces of house mice from new york city (common united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 165
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
594amnon high in rural community ngoantet compared to city yaounde in feces homo sapiens adult cameroon 2020-03-12v4No1 / 172
861amnon high in city soweto urban community compared to rural community bushbuckridge local municipality peri-urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 185
550amnon high in sea water compared to coelomic fluid wild starfish patiria pectinifera in city hokkaido japan 2019-08-18v4No1 / 185
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens skin )2018-09-06v4No1 / 195
878amnoncommon city, air, respirable suspended particulate matter, china, municipality of beijing, pm102022-03-11v3No1 / 203
53amnon high in lima shantytown compared to el salado small village in feces homo sapiens city 2017-01-21v4No1 / 236
404amnon high in bogota medellin metropolitan area compared to municipality of santiago de cali bucaramanga barranquilla in feces homo sapiens city adult colombia 2018-11-20v4No1 / 237
550amnon high in patiria pectinifera compared to asterias amurensis in city coelomic fluid hokkaido wild starfish japan 2019-08-18v4No1 / 278
128amnonhigher in ivy leaves from city compared to moor and forest ( high in city dense settlement biome compared to moor forest ecosystem in leaf belgium ivy hedera hibernica )2017-04-14v4No1 / 287
861amnon high in rural community bushbuckridge local municipality peri-urban community compared to city soweto urban community in feces homo sapiens female south africa human middle aged stage 2022-01-15v3No1 / 289
550amnoncommon city, sea water, hokkaido, japan2019-08-18v4No1 / 291
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
550amnon high in sea water compared to coelomic fluid wild starfish asterias amurensis in city hokkaido japan 2019-08-18v4No1 / 389
906amnon high in forested area compared to city in feces canada province of ontario sciurus carolinensis grey squirrel 2022-05-19v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
906amnon high in city compared to forested area in feces canada province of ontario sciurus carolinensis grey squirrel 2022-05-19v4No1 / 421
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
128amnoncommon city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 461
254amnonlower in river when close to populated region compared to downstream ( high in downstream compared to populated place city upstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 468
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
128amnonhigher in ivy leaves from moor and forest compared to city ( high in moor forest ecosystem compared to city dense settlement biome in leaf belgium ivy hedera hibernica )2017-04-14v4No1 / 525
53amnonhigher in wastewater plant effluent compared to influent and sewer in south america ( high in effluent compared to sewage influent in city wastewater treatment plant south america )2017-01-21v4No1 / 657
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854

Problems / suggestions? Please email info AT dbbact DOT org