Summary for ontology term: clostridium difficile infection

Number of annotations with term: 10

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__PeptostreptococcaceaeTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGGGATGTGAAATACCCGGGCTCAACCTGGGTGCTGCATTCCAAACTGGAAATCTAGAGTGCAGGAGGGGAAAGTGGAATTCCTAG0.111111
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTGGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGACACTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FlavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGCAAGTCAGATGTGAAAACTGGGGGCTCAACCTCCAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.111111
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__Clostridium XVIIITACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCAGCAAGGGTCTGTGGTGAAAGCCTGAAGCTTAACTTCAGTAAGCCATAGAAACCAGGCAGCTAGAGTGCAGGAGAGGATCGTGGAATTCCATGT0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGCATGGTAAGTCAGAAGTGAAAGCCCGGGGCTTAACCCCGGGACTGCTTTTGAAACTGTCATGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.111111
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTGTTCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.111111

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATTTCGGGGCTCAACCCTGAACGTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGTCAGGAGTTAAAGGCTACGGCTCAACCGTAGTAAGCTCCTGATACTGTCTGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGACACTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.181818
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhodobiaceae;g__LutibaculumTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACTGTTAAGTCAGGGGTGAAATCCCGAGGCTCAACCTCGGAACAGCCTCTGATACTGGCAGTCTTGAGTCCGAGAGAGGTGAGTGGAATTCCGAG0.181818
d__BacteriaTACGTAAGAGACTAGCGTTATTCATCTTAATTAGGTTTAAAGGGTACTCAAACGGTCAATATGACATTTAGGATGTTATTACTTGACTAGAGTTATATATAAGGAGGCAGTACTTTAGGAGGAGAGATTATATTCAATGATACCGAAAGG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__PeptostreptococcaceaeTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.137931
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGAGAGCCTGAACCAGCCAAGTAGCGTGAAGGATGACCGCCCTATGGGTTGTAAACTTCTTTTATATGGGAATAAAGGGTGCCACGTGTGGCATTTTGTATGTACCATATGAATAAGGATCGGCTAACT0.133333
d__BacteriaAACATAGGTCACGAGCATTATCCGGATTTATTGGGCGTAAAGGAAGCGTAGGCGGGGAGGTTGATCCATTGTTAAAAGCATTTGCTTAACAAATGTGTGCATTGGAGATCGCCTCCCTAGAGTTAATCAGGGGGTACTGGAATTCAATGT0.100000
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGCTTGGCAAGTTGGTAGCGTAATTCCGAGGCTCAACCTCGGCGCTACTACCAAAACTGTCAGGCTCGAGTGCAGGAGGGGTAAGTGGAATTCCTAG0.095238
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTGTTCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.090909
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Chitinophagaceae;g__HydrotaleaTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGCGGGTATGTAAGTCAGTGGTGAAATACCGGAGCTTAACTTCGGAACTGCCATTGATACTATATATCTTGAATATTGTGGAGGTAAGCGGAATATGTCA0.086957
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.086957

Annotations:

common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
702amnon high in control compared to clostridium difficile infection in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 1
689amnon high in non c. diff diarrhea compared to clostridium difficile colitis clostridium difficile infection in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 1
689amnon high in clostridium difficile colitis clostridium difficile infection compared to non c. diff diarrhea in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 3
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 6
868amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 6
868amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 13
728amnoncommon feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 16
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
728amnondominant feces, homo sapiens, hospital, adult, kingdom of spain, clostridium difficile intestinal infectious disease, clostridium difficile infection, valladolid2021-01-05v3No1 / 21
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22

Problems / suggestions? Please email info AT dbbact DOT org