![]() |
||||||
Taxonomy | Sequence | Recall |
---|---|---|
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__Alistipes | TACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATTTCGGGGCTCAACCCTGAACGTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG | 0.333333 |
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XI | TACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGTCAGGAGTTAAAGGCTACGGCTCAACCGTAGTAAGCTCCTGATACTGTCTGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT | 0.333333 |
Term | Score |
---|---|
clostridium difficile infection | 0.800000 |
clostridium difficile colitis | 0.500000 |
tucson | 0.444444 |
LOWER IN clostridium difficile infection | 0.307692 |
hospital | 0.300000 |
valladolid | 0.285714 |
province of alberta | 0.250000 |
clostridium difficile intestinal infectious disease | 0.181818 |
LOWER IN clostridium difficile colitis | 0.166667 |
state of north carolina | 0.166667 |
LOWER IN non c. diff diarrhea | 0.153846 |
non c. diff diarrhea | 0.153846 |
diarrhea | 0.142857 |
LOWER IN iga negative fraction | 0.105263 |
iga positive fraction | 0.105263 |
LOWER IN iga positive fraction | 0.105263 |
iga negative fraction | 0.105263 |
human adult stage | 0.083333 |
kingdom of spain | 0.068966 |
dog | 0.062500 |
canada | 0.060606 |
canis lupus familiaris | 0.055556 |
adult | 0.028605 |
feces | 0.020672 |
homo sapiens | 0.018363 |
united states of america | 0.014019 |
LOWER IN control | 0.009709 |
control | 0.009479 |
Term | Score |
---|---|
clostridium difficile infection | 0.800000 |
LOWER IN clostridium difficile infection | 0.666667 |
valladolid | 0.500000 |
clostridium difficile colitis | 0.500000 |
tucson | 0.500000 |
LOWER IN clostridium difficile colitis | 0.500000 |
province of alberta | 0.333333 |
LOWER IN non c. diff diarrhea | 0.333333 |
non c. diff diarrhea | 0.333333 |
hospital | 0.200000 |
clostridium difficile intestinal infectious disease | 0.166667 |
state of north carolina | 0.142857 |
LOWER IN iga negative fraction | 0.111111 |
iga positive fraction | 0.111111 |
LOWER IN iga positive fraction | 0.111111 |
iga negative fraction | 0.111111 |
diarrhea | 0.111111 |
human adult stage | 0.052632 |
kingdom of spain | 0.041667 |
dog | 0.037037 |
canada | 0.035714 |
canis lupus familiaris | 0.032258 |
adult | 0.014563 |
feces | 0.010444 |
homo sapiens | 0.009288 |
united states of america | 0.007092 |
LOWER IN control | 0.005102 |
control | 0.004975 |
Term | Score |
---|---|
feces | 1.000000 |
clostridium difficile infection | 0.800000 |
adult | 0.800000 |
homo sapiens | 0.800000 |
united states of america | 0.600000 |
hospital | 0.600000 |
clostridium difficile colitis | 0.500000 |
tucson | 0.400000 |
canis lupus familiaris | 0.200000 |
dog | 0.200000 |
state of north carolina | 0.200000 |
LOWER IN clostridium difficile infection | 0.200000 |
valladolid | 0.200000 |
kingdom of spain | 0.200000 |
clostridium difficile intestinal infectious disease | 0.200000 |
human adult stage | 0.200000 |
province of alberta | 0.200000 |
canada | 0.200000 |
diarrhea | 0.200000 |
LOWER IN control | 0.100000 |
control | 0.100000 |
LOWER IN iga negative fraction | 0.100000 |
iga positive fraction | 0.100000 |
LOWER IN iga positive fraction | 0.100000 |
iga negative fraction | 0.100000 |
LOWER IN non c. diff diarrhea | 0.100000 |
LOWER IN clostridium difficile colitis | 0.100000 |
non c. diff diarrhea | 0.100000 |
Term | Score |
---|---|
clostridium difficile infection | 4.000000 |
feces | 4.000000 |
adult | 3.000000 |
homo sapiens | 3.000000 |
united states of america | 2.000000 |
LOWER IN clostridium difficile infection | 2.000000 |
hospital | 2.000000 |
clostridium difficile colitis | 2.000000 |
LOWER IN control | 1.000000 |
canis lupus familiaris | 1.000000 |
dog | 1.000000 |
state of north carolina | 1.000000 |
control | 1.000000 |
valladolid | 1.000000 |
kingdom of spain | 1.000000 |
clostridium difficile intestinal infectious disease | 1.000000 |
LOWER IN iga negative fraction | 1.000000 |
iga positive fraction | 1.000000 |
human adult stage | 1.000000 |
province of alberta | 1.000000 |
canada | 1.000000 |
LOWER IN iga positive fraction | 1.000000 |
iga negative fraction | 1.000000 |
LOWER IN non c. diff diarrhea | 1.000000 |
diarrhea | 1.000000 |
tucson | 1.000000 |
LOWER IN clostridium difficile colitis | 1.000000 |
non c. diff diarrhea | 1.000000 |
Problems / suggestions? Please email info AT dbbact DOT org