![]() |
||||||
Taxonomy | Sequence | Recall |
---|---|---|
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__Alistipes | TACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATTTCGGGGCTCAACCCTGAACGTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG | 0.333333 |
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XI | TACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGTCAGGAGTTAAAGGCTACGGCTCAACCGTAGTAAGCTCCTGATACTGTCTGACTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT | 0.333333 |
Term | Score |
---|---|
clostridium difficile infection | 0.888889 |
clostridium difficile colitis | 0.571429 |
tucson | 0.444444 |
hospital | 0.300000 |
LOWER IN clostridium difficile infection | 0.285714 |
valladolid | 0.285714 |
province of alberta | 0.285714 |
diarrhea | 0.285714 |
state of north carolina | 0.181818 |
clostridium difficile intestinal infectious disease | 0.181818 |
LOWER IN non c. diff diarrhea | 0.153846 |
non c. diff diarrhea | 0.153846 |
LOWER IN clostridium difficile colitis | 0.153846 |
iga positive fraction | 0.133333 |
LOWER IN iga negative fraction | 0.133333 |
iga negative fraction | 0.133333 |
LOWER IN iga positive fraction | 0.133333 |
kingdom of spain | 0.076923 |
human adult stage | 0.074074 |
dog | 0.071429 |
canada | 0.066667 |
canis lupus familiaris | 0.064516 |
adult | 0.033946 |
feces | 0.025157 |
homo sapiens | 0.021838 |
united states of america | 0.015979 |
LOWER IN control | 0.010256 |
control | 0.010256 |
Term | Score |
---|---|
clostridium difficile infection | 1.000000 |
clostridium difficile colitis | 0.666667 |
LOWER IN clostridium difficile infection | 0.500000 |
valladolid | 0.500000 |
province of alberta | 0.500000 |
diarrhea | 0.500000 |
tucson | 0.500000 |
LOWER IN non c. diff diarrhea | 0.333333 |
non c. diff diarrhea | 0.333333 |
LOWER IN clostridium difficile colitis | 0.333333 |
hospital | 0.200000 |
iga positive fraction | 0.200000 |
LOWER IN iga negative fraction | 0.200000 |
iga negative fraction | 0.200000 |
LOWER IN iga positive fraction | 0.200000 |
state of north carolina | 0.166667 |
clostridium difficile intestinal infectious disease | 0.166667 |
kingdom of spain | 0.047619 |
human adult stage | 0.045455 |
dog | 0.043478 |
canada | 0.040000 |
canis lupus familiaris | 0.038462 |
adult | 0.017341 |
feces | 0.012739 |
homo sapiens | 0.011070 |
united states of america | 0.008097 |
LOWER IN control | 0.005405 |
control | 0.005405 |
Term | Score |
---|---|
feces | 1.000000 |
clostridium difficile infection | 0.800000 |
homo sapiens | 0.800000 |
adult | 0.800000 |
united states of america | 0.600000 |
hospital | 0.600000 |
clostridium difficile colitis | 0.500000 |
tucson | 0.400000 |
canis lupus familiaris | 0.200000 |
state of north carolina | 0.200000 |
dog | 0.200000 |
LOWER IN clostridium difficile infection | 0.200000 |
kingdom of spain | 0.200000 |
clostridium difficile intestinal infectious disease | 0.200000 |
valladolid | 0.200000 |
canada | 0.200000 |
province of alberta | 0.200000 |
human adult stage | 0.200000 |
diarrhea | 0.200000 |
LOWER IN control | 0.100000 |
control | 0.100000 |
iga positive fraction | 0.100000 |
LOWER IN iga negative fraction | 0.100000 |
iga negative fraction | 0.100000 |
LOWER IN iga positive fraction | 0.100000 |
LOWER IN non c. diff diarrhea | 0.100000 |
non c. diff diarrhea | 0.100000 |
LOWER IN clostridium difficile colitis | 0.100000 |
Problems / suggestions? Please email info AT dbbact DOT org