Summary for ontology term: colitis

Number of annotations with term: 60

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.210526
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.157895
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.131579
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG0.131579
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ButyricimonasTACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGCGCGTAGGCGGGACGTCAAGTCAGCGGTAAAAGACTGCAGCTAAACTGTAGCACGCCGTTGAAACTGGCGCCCTGGAGACGAGACGAGGGAGGCGGAACAAGTGAA0.131579
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.105263
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.105263
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTTTGGAAACTGTGCTGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.105263
d__BacteriaTACGGAGGATGCAAGCGTTATCCGGAATTATTGGGTTTAAAGGGTCCGCAGGCGGCCCGTTAAGTCAGTAGTGAAAACCCGGGGCTCAACCCCGGACGTGCTACAGATACTGGCGGGCTAGAGAAAGTCTGGAGGCAGCGGAATGTGACA0.105263
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.105263

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCATGATAAGTCTGATGTGAAAACCCAAGGCTCAACCATGGGACTGCATTGGAAACTGTCGTGCTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.411765
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.411765
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.411765
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.352941
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGCTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGATACTGGTGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.352941
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATTTCGGGGCTCAACCCTGAACGTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.352941
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAATCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.294118
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCAGTCTTGAGTGCAGTAGAGGTGGGCGGAATTCGTGG0.294118
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGATTGGCAAGTCAGAAGTGAAATCCATGGGCTTAACCCATGAACTGCTTTTGAAACTGTTAGTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.294118
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.294118

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGCCGGTAAGTCAGCGGTAAAATAGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGCCGGTCTTGAGTGGGCGAGAAGTGCGCGGAATGCGTGGT0.208333
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCTGTTAAGTCAGCGGTAAAATTGCGGGGCTCAACCTCGCCGAGCCGTTGAAACTGGTAGACTTGAGTGGGCGAGAAGTACGCGGAATGCGTGGT0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGGGCGCAGACGGCAGTGCAAGCCAGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTTGGAACTGCAAAGCTGGAGTGCAGGAGGGGCAGGCGGAATTCCTGG0.186047
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATCTCAAGTCAGCGGTCAAATCGTGGGGCCCAACCCCATTCCGCCGTTGAAACTGGGATTCTTGAGGGATCGAGAGGTATGCGGAATGCGTGGT0.177778
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATTTCAAGTCAGCGGTCAAATCGTGGGGCCCAACCCCATTCCGCCGTTGAAACTGGGATTCTTGAGAGATCGAGAGGTATGCGGAATGCGTGGT0.170213
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATGGTAAGTCAGATGTGAAATACCGGGGCTCAACTCCGGGGCTGCATTTGAAACTGCCGTTCTTGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.170213
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGACGGTAAGTCAGCGGTAAAAATGCGGAGCTCAACTCCGTCGAGCCGTTGAAACTGCCGTTCTTGAGTGAGCGAGAAGTATGCGGAATGCGTGGT0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGAATGTCAAGTCAGCGGTCAAATCGCGGGGCTCAACCTCGCTTCGCCGTTGAAACTGGTGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGACAGTTAAGTCAGCGGTAAAATAGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGGCAGTCTAGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.166667
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCATTTCAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTAGAGCCGTTGAGACTGAGGAGCTAGAGACGGCGAGAGGTACGCGGAATGCGCAGT0.166667

Annotations:

common ontology terms
term enrichment score
TermScore
ulcerative colitis0.679612
LOWER IN ulcerative colitis0.363354
colitis0.262626
LOWER IN colitis0.200000
crohn's disease0.195122
clostridium difficile colitis0.181818
rat0.166667
sprague dawley0.160000
child0.150538
biopsy0.142857
clostridium difficile infection0.142857
LOWER IN crohn's disease0.131148
rectum0.129032
human adult stage0.125749
tucson0.117647
control0.114286
rattus0.108108
feces0.107784
LOWER IN control0.106122
guangzhou city prefecture0.100000
tnbs0.090909
acute severe colitis0.090909
adult organism0.086957
equus caballus0.083333
horse0.083333
commonwealth of pennsylvania0.083333
biopsy site0.083333
homo sapiens0.083292
intestinal mucosa0.080000
hospital0.080000
united states of america0.075259
adult0.073198
rattus norvegicus0.068966
atlanta0.064516
age<17 years0.062500
province of alberta0.062500
mild0.062500
LOWER IN severe0.062500
severe0.062500
LOWER IN mild0.062500
diarrhea0.062500
wistar rat0.060606
research facility0.058797
antibiotic0.055556
china0.053251
adolescent stage0.052632
LOWER IN antibiotic0.052632
czech republic0.052632
obsolete_juvenile stage0.050000
state of california0.048780
inflammatory bowel disease0.047619
israel0.042553
c57bl/60.041667
male0.041667
mouse0.041237
mus musculus0.038835
canada0.036364
LOWER IN tnbs0.032258
LOWER IN dnbs induced colitis0.032258
dnbs induced colitis0.032258
dss induced colitis0.032258
LOWER IN dss induced colitis0.032258
before antibiotics0.032258
LOWER IN amoxicillin0.032258
LOWER IN doxycycline0.032258
LOWER IN sulfasalazine0.032258
sulfasalazine0.032258
humanized mouse0.031746
LOWER IN non c. diff diarrhea0.031746
non c. diff diarrhea0.031746
LOWER IN clostridium difficile colitis0.031746
LOWER IN vancomycin0.031250
LOWER IN biopsy site0.031250
LOWER IN clostridium difficile infection0.031250
iga positive fraction0.030769
LOWER IN iga negative fraction0.030769
iga negative fraction0.030769
LOWER IN iga positive fraction0.030769
immature stage0.030769
clostridium difficile intestinal infectious disease0.030303
LOWER IN metronidazole0.029851
balb/c0.029412
state of texas0.029412
LOWER IN biopsy0.029412
LOWER IN rectum0.028169
LOWER IN inflammatory bowel disease0.024390
LOWER IN child0.020833
LOWER IN feces0.005348
LOWER IN antibiotics induced colitis0.000000
antibiotics induced colitis0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN crohn&#39;s disease4.000000
crohn's disease4.000000
ulcerative colitis1.250000
LOWER IN ulcerative colitis1.125000
clostridium difficile colitis1.000000
atlanta1.000000
age<17 years0.500000
LOWER IN tnbs0.500000
tnbs0.500000
clostridium difficile infection0.500000
province of alberta0.500000
LOWER IN dnbs induced colitis0.500000
dnbs induced colitis0.500000
dss induced colitis0.500000
LOWER IN dss induced colitis0.500000
acute severe colitis0.500000
before antibiotics0.500000
LOWER IN amoxicillin0.500000
LOWER IN doxycycline0.500000
LOWER IN sulfasalazine0.500000
sulfasalazine0.500000
mild0.500000
LOWER IN severe0.500000
severe0.500000
LOWER IN mild0.500000
diarrhea0.500000
tucson0.500000
LOWER IN colitis0.400000
humanized mouse0.333333
colitis0.333333
wistar rat0.333333
LOWER IN non c. diff diarrhea0.333333
non c. diff diarrhea0.333333
LOWER IN clostridium difficile colitis0.333333
LOWER IN vancomycin0.250000
LOWER IN biopsy site0.250000
biopsy0.250000
biopsy site0.250000
LOWER IN clostridium difficile infection0.250000
guangzhou city prefecture0.200000
sprague dawley0.200000
iga positive fraction0.200000
LOWER IN iga negative fraction0.200000
iga negative fraction0.200000
LOWER IN iga positive fraction0.200000
intestinal mucosa0.200000
rectum0.181818
clostridium difficile intestinal infectious disease0.166667
rat0.166667
LOWER IN metronidazole0.142857
human adult stage0.136364
balb/c0.125000
state of texas0.125000
adolescent stage0.125000
LOWER IN antibiotic0.125000
adult organism0.125000
czech republic0.125000
LOWER IN biopsy0.125000
rattus0.117647
child0.111111
equus caballus0.111111
horse0.111111
commonwealth of pennsylvania0.111111
obsolete_juvenile stage0.100000
hospital0.100000
LOWER IN rectum0.090909
control0.075676
rattus norvegicus0.071429
LOWER IN control0.070270
antibiotic0.062500
israel0.058824
feces0.057325
c57bl/60.055556
inflammatory bowel disease0.045455
LOWER IN inflammatory bowel disease0.045455
homo sapiens0.044280
united states of america0.040486
adult0.040462
canada0.040000
state of california0.038462
mouse0.035088
research facility0.034014
mus musculus0.031746
male0.030303
china0.029070
immature stage0.028571
LOWER IN child0.027778
LOWER IN feces0.003185
LOWER IN antibiotics induced colitis0.000000
antibiotics induced colitis0.000000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.900000
homo sapiens0.700000
united states of america0.533333
ulcerative colitis0.466667
adult0.383333
china0.316667
control0.233333
child0.233333
LOWER IN ulcerative colitis0.216667
LOWER IN control0.216667
research facility0.216667
colitis0.216667
rat0.166667
LOWER IN colitis0.133333
sprague dawley0.133333
human adult stage0.116667
crohn's disease0.100000
clostridium difficile colitis0.100000
rattus0.100000
rectum0.100000
biopsy0.100000
clostridium difficile infection0.083333
LOWER IN crohn&#39;s disease0.066667
guangzhou city prefecture0.066667
rattus norvegicus0.066667
male0.066667
equus caballus0.066667
horse0.066667
adult organism0.066667
state of california0.066667
commonwealth of pennsylvania0.066667
hospital0.066667
tucson0.066667
mus musculus0.050000
mouse0.050000
tnbs0.050000
antibiotic0.050000
antibiotics induced colitis0.050000
acute severe colitis0.050000
intestinal mucosa0.050000
inflammatory bowel disease0.050000
biopsy site0.050000
atlanta0.033333
obsolete_juvenile stage0.033333
age<17 years0.033333
immature stage0.033333
adolescent stage0.033333
LOWER IN antibiotic0.033333
canada0.033333
province of alberta0.033333
czech republic0.033333
wistar rat0.033333
c57bl/60.033333
israel0.033333
mild0.033333
LOWER IN severe0.033333
severe0.033333
LOWER IN mild0.033333
diarrhea0.033333
balb/c0.016667
state of texas0.016667
clostridium difficile intestinal infectious disease0.016667
humanized mouse0.016667
LOWER IN tnbs0.016667
LOWER IN antibiotics induced colitis0.016667
iga positive fraction0.016667
LOWER IN iga negative fraction0.016667
iga negative fraction0.016667
LOWER IN iga positive fraction0.016667
LOWER IN dnbs induced colitis0.016667
dnbs induced colitis0.016667
dss induced colitis0.016667
LOWER IN dss induced colitis0.016667
before antibiotics0.016667
LOWER IN vancomycin0.016667
LOWER IN metronidazole0.016667
LOWER IN amoxicillin0.016667
LOWER IN doxycycline0.016667
LOWER IN sulfasalazine0.016667
sulfasalazine0.016667
LOWER IN rectum0.016667
LOWER IN biopsy site0.016667
LOWER IN biopsy0.016667
LOWER IN child0.016667
LOWER IN inflammatory bowel disease0.016667
LOWER IN feces0.016667
LOWER IN non c. diff diarrhea0.016667
non c. diff diarrhea0.016667
LOWER IN clostridium difficile colitis0.016667
LOWER IN clostridium difficile infection0.016667
Exp. ID User ID Description Date Region Flag Sequences
689amnon high in non c. diff diarrhea compared to clostridium difficile colitis clostridium difficile infection in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 1
399amnon high in crohn's disease compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 3
689amnon high in clostridium difficile colitis clostridium difficile infection compared to non c. diff diarrhea in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 3
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in feces united states of america mus musculus balb/c state of texas mouse )2017-10-06v4No1 / 4
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile colitis clostridium difficile intestinal infectious disease compared to control in feces united states of america research facility humanized mouse )2018-04-29v4No1 / 4
779amnon high in ulcerative colitis compared to control in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 5
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 5
868amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 6
856amnon high in control compared to ulcerative colitis ulcerative colitis in homo sapiens rectum adult biopsy intestinal mucosa china human adult stage 2022-01-09v3No1 / 6
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
866amnon high in ulcerative colitis ulcerative colitis compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 9
221amnonhigher in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in sulfasalazine compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 11
868amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens clostridium difficile colitis adult canada clostridium difficile infection province of alberta human adult stage 2022-02-12v4No1 / 13
902amnondominant feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 16
659amnondominant feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 16
659amnon high in before antibiotics compared to antibiotic vancomycin metronidazole amoxicillin doxycycline in feces homo sapiens ulcerative colitis child acute severe colitis 2020-09-19v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in feces homo sapiens united states of america child )2018-11-22v4No1 / 18
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
292amnondominant feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 20
866amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 20
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
442amnonhigh freq. in tnbs induced colitis in rat feces (dominant feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 21
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
779amnondominant feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 23
779amnoncommon feces, homo sapiens, ulcerative colitis, adult, guangzhou city prefecture, china2021-04-28v4No1 / 25
856amnondominant homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 26
659amnoncommon feces, homo sapiens, ulcerative colitis, child, acute severe colitis2020-09-19v4No1 / 27
779amnon high in control compared to ulcerative colitis in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 28
292amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens adult china 2018-02-05v4No1 / 32
856amnoncommon homo sapiens, rectum, ulcerative colitis, adult, biopsy, intestinal mucosa, ulcerative colitis, china, human adult stage2022-01-09v3No1 / 33
399amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 36
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 38
221amnonlower in induced colitis treated with Sulfasalazine compared to no Sulfasalazine in rat feces ( high in colitis compared to sulfasalazine in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 44
399amnon high in ulcerative colitis compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 47
442amnonlower in tnbs induced colitis compared to controls ( high in control compared to tnbs colitis in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 49
221amnonhigher in control compared to tnbs induced colitis in rat feces ( high in control compared to colitis in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 49
292amnoncommon feces, homo sapiens, adult, ulcerative colitis, china2018-02-05v4No1 / 53
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
442amnonhigher in tnbs induced colitis compared to controls ( high in tnbs colitis compared to control in feces research facility rattus norvegicus sprague dawley male rat china )2019-01-06v4No1 / 63
902amnoncommon feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 68
221amnonlower in control compared to tnbs induced colitis in rat feces ( high in colitis compared to control in feces research facility sprague dawley rattus rat china )2017-10-25v4No1 / 68
394amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 71
334amnonhigher in dss induced colitis compared to controls ( high in dss induced colitis colitis compared to control in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 83
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
334amnonlower in dss induced colitis compared to controls ( high in control compared to dss induced colitis colitis in feces research facility mus musculus c57bl/6 israel mouse )2018-05-15v4No1 / 153
358amnonhigher in dnbs induced colitis compared to controls in rat feces ( high in dnbs induced colitis colitis compared to control in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 154
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
442amnoncommon in tnbs induced colitis in rat feces (common feces, research facility, rattus norvegicus, sprague dawley, male, rat, tnbs, colitis, china)2019-01-06v4No1 / 360
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 364
358amnonlower in dnbs induced colitis compared to controls in rat feces ( high in control compared to dnbs induced colitis colitis in feces research facility rattus czech republic rat wistar rat )2018-08-19v4No1 / 754
902amnon high in control compared to colitis antibiotic colitis antibiotics induced colitis in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 1755

Problems / suggestions? Please email info AT dbbact DOT org